Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP045783 Klebsiella variicola strain LEMB11 chromosome, complete genome 2 crisprs DinG,DEDDh,csa3,cas3,WYL,cas3HD 0 3 5 0

Results visualization

1. NZ_CP045783
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045783_1 737035-737246 Orphan I-E,II-B
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045783_2 2655605-2655726 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP045783_1 1.1|737064|32|NZ_CP045783|CRISPRCasFinder 737064-737095 32 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 144602-144633 7 0.781
NZ_CP045783_1 1.3|737186|32|NZ_CP045783|CRISPRCasFinder 737186-737217 32 NC_017639 Escherichia coli UMNK88 plasmid pUMNK88_K88, complete sequence 43367-43398 7 0.781
NZ_CP045783_1 1.3|737186|32|NZ_CP045783|CRISPRCasFinder 737186-737217 32 NZ_MG904991 Escherichia coli strain 14OD0056 plasmid p14ODK88, complete sequence 27614-27645 7 0.781
NZ_CP045783_2 2.1|2655651|30|NZ_CP045783|CRISPRCasFinder 2655651-2655680 30 LR134122 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2 515240-515269 7 0.767
NZ_CP045783_2 2.1|2655651|30|NZ_CP045783|CRISPRCasFinder 2655651-2655680 30 LR134122 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2 515452-515481 7 0.767
NZ_CP045783_2 2.1|2655651|30|NZ_CP045783|CRISPRCasFinder 2655651-2655680 30 CP052389 Klebsiella pneumoniae strain C17KP0052 plasmid pC17KP0052-1 228253-228282 7 0.767
NZ_CP045783_1 1.1|737064|32|NZ_CP045783|CRISPRCasFinder 737064-737095 32 KT264832 Gokushovirus WZ-2015a isolate 84Fx6, complete genome 3342-3373 8 0.75
NZ_CP045783_1 1.3|737186|32|NZ_CP045783|CRISPRCasFinder 737186-737217 32 NZ_CP026279 Klebsiella oxytoca strain KONIH2 plasmid pKOR-b08d, complete sequence 21433-21464 8 0.75
NZ_CP045783_1 1.3|737186|32|NZ_CP045783|CRISPRCasFinder 737186-737217 32 NZ_KT148595 Klebsiella pneumoniae subsp. pneumoniae strain GN1006 plasmid pKPC-SMH, complete sequence 52447-52478 8 0.75
NZ_CP045783_1 1.3|737186|32|NZ_CP045783|CRISPRCasFinder 737186-737217 32 NZ_CP017587 Pantoea stewartii subsp. stewartii DC283 plasmid pDSJ06, complete sequence 39975-40006 8 0.75
NZ_CP045783_1 1.3|737186|32|NZ_CP045783|CRISPRCasFinder 737186-737217 32 NZ_CP026274 Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence 167792-167823 8 0.75
NZ_CP045783_1 1.3|737186|32|NZ_CP045783|CRISPRCasFinder 737186-737217 32 NZ_CP050010 Citrobacter sp. Y3 plasmid unnamed1, complete sequence 11481-11512 8 0.75
NZ_CP045783_1 1.3|737186|32|NZ_CP045783|CRISPRCasFinder 737186-737217 32 NZ_CP027617 Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed5, complete sequence 53590-53621 8 0.75
NZ_CP045783_1 1.3|737186|32|NZ_CP045783|CRISPRCasFinder 737186-737217 32 NZ_CP029112 Escherichia coli strain AR436 plasmid unnamed3, complete sequence 15085-15116 8 0.75
NZ_CP045783_1 1.3|737186|32|NZ_CP045783|CRISPRCasFinder 737186-737217 32 NZ_CP026205 Escherichia coli strain ECONIH5 plasmid pKPC-e3ee, complete sequence 21065-21096 8 0.75
NZ_CP045783_1 1.3|737186|32|NZ_CP045783|CRISPRCasFinder 737186-737217 32 NZ_CP026184 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-af73, complete sequence 15917-15948 8 0.75
NZ_CP045783_1 1.3|737186|32|NZ_CP045783|CRISPRCasFinder 737186-737217 32 NZ_CP035471 Escherichia coli strain U12A plasmid pU12A_D, complete sequence 29488-29519 8 0.75
NZ_CP045783_1 1.3|737186|32|NZ_CP045783|CRISPRCasFinder 737186-737217 32 NZ_CP026232 Citrobacter freundii complex sp. CFNIH4 plasmid pKPC-c9fd, complete sequence 6134-6165 8 0.75
NZ_CP045783_1 1.3|737186|32|NZ_CP045783|CRISPRCasFinder 737186-737217 32 NZ_CP019907 Escherichia coli strain MDR_56 plasmid unnamed2, complete sequence 6224-6255 8 0.75
NZ_CP045783_1 1.3|737186|32|NZ_CP045783|CRISPRCasFinder 737186-737217 32 NZ_AP018688 Vibrio rumoiensis strain FERM P-14531 plasmid 2, complete sequence 26264-26295 8 0.75
NZ_CP045783_1 1.3|737186|32|NZ_CP045783|CRISPRCasFinder 737186-737217 32 KX863569 Uncultured bacterium plasmid pTRE-131 clone TRE-131, complete sequence 32608-32639 8 0.75
NZ_CP045783_1 1.3|737186|32|NZ_CP045783|CRISPRCasFinder 737186-737217 32 NZ_CP027125 Escherichia coli strain AR_0374 plasmid unnamed3 40334-40365 8 0.75
NZ_CP045783_1 1.3|737186|32|NZ_CP045783|CRISPRCasFinder 737186-737217 32 NZ_CP010382 Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-53.129kb, complete sequence 20606-20637 8 0.75
NZ_CP045783_1 1.3|737186|32|NZ_CP045783|CRISPRCasFinder 737186-737217 32 NZ_CP013631 Rhizobium sp. N324 plasmid pRspN324a, complete sequence 254977-255008 8 0.75
NZ_CP045783_1 1.3|737186|32|NZ_CP045783|CRISPRCasFinder 737186-737217 32 NZ_CP035002 Rhizobium acidisoli strain FH23 plasmid pRapFH23d, complete sequence 449486-449517 8 0.75
NZ_CP045783_2 2.1|2655651|30|NZ_CP045783|CRISPRCasFinder 2655651-2655680 30 LR134122 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2 515346-515375 8 0.733
NZ_CP045783_2 2.1|2655651|30|NZ_CP045783|CRISPRCasFinder 2655651-2655680 30 LR134122 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2 515557-515586 8 0.733
NZ_CP045783_2 2.1|2655651|30|NZ_CP045783|CRISPRCasFinder 2655651-2655680 30 CP052389 Klebsiella pneumoniae strain C17KP0052 plasmid pC17KP0052-1 32008-32037 8 0.733
NZ_CP045783_1 1.1|737064|32|NZ_CP045783|CRISPRCasFinder 737064-737095 32 MN276049 Acinetobacter phage BS46, complete genome 89442-89473 9 0.719
NZ_CP045783_1 1.3|737186|32|NZ_CP045783|CRISPRCasFinder 737186-737217 32 NZ_KX784503 Citrobacter freundii strain 17285 plasmid p17285-IMP, complete sequence 31825-31856 9 0.719
NZ_CP045783_1 1.3|737186|32|NZ_CP045783|CRISPRCasFinder 737186-737217 32 NZ_KX784502 Klebsiella oxytoca strain 7121 plasmid p7121-IMP, complete sequence 40596-40627 9 0.719
NZ_CP045783_1 1.3|737186|32|NZ_CP045783|CRISPRCasFinder 737186-737217 32 NZ_CP015078 Escherichia coli strain Ecol_448 plasmid pEC448_OXA163, complete sequence 45466-45497 9 0.719
NZ_CP045783_1 1.3|737186|32|NZ_CP045783|CRISPRCasFinder 737186-737217 32 NZ_KT345947 Klebsiella pneumoniae strain 2013050801 plasmid p0801-IMP, complete sequence 40716-40747 9 0.719
NZ_CP045783_1 1.3|737186|32|NZ_CP045783|CRISPRCasFinder 737186-737217 32 NZ_CP034403 Escherichia coli strain CRE10 plasmid pCRE10.4, complete sequence 5332-5363 9 0.719
NZ_CP045783_1 1.3|737186|32|NZ_CP045783|CRISPRCasFinder 737186-737217 32 NZ_CP010378 Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-59.134kb, complete sequence 37387-37418 9 0.719
NZ_CP045783_1 1.3|737186|32|NZ_CP045783|CRISPRCasFinder 737186-737217 32 NZ_EF219134 Klebsiella pneumoniae isolate JIE137 plasmid pJIE137, complete sequence 30090-30121 9 0.719
NZ_CP045783_1 1.3|737186|32|NZ_CP045783|CRISPRCasFinder 737186-737217 32 MN967025 Klebsiella pneumoniae strain KP2611 plasmid pKP2611-N, complete sequence 60155-60186 9 0.719
NZ_CP045783_1 1.3|737186|32|NZ_CP045783|CRISPRCasFinder 737186-737217 32 NZ_CP022277 Citrobacter freundii strain 18-1 plasmid pD18-1, complete sequence 38641-38672 9 0.719
NZ_CP045783_1 1.3|737186|32|NZ_CP045783|CRISPRCasFinder 737186-737217 32 MK368725 Escherichia coli strain JN24 plasmid pJN24NDM1, complete sequence 40375-40406 9 0.719
NZ_CP045783_1 1.3|737186|32|NZ_CP045783|CRISPRCasFinder 737186-737217 32 NC_019163 Klebsiella pneumoniae plasmid pTR4, complete sequence 40373-40404 9 0.719
NZ_CP045783_1 1.3|737186|32|NZ_CP045783|CRISPRCasFinder 737186-737217 32 NZ_CP024879 Klebsiella pneumoniae strain NH25 plasmid pNH25.5, complete sequence 5438-5469 9 0.719
NZ_CP045783_1 1.3|737186|32|NZ_CP045783|CRISPRCasFinder 737186-737217 32 NZ_CP043856 Enterobacter hormaechei strain EB_P6_L3_02.19 plasmid pIMPIncN3_52kb, complete sequence 14251-14282 9 0.719
NZ_CP045783_1 1.3|737186|32|NZ_CP045783|CRISPRCasFinder 737186-737217 32 NZ_LT985223 Escherichia coli strain 711 plasmid RCS25_p, complete sequence 34076-34107 9 0.719
NZ_CP045783_1 1.3|737186|32|NZ_CP045783|CRISPRCasFinder 737186-737217 32 NZ_CP034398 Escherichia coli strain CRE1 plasmid pCRE1.4, complete sequence 37835-37866 9 0.719
NZ_CP045783_1 1.3|737186|32|NZ_CP045783|CRISPRCasFinder 737186-737217 32 NZ_CP042548 Klebsiella michiganensis strain C52 plasmid pC52_003, complete sequence 37617-37648 9 0.719
NZ_CP045783_1 1.3|737186|32|NZ_CP045783|CRISPRCasFinder 737186-737217 32 NC_015872 Escherichia coli plasmid p271A, complete sequence 13991-14022 9 0.719
NZ_CP045783_1 1.3|737186|32|NZ_CP045783|CRISPRCasFinder 737186-737217 32 NZ_CP040826 Enterobacter cloacae strain NH77 plasmid pEcloNH77, complete sequence 435-466 9 0.719
NZ_CP045783_1 1.3|737186|32|NZ_CP045783|CRISPRCasFinder 737186-737217 32 NZ_CP043516 Enterobacter kobei strain EB_P8_L5_01.19 plasmid pIMPIncN3_57kb, complete sequence 2069-2100 9 0.719
NZ_CP045783_1 1.3|737186|32|NZ_CP045783|CRISPRCasFinder 737186-737217 32 NZ_CP027137 Escherichia coli strain AR_0369 plasmid unnamed1, complete sequence 19092-19123 9 0.719
NZ_CP045783_1 1.3|737186|32|NZ_CP045783|CRISPRCasFinder 737186-737217 32 MN583554 Escherichia coli strain M17224 plasmid p17511_70, complete sequence 52346-52377 9 0.719
NZ_CP045783_1 1.3|737186|32|NZ_CP045783|CRISPRCasFinder 737186-737217 32 NZ_LT985250 Escherichia coli strain 170 plasmid RCS38_p, complete sequence 174143-174174 9 0.719
NZ_CP045783_1 1.3|737186|32|NZ_CP045783|CRISPRCasFinder 737186-737217 32 NC_024954 Escherichia coli strain ECS01 plasmid pNDM-ECS01, complete sequence 40375-40406 9 0.719
NZ_CP045783_1 1.3|737186|32|NZ_CP045783|CRISPRCasFinder 737186-737217 32 AM749121 Streptococcus phage M102 complete genome 25689-25720 9 0.719
NZ_CP045783_1 1.3|737186|32|NZ_CP045783|CRISPRCasFinder 737186-737217 32 MT430910 Streptococcus phage smHBZ8, complete genome 6059-6090 9 0.719
NZ_CP045783_1 1.3|737186|32|NZ_CP045783|CRISPRCasFinder 737186-737217 32 NC_012884 Streptococcus phage M102, complete genome 25689-25720 9 0.719

1. spacer 1.1|737064|32|NZ_CP045783|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.781

ccgaacagggaagcggagagtttttctttttt	CRISPR spacer
ccgaacagggaagcggaaagttttgctgacaa	Protospacer
*****************.****** **  .  

2. spacer 1.3|737186|32|NZ_CP045783|CRISPRCasFinder matches to NC_017639 (Escherichia coli UMNK88 plasmid pUMNK88_K88, complete sequence) position: , mismatch: 7, identity: 0.781

gtcacgtatatgcgcctgctagatgatgctga	CRISPR spacer
gcccctgatatgcgcttgctggatgatgctgg	Protospacer
*.* *  ********.****.**********.

3. spacer 1.3|737186|32|NZ_CP045783|CRISPRCasFinder matches to NZ_MG904991 (Escherichia coli strain 14OD0056 plasmid p14ODK88, complete sequence) position: , mismatch: 7, identity: 0.781

gtcacgtatatgcgcctgctagatgatgctga	CRISPR spacer
gcccctgatatgcgcttgctggatgatgctgg	Protospacer
*.* *  ********.****.**********.

4. spacer 2.1|2655651|30|NZ_CP045783|CRISPRCasFinder matches to LR134122 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2) position: , mismatch: 7, identity: 0.767

tattccctgctcgcgctacgcttaattccg	CRISPR spacer
atttccctgctcgcgctacgcttagcaggg	Protospacer
  **********************..   *

5. spacer 2.1|2655651|30|NZ_CP045783|CRISPRCasFinder matches to LR134122 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2) position: , mismatch: 7, identity: 0.767

tattccctgctcgcgctacgcttaattccg	CRISPR spacer
atttccctgctcgcgctacgcttagcaggg	Protospacer
  **********************..   *

6. spacer 2.1|2655651|30|NZ_CP045783|CRISPRCasFinder matches to CP052389 (Klebsiella pneumoniae strain C17KP0052 plasmid pC17KP0052-1) position: , mismatch: 7, identity: 0.767

tattccctgctcgcgctacgcttaattccg	CRISPR spacer
gcttccctgctcgcgctacgcttagcaggg	Protospacer
  **********************..   *

7. spacer 1.1|737064|32|NZ_CP045783|CRISPRCasFinder matches to KT264832 (Gokushovirus WZ-2015a isolate 84Fx6, complete genome) position: , mismatch: 8, identity: 0.75

ccgaacagggaagcggagagtttttctttttt	CRISPR spacer
tttacccgcgaagcggaaagtttttatttttt	Protospacer
.. * * * ********.******* ******

8. spacer 1.3|737186|32|NZ_CP045783|CRISPRCasFinder matches to NZ_CP026279 (Klebsiella oxytoca strain KONIH2 plasmid pKOR-b08d, complete sequence) position: , mismatch: 8, identity: 0.75

gtcacgtatatgcgcctgctagatgatgctga	CRISPR spacer
cctgagcttatgcgcctgctaaatgatgctga	Protospacer
 ... *. *************.**********

9. spacer 1.3|737186|32|NZ_CP045783|CRISPRCasFinder matches to NZ_KT148595 (Klebsiella pneumoniae subsp. pneumoniae strain GN1006 plasmid pKPC-SMH, complete sequence) position: , mismatch: 8, identity: 0.75

gtcacgtatatgcgcctgctagatgatgctga	CRISPR spacer
cctgagcttatgcgcctgctaaatgatgctga	Protospacer
 ... *. *************.**********

10. spacer 1.3|737186|32|NZ_CP045783|CRISPRCasFinder matches to NZ_CP017587 (Pantoea stewartii subsp. stewartii DC283 plasmid pDSJ06, complete sequence) position: , mismatch: 8, identity: 0.75

gtcacgtatatgcgcctgctagatgatgctga	CRISPR spacer
cctgagcttatgcgcctgctaaatgatgctga	Protospacer
 ... *. *************.**********

11. spacer 1.3|737186|32|NZ_CP045783|CRISPRCasFinder matches to NZ_CP026274 (Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence) position: , mismatch: 8, identity: 0.75

gtcacgtatatgcgcctgctagatgatgctga	CRISPR spacer
cctgagcttatgcgcctgctaaatgatgctga	Protospacer
 ... *. *************.**********

12. spacer 1.3|737186|32|NZ_CP045783|CRISPRCasFinder matches to NZ_CP050010 (Citrobacter sp. Y3 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

gtcacgtatatgcgcctgctagatgatgctga	CRISPR spacer
cctgagcttatgcgcctgctaaatgatgctga	Protospacer
 ... *. *************.**********

13. spacer 1.3|737186|32|NZ_CP045783|CRISPRCasFinder matches to NZ_CP027617 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.75

gtcacgtatatgcgcctgctagatgatgctga	CRISPR spacer
cctgagcttatgcgcctgctaaatgatgctga	Protospacer
 ... *. *************.**********

14. spacer 1.3|737186|32|NZ_CP045783|CRISPRCasFinder matches to NZ_CP029112 (Escherichia coli strain AR436 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75

gtcacgtatatgcgcctgctagatgatgctga	CRISPR spacer
cctgagcttatgcgcctgctaaatgatgctga	Protospacer
 ... *. *************.**********

15. spacer 1.3|737186|32|NZ_CP045783|CRISPRCasFinder matches to NZ_CP026205 (Escherichia coli strain ECONIH5 plasmid pKPC-e3ee, complete sequence) position: , mismatch: 8, identity: 0.75

gtcacgtatatgcgcctgctagatgatgctga	CRISPR spacer
cctgagcttatgcgcctgctaaatgatgctga	Protospacer
 ... *. *************.**********

16. spacer 1.3|737186|32|NZ_CP045783|CRISPRCasFinder matches to NZ_CP026184 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-af73, complete sequence) position: , mismatch: 8, identity: 0.75

gtcacgtatatgcgcctgctagatgatgctga	CRISPR spacer
cctgagcttatgcgcctgctaaatgatgctga	Protospacer
 ... *. *************.**********

17. spacer 1.3|737186|32|NZ_CP045783|CRISPRCasFinder matches to NZ_CP035471 (Escherichia coli strain U12A plasmid pU12A_D, complete sequence) position: , mismatch: 8, identity: 0.75

gtcacgtatatgcgcctgctagatgatgctga	CRISPR spacer
cctgagcttatgcgcctgctaaatgatgctga	Protospacer
 ... *. *************.**********

18. spacer 1.3|737186|32|NZ_CP045783|CRISPRCasFinder matches to NZ_CP026232 (Citrobacter freundii complex sp. CFNIH4 plasmid pKPC-c9fd, complete sequence) position: , mismatch: 8, identity: 0.75

gtcacgtatatgcgcctgctagatgatgctga	CRISPR spacer
cctgagcttatgcgcctgctaaatgatgctga	Protospacer
 ... *. *************.**********

19. spacer 1.3|737186|32|NZ_CP045783|CRISPRCasFinder matches to NZ_CP019907 (Escherichia coli strain MDR_56 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

gtcacgtatatgcgcctgctagatgatgctga	CRISPR spacer
cctgagcttatgcgcctgctaaatgatgctga	Protospacer
 ... *. *************.**********

20. spacer 1.3|737186|32|NZ_CP045783|CRISPRCasFinder matches to NZ_AP018688 (Vibrio rumoiensis strain FERM P-14531 plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.75

gtcacgtatatgcgcctgctagatgatgctga	CRISPR spacer
cctgagcttatgcgcctgctaaatgatgctga	Protospacer
 ... *. *************.**********

21. spacer 1.3|737186|32|NZ_CP045783|CRISPRCasFinder matches to KX863569 (Uncultured bacterium plasmid pTRE-131 clone TRE-131, complete sequence) position: , mismatch: 8, identity: 0.75

gtcacgtatatgcgcctgctagatgatgctga	CRISPR spacer
cctgagcttatgcgcctgctaaatgatgctga	Protospacer
 ... *. *************.**********

22. spacer 1.3|737186|32|NZ_CP045783|CRISPRCasFinder matches to NZ_CP027125 (Escherichia coli strain AR_0374 plasmid unnamed3) position: , mismatch: 8, identity: 0.75

gtcacgtatatgcgcctgctagatgatgctga	CRISPR spacer
cctgagcttatgcgcctgctaaatgatgctga	Protospacer
 ... *. *************.**********

23. spacer 1.3|737186|32|NZ_CP045783|CRISPRCasFinder matches to NZ_CP010382 (Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-53.129kb, complete sequence) position: , mismatch: 8, identity: 0.75

gtcacgtatatgcgcctgctagatgatgctga	CRISPR spacer
cctgagcttatgcgcctgctaaatgatgctga	Protospacer
 ... *. *************.**********

24. spacer 1.3|737186|32|NZ_CP045783|CRISPRCasFinder matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 8, identity: 0.75

gtcacgtatatgcgcctgctagatgatgctga	CRISPR spacer
ggccggctgatgcgcctgcttgatgttgctga	Protospacer
* *  *.  *********** **** ******

25. spacer 1.3|737186|32|NZ_CP045783|CRISPRCasFinder matches to NZ_CP035002 (Rhizobium acidisoli strain FH23 plasmid pRapFH23d, complete sequence) position: , mismatch: 8, identity: 0.75

gtcacgtatatgcgcctgctagatgatgctga	CRISPR spacer
ggccggctgatgcgcctgcttgatgttgctga	Protospacer
* *  *.  *********** **** ******

26. spacer 2.1|2655651|30|NZ_CP045783|CRISPRCasFinder matches to LR134122 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2) position: , mismatch: 8, identity: 0.733

tattccctgctcgcgctacgcttaattccg	CRISPR spacer
atttccctgctcgcgctgcgcttagcaggg	Protospacer
  ***************.******..   *

27. spacer 2.1|2655651|30|NZ_CP045783|CRISPRCasFinder matches to LR134122 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2) position: , mismatch: 8, identity: 0.733

tattccctgctcgcgctacgcttaattccg	CRISPR spacer
atttccctgctcgcgctgcgcttagcaggg	Protospacer
  ***************.******..   *

28. spacer 2.1|2655651|30|NZ_CP045783|CRISPRCasFinder matches to CP052389 (Klebsiella pneumoniae strain C17KP0052 plasmid pC17KP0052-1) position: , mismatch: 8, identity: 0.733

tattccctgctcgcgctacgcttaattccg	CRISPR spacer
ttgtccctgcttgcgctacgcttagcaggg	Protospacer
*  ********.************..   *

29. spacer 1.1|737064|32|NZ_CP045783|CRISPRCasFinder matches to MN276049 (Acinetobacter phage BS46, complete genome) position: , mismatch: 9, identity: 0.719

ccgaacagggaagcggagagtttttctttttt	CRISPR spacer
tagaacagggaagtggagagtttttaaccctg	Protospacer
. ***********.***********  ...* 

30. spacer 1.3|737186|32|NZ_CP045783|CRISPRCasFinder matches to NZ_KX784503 (Citrobacter freundii strain 17285 plasmid p17285-IMP, complete sequence) position: , mismatch: 9, identity: 0.719

gtcacgtatatgcgcctgctagatgatgctga	CRISPR spacer
cctgagcttatgcgcctgctaagtgatgctga	Protospacer
 ... *. *************..*********

31. spacer 1.3|737186|32|NZ_CP045783|CRISPRCasFinder matches to NZ_KX784502 (Klebsiella oxytoca strain 7121 plasmid p7121-IMP, complete sequence) position: , mismatch: 9, identity: 0.719

gtcacgtatatgcgcctgctagatgatgctga	CRISPR spacer
cctgagcttatgcgcctgctaagtgatgctga	Protospacer
 ... *. *************..*********

32. spacer 1.3|737186|32|NZ_CP045783|CRISPRCasFinder matches to NZ_CP015078 (Escherichia coli strain Ecol_448 plasmid pEC448_OXA163, complete sequence) position: , mismatch: 9, identity: 0.719

gtcacgtatatgcgcctgctagatgatgctga	CRISPR spacer
cctgagcttatgcgcctgctaagtgatgctga	Protospacer
 ... *. *************..*********

33. spacer 1.3|737186|32|NZ_CP045783|CRISPRCasFinder matches to NZ_KT345947 (Klebsiella pneumoniae strain 2013050801 plasmid p0801-IMP, complete sequence) position: , mismatch: 9, identity: 0.719

gtcacgtatatgcgcctgctagatgatgctga	CRISPR spacer
cctgagcttatgcgcctgctaagtgatgctga	Protospacer
 ... *. *************..*********

34. spacer 1.3|737186|32|NZ_CP045783|CRISPRCasFinder matches to NZ_CP034403 (Escherichia coli strain CRE10 plasmid pCRE10.4, complete sequence) position: , mismatch: 9, identity: 0.719

gtcacgtatatgcgcctgctagatgatgctga	CRISPR spacer
cctgagcttatgcgcctgctaagtgatgctga	Protospacer
 ... *. *************..*********

35. spacer 1.3|737186|32|NZ_CP045783|CRISPRCasFinder matches to NZ_CP010378 (Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-59.134kb, complete sequence) position: , mismatch: 9, identity: 0.719

gtcacgtatatgcgcctgctagatgatgctga	CRISPR spacer
cctgagcttatgcgcctgctaagtgatgctga	Protospacer
 ... *. *************..*********

36. spacer 1.3|737186|32|NZ_CP045783|CRISPRCasFinder matches to NZ_EF219134 (Klebsiella pneumoniae isolate JIE137 plasmid pJIE137, complete sequence) position: , mismatch: 9, identity: 0.719

gtcacgtatatgcgcctgctagatgatgctga	CRISPR spacer
cctgagcttatgcgcctgctaagtgatgctga	Protospacer
 ... *. *************..*********

37. spacer 1.3|737186|32|NZ_CP045783|CRISPRCasFinder matches to MN967025 (Klebsiella pneumoniae strain KP2611 plasmid pKP2611-N, complete sequence) position: , mismatch: 9, identity: 0.719

gtcacgtatatgcgcctgctagatgatgctga	CRISPR spacer
cctgagcttatgcgcctgctaagtgatgctga	Protospacer
 ... *. *************..*********

38. spacer 1.3|737186|32|NZ_CP045783|CRISPRCasFinder matches to NZ_CP022277 (Citrobacter freundii strain 18-1 plasmid pD18-1, complete sequence) position: , mismatch: 9, identity: 0.719

gtcacgtatatgcgcctgctagatgatgctga	CRISPR spacer
cctgagcttatgcgcctgctaagtgatgctga	Protospacer
 ... *. *************..*********

39. spacer 1.3|737186|32|NZ_CP045783|CRISPRCasFinder matches to MK368725 (Escherichia coli strain JN24 plasmid pJN24NDM1, complete sequence) position: , mismatch: 9, identity: 0.719

gtcacgtatatgcgcctgctagatgatgctga	CRISPR spacer
cctgagcttatgcgcctgctaagtgatgctga	Protospacer
 ... *. *************..*********

40. spacer 1.3|737186|32|NZ_CP045783|CRISPRCasFinder matches to NC_019163 (Klebsiella pneumoniae plasmid pTR4, complete sequence) position: , mismatch: 9, identity: 0.719

gtcacgtatatgcgcctgctagatgatgctga	CRISPR spacer
cctgagcttatgcgcctgctaagtgatgctga	Protospacer
 ... *. *************..*********

41. spacer 1.3|737186|32|NZ_CP045783|CRISPRCasFinder matches to NZ_CP024879 (Klebsiella pneumoniae strain NH25 plasmid pNH25.5, complete sequence) position: , mismatch: 9, identity: 0.719

gtcacgtatatgcgcctgctagatgatgctga	CRISPR spacer
cctgagcttatgcgcctgctaagtgatgctga	Protospacer
 ... *. *************..*********

42. spacer 1.3|737186|32|NZ_CP045783|CRISPRCasFinder matches to NZ_CP043856 (Enterobacter hormaechei strain EB_P6_L3_02.19 plasmid pIMPIncN3_52kb, complete sequence) position: , mismatch: 9, identity: 0.719

gtcacgtatatgcgcctgctagatgatgctga	CRISPR spacer
cctgagcttatgcgcctgctaagtgatgctga	Protospacer
 ... *. *************..*********

43. spacer 1.3|737186|32|NZ_CP045783|CRISPRCasFinder matches to NZ_LT985223 (Escherichia coli strain 711 plasmid RCS25_p, complete sequence) position: , mismatch: 9, identity: 0.719

gtcacgtatatgcgcctgctagatgatgctga	CRISPR spacer
cctgagcttatgcgcctgctaagtgatgctga	Protospacer
 ... *. *************..*********

44. spacer 1.3|737186|32|NZ_CP045783|CRISPRCasFinder matches to NZ_CP034398 (Escherichia coli strain CRE1 plasmid pCRE1.4, complete sequence) position: , mismatch: 9, identity: 0.719

gtcacgtatatgcgcctgctagatgatgctga	CRISPR spacer
cctgagcttatgcgcctgctaagtgatgctga	Protospacer
 ... *. *************..*********

45. spacer 1.3|737186|32|NZ_CP045783|CRISPRCasFinder matches to NZ_CP042548 (Klebsiella michiganensis strain C52 plasmid pC52_003, complete sequence) position: , mismatch: 9, identity: 0.719

gtcacgtatatgcgcctgctagatgatgctga	CRISPR spacer
cctgagcttatgcgcctgctaagtgatgctga	Protospacer
 ... *. *************..*********

46. spacer 1.3|737186|32|NZ_CP045783|CRISPRCasFinder matches to NC_015872 (Escherichia coli plasmid p271A, complete sequence) position: , mismatch: 9, identity: 0.719

gtcacgtatatgcgcctgctagatgatgctga	CRISPR spacer
cctgagcttatgcgcctgctaagtgatgctga	Protospacer
 ... *. *************..*********

47. spacer 1.3|737186|32|NZ_CP045783|CRISPRCasFinder matches to NZ_CP040826 (Enterobacter cloacae strain NH77 plasmid pEcloNH77, complete sequence) position: , mismatch: 9, identity: 0.719

gtcacgtatatgcgcctgctagatgatgctga	CRISPR spacer
cctgagcttatgcgcctgctaagtgatgctga	Protospacer
 ... *. *************..*********

48. spacer 1.3|737186|32|NZ_CP045783|CRISPRCasFinder matches to NZ_CP043516 (Enterobacter kobei strain EB_P8_L5_01.19 plasmid pIMPIncN3_57kb, complete sequence) position: , mismatch: 9, identity: 0.719

gtcacgtatatgcgcctgctagatgatgctga	CRISPR spacer
cctgagcttatgcgcctgctaagtgatgctga	Protospacer
 ... *. *************..*********

49. spacer 1.3|737186|32|NZ_CP045783|CRISPRCasFinder matches to NZ_CP027137 (Escherichia coli strain AR_0369 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

gtcacgtatatgcgcctgctagatgatgctga	CRISPR spacer
cctgagcttatgcgcctgctaagtgatgctga	Protospacer
 ... *. *************..*********

50. spacer 1.3|737186|32|NZ_CP045783|CRISPRCasFinder matches to MN583554 (Escherichia coli strain M17224 plasmid p17511_70, complete sequence) position: , mismatch: 9, identity: 0.719

gtcacgtatatgcgcctgctagatgatgctga	CRISPR spacer
cctgagcttatgcgcctgctaagtgatgctga	Protospacer
 ... *. *************..*********

51. spacer 1.3|737186|32|NZ_CP045783|CRISPRCasFinder matches to NZ_LT985250 (Escherichia coli strain 170 plasmid RCS38_p, complete sequence) position: , mismatch: 9, identity: 0.719

gtcacgtatatgcgcctgctagatgatgctga	CRISPR spacer
cctgagcttatgcgcctgctaagtgatgctga	Protospacer
 ... *. *************..*********

52. spacer 1.3|737186|32|NZ_CP045783|CRISPRCasFinder matches to NC_024954 (Escherichia coli strain ECS01 plasmid pNDM-ECS01, complete sequence) position: , mismatch: 9, identity: 0.719

gtcacgtatatgcgcctgctagatgatgctga	CRISPR spacer
cctgagcttatgcgcctgctaagtgatgctga	Protospacer
 ... *. *************..*********

53. spacer 1.3|737186|32|NZ_CP045783|CRISPRCasFinder matches to AM749121 (Streptococcus phage M102 complete genome) position: , mismatch: 9, identity: 0.719

gtcacgtatatgcgcctgctagatgatgctga	CRISPR spacer
caagcgtatatacgcatgctagatgataaaga	Protospacer
   .*******.*** ***********.  **

54. spacer 1.3|737186|32|NZ_CP045783|CRISPRCasFinder matches to MT430910 (Streptococcus phage smHBZ8, complete genome) position: , mismatch: 9, identity: 0.719

gtcacgtatatgcgcctgctagatgatgctga	CRISPR spacer
caagcgtatatacgcatgctagatgataaaga	Protospacer
   .*******.*** ***********.  **

55. spacer 1.3|737186|32|NZ_CP045783|CRISPRCasFinder matches to NC_012884 (Streptococcus phage M102, complete genome) position: , mismatch: 9, identity: 0.719

gtcacgtatatgcgcctgctagatgatgctga	CRISPR spacer
caagcgtatatacgcatgctagatgataaaga	Protospacer
   .*******.*** ***********.  **

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 206982 : 217861 9 Escherichia_phage(87.5%) NA NA
DBSCAN-SWA_2 1303096 : 1310024 6 Bacillus_phage(33.33%) tRNA NA
DBSCAN-SWA_3 4849895 : 4859342 8 Dickeya_phage(16.67%) protease,tRNA NA
DBSCAN-SWA_4 5110828 : 5174207 61 Klebsiella_phage(52.5%) terminase,head,portal,holin,tail,integrase,transposase,capsid,tRNA attL 5098287:5098301|attR 5124402:5124416
DBSCAN-SWA_5 5479556 : 5533610 63 Escherichia_phage(33.33%) holin,tail,tRNA,terminase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage