Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP043163 Bordetella parapertussis strain H102 chromosome, complete genome 7 crisprs RT,csa3,DEDDh,cas3,DinG 1 0 1 0

Results visualization

1. NZ_CP043163
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP043163_1 822608-822764 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP043163_2 1052557-1052643 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP043163_3 2199068-2199154 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP043163_4 3091686-3091782 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP043163_5 3767644-3767725 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP043163_6 3920669-3920753 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP043163_7 4131341-4131434 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP043163_1 1.2|822722|24|NZ_CP043163|PILER-CR 822722-822745 24 NZ_CP043163.1 822584-822607 0 1.0
NZ_CP043163_1 1.2|822722|24|NZ_CP043163|PILER-CR 822722-822745 24 NZ_CP043163.1 822794-822817 0 1.0

1. spacer 1.2|822722|24|NZ_CP043163|PILER-CR matches to position: 822584-822607, mismatch: 0, identity: 1.0

ggactggcaccggcaagatttcac	CRISPR spacer
ggactggcaccggcaagatttcac	Protospacer
************************

2. spacer 1.2|822722|24|NZ_CP043163|PILER-CR matches to position: 822794-822817, mismatch: 0, identity: 1.0

ggactggcaccggcaagatttcac	CRISPR spacer
ggactggcaccggcaagatttcac	Protospacer
************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3294570 : 3302636 9 uncultured_Mediterranean_phage(28.57%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage