Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP045827 Escherichia coli strain AUSMDU00014361 chromosome, complete genome 6 crisprs csa3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2,cas3,DinG,PrimPol,c2c9_V-U4,DEDDh 0 9 21 0
NZ_CP045829 Escherichia coli strain AUSMDU00014361 plasmid pAUSMDU00014361_02, complete sequence 0 crisprs NA 0 0 2 0
NZ_CP045828 Escherichia coli strain AUSMDU00014361 plasmid pAUSMDU00014361_01, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP045830 Escherichia coli strain AUSMDU00014361 plasmid pAUSMDU00014361_03, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP045827
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045827_1 639052-639169 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045827_2 1028328-1028905 Orphan I-E
9 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045827_3 1054605-1055060 TypeI-E I-E
7 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045827_4 3465139-3465272 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045827_5 3780636-3780780 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045827_6 4627191-4627323 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP045827_6 6.1|4627208|42|NZ_CP045827|PILER-CR 4627208-4627249 42 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141085-141126 0 1.0
NZ_CP045827_6 6.2|4627267|40|NZ_CP045827|PILER-CR 4627267-4627306 40 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141028-141067 2 0.95
NZ_CP045827_3 3.7|1055000|32|NZ_CP045827|PILER-CR,CRISPRCasFinder,CRT 1055000-1055031 32 NZ_CP050442 Tolypothrix sp. PCC 7910 plasmid unnamed2, complete sequence 41503-41534 6 0.812
NZ_CP045827_2 2.6|1028662|32|NZ_CP045827|CRISPRCasFinder,CRT 1028662-1028693 32 NZ_CP010860 Marinovum algicola DG 898 plasmid pMaD5, complete sequence 101414-101445 7 0.781
NZ_CP045827_2 2.9|1028845|32|NZ_CP045827|CRISPRCasFinder,CRT 1028845-1028876 32 KR080197 Mycobacterium phage FlagStaff, complete genome 15476-15507 7 0.781
NZ_CP045827_2 2.6|1028662|32|NZ_CP045827|CRISPRCasFinder,CRT 1028662-1028693 32 NZ_CP010410 Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence 347166-347197 8 0.75
NZ_CP045827_2 2.9|1028845|32|NZ_CP045827|CRISPRCasFinder,CRT 1028845-1028876 32 NZ_CP014600 Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence 15418-15449 8 0.75
NZ_CP045827_3 3.3|1054756|32|NZ_CP045827|PILER-CR,CRISPRCasFinder,CRT 1054756-1054787 32 NZ_CP030355 Novosphingobium sp. P6W plasmid pP6W2, complete sequence 141173-141204 8 0.75
NZ_CP045827_2 2.6|1028662|32|NZ_CP045827|CRISPRCasFinder,CRT 1028662-1028693 32 NZ_CP029777 Deinococcus actinosclerus strain Deinococcus actinosclerus SJTR plasmid unnamed3, complete sequence 89227-89258 9 0.719
NZ_CP045827_2 2.6|1028662|32|NZ_CP045827|CRISPRCasFinder,CRT 1028662-1028693 32 NZ_CP021083 Deinococcus ficus strain CC-FR2-10 plasmid pDFI2, complete sequence 361520-361551 9 0.719
NZ_CP045827_2 2.7|1028723|32|NZ_CP045827|CRISPRCasFinder,CRT 1028723-1028754 32 NZ_CP030074 Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence 224876-224907 9 0.719
NZ_CP045827_2 2.9|1028845|32|NZ_CP045827|CRISPRCasFinder,CRT 1028845-1028876 32 NZ_CP009292 Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence 139210-139241 9 0.719
NZ_CP045827_3 3.5|1054878|32|NZ_CP045827|PILER-CR,CRISPRCasFinder,CRT 1054878-1054909 32 LT599585 Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid 32377-32408 9 0.719
NZ_CP045827_2 2.6|1028662|32|NZ_CP045827|CRISPRCasFinder,CRT 1028662-1028693 32 NZ_CP019037 Massilia putida strain 6NM-7 plasmid unnamed2, complete sequence 354311-354342 10 0.688
NZ_CP045827_2 2.9|1028845|32|NZ_CP045827|CRISPRCasFinder,CRT 1028845-1028876 32 NZ_CP012383 Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence 14130-14161 10 0.688
NZ_CP045827_3 3.3|1054756|32|NZ_CP045827|PILER-CR,CRISPRCasFinder,CRT 1054756-1054787 32 MF417892 Uncultured Caudovirales phage clone 2F_2, partial genome 39822-39853 10 0.688
NZ_CP045827_2 2.2|1028418|32|NZ_CP045827|CRISPRCasFinder,CRT 1028418-1028449 32 MN693839 Marine virus AFVG_250M206, complete genome 38115-38146 11 0.656

1. spacer 6.1|4627208|42|NZ_CP045827|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 0, identity: 1.0 

tgtcacacgcagataaatccaactttcaatattgttaagttc	CRISPR spacer
tgtcacacgcagataaatccaactttcaatattgttaagttc	Protospacer
******************************************

2. spacer 6.2|4627267|40|NZ_CP045827|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 2, identity: 0.95 

catcgcgtagcaaaaagaaattttcaatattgctttatgg	CRISPR spacer
catggcgtagaaaaaagaaattttcaatattgctttatgg	Protospacer
*** ****** *****************************

3. spacer 3.7|1055000|32|NZ_CP045827|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050442 (Tolypothrix sp. PCC 7910 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812 

cggctatggaatttatggagaagtttggtttt	CRISPR spacer
ctcctatggaatttatgcagaagtttagtaat	Protospacer
*  ************** ********.**  *

4. spacer 2.6|1028662|32|NZ_CP045827|CRISPRCasFinder,CRT matches to NZ_CP010860 (Marinovum algicola DG 898 plasmid pMaD5, complete sequence) position: , mismatch: 7, identity: 0.781 

gcgagggg---cagccgttcgcgctgcatgttgat	CRISPR spacer
---agcgatttcagccgttcgagctgcatgtggat	Protospacer
   ** *.   ********** ********* ***

5. spacer 2.9|1028845|32|NZ_CP045827|CRISPRCasFinder,CRT matches to KR080197 (Mycobacterium phage FlagStaff, complete genome) position: , mismatch: 7, identity: 0.781 

gacgccgccgccgcgaagccgtttccgatgtt	CRISPR spacer
gacgccggcgccgcgatgccgttcgccgggtt	Protospacer
******* ******** ******. * . ***

6. spacer 2.6|1028662|32|NZ_CP045827|CRISPRCasFinder,CRT matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

gcgaggggcagccgttcgcgctgca--tgttgat	CRISPR spacer
tggagtcgcagccgttcgcgctgcaggcgctg--	Protospacer
  ***  ******************  .*.**

7. spacer 2.9|1028845|32|NZ_CP045827|CRISPRCasFinder,CRT matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75 

gacgccgccgccgcgaagccgtttccgatgtt	CRISPR spacer
gtcgccgccgccgcgcagccctttccacagcc	Protospacer
* ************* **** *****.  *..

8. spacer 3.3|1054756|32|NZ_CP045827|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030355 (Novosphingobium sp. P6W plasmid pP6W2, complete sequence) position: , mismatch: 8, identity: 0.75 

gaaactgaatcatcattgattacccgcgaaga	CRISPR spacer
aattcacgatcatctttgattatccgcgaaga	Protospacer
.*  *  .****** *******.*********

9. spacer 2.6|1028662|32|NZ_CP045827|CRISPRCasFinder,CRT matches to NZ_CP029777 (Deinococcus actinosclerus strain Deinococcus actinosclerus SJTR plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719 

gcgaggggcagccgttcgcgctgcatgttgat	CRISPR spacer
gcgaggcgctgccgttcgcgctggaactcctg	Protospacer
****** ** ************* *  *.

10. spacer 2.6|1028662|32|NZ_CP045827|CRISPRCasFinder,CRT matches to NZ_CP021083 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI2, complete sequence) position: , mismatch: 9, identity: 0.719 

gcgaggggcagccgttcgcgctgcatgttgat	CRISPR spacer
tcgaggggcagccgctggcgctgctcgaaggc	Protospacer
 *************.* ******* .*  *..

11. spacer 2.7|1028723|32|NZ_CP045827|CRISPRCasFinder,CRT matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

taaggccgtcgccggatcagcctggctatgcc	CRISPR spacer
cggggccgtcgccggatcagccggtctgctgc	Protospacer
...******************* * **..  *

12. spacer 2.9|1028845|32|NZ_CP045827|CRISPRCasFinder,CRT matches to NZ_CP009292 (Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence) position: , mismatch: 9, identity: 0.719 

gacgccgccgccgcgaagccgtttccgatgtt	CRISPR spacer
gaagccgccgccgcgaacccgtttttcccggg	Protospacer
** ************** ******..  .*

13. spacer 3.5|1054878|32|NZ_CP045827|PILER-CR,CRISPRCasFinder,CRT matches to LT599585 (Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid) position: , mismatch: 9, identity: 0.719 

atcaggtaatcgagacacctgtcagcactctc	CRISPR spacer
ccaaggtaatcgagagacctgccagcaaagcc	Protospacer
 . ************ *****.*****   .*

14. spacer 2.6|1028662|32|NZ_CP045827|CRISPRCasFinder,CRT matches to NZ_CP019037 (Massilia putida strain 6NM-7 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688 

gcgaggggcagccgttcgcgctgcatgttgat	CRISPR spacer
tcccggggcagccgttcgcgatgaatgaaacc	Protospacer
 *  **************** ** ***  . .

15. spacer 2.9|1028845|32|NZ_CP045827|CRISPRCasFinder,CRT matches to NZ_CP012383 (Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence) position: , mismatch: 10, identity: 0.688 

gacgccgccgccgcgaagccgtttccgatgtt	CRISPR spacer
ttgcccgccgcggcgaagccgcttccgtcctc	Protospacer
    ******* *********.***** . *.

16. spacer 3.3|1054756|32|NZ_CP045827|PILER-CR,CRISPRCasFinder,CRT matches to MF417892 (Uncultured Caudovirales phage clone 2F_2, partial genome) position: , mismatch: 10, identity: 0.688 

gaaactgaatcatcattgattacccgcgaaga	CRISPR spacer
tgggctgcatcatcattgattacctgcaactg	Protospacer
 ...*** ****************.**.*  .

17. spacer 2.2|1028418|32|NZ_CP045827|CRISPRCasFinder,CRT matches to MN693839 (Marine virus AFVG_250M206, complete genome) position: , mismatch: 11, identity: 0.656 

gaccgtaacactggtaaacctttatccggggt	CRISPR spacer
tttactaaaactggtaaaactttatccgaata	Protospacer
  .  *** ********* *********..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1071415 : 1078555 6 Escherichia_phage(83.33%) NA NA
DBSCAN-SWA_2 1429048 : 1439147 8 Enterobacteria_phage(42.86%) transposase,integrase attL 1423261:1423277|attR 1441157:1441173
DBSCAN-SWA_3 1540139 : 1583318 42 Escherichia_phage(27.27%) holin,transposase,integrase,head,tail,terminase attL 1536826:1536840|attR 1584599:1584613
DBSCAN-SWA_4 1586431 : 1650264 79 Shigella_phage(37.1%) plate,transposase,integrase,protease,head,tail attL 1586692:1586708|attR 1654215:1654231
DBSCAN-SWA_5 1769928 : 1811685 37 Stx2-converting_phage(41.67%) protease,transposase,integrase attL 1763293:1763306|attR 1774434:1774447
DBSCAN-SWA_6 1976778 : 2011583 55 Escherichia_phage(46.81%) holin,transposase,integrase,protease,tail,terminase attL 1977640:1977699|attR 2011660:2011724
DBSCAN-SWA_7 2046890 : 2113930 80 Escherichia_phage(82.28%) portal,holin,integrase,capsid,lysis,tail,terminase,bacteriocin attL 2044412:2044427|attR 2080412:2080427
DBSCAN-SWA_8 2217679 : 2290524 94 Escherichia_phage(25.42%) holin,integrase,capsid,head,tail,terminase,tRNA attL 2232924:2232943|attR 2275945:2275964
DBSCAN-SWA_9 2394488 : 2431576 42 Stx2-converting_phage(35.71%) holin,head,integrase,tail attL 2393510:2393524|attR 2434731:2434745
DBSCAN-SWA_10 2435827 : 2518419 91 Enterobacteria_phage(39.68%) portal,holin,transposase,integrase,capsid,protease,head,tail,terminase attL 2450016:2450038|attR 2502125:2502147
DBSCAN-SWA_11 2594959 : 2651122 66 Escherichia_phage(44.26%) holin,integrase,capsid,head,tail,terminase,tRNA attL 2588504:2588518|attR 2621529:2621543
DBSCAN-SWA_12 2796368 : 2901239 106 Stx2-converting_phage(27.59%) holin,transposase,capsid,integrase,lysis,head,tail,terminase attL 2784911:2784927|attR 2907876:2907892
DBSCAN-SWA_13 3292004 : 3339146 57 Enterobacteria_phage(36.96%) portal,holin,transposase,capsid,integrase,head,tail,terminase attL 3310101:3310117|attR 3345738:3345754
DBSCAN-SWA_14 3411390 : 3416708 9 Stx2-converting_phage(50.0%) transposase NA
DBSCAN-SWA_15 3451657 : 3457959 6 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_16 3508140 : 3615487 109 Stx2-converting_phage(35.06%) portal,holin,transposase,capsid,integrase,head,tail,terminase,tRNA attL 3556438:3556458|attR 3612993:3613013
DBSCAN-SWA_17 3700530 : 3779152 77 Enterobacteria_phage(35.94%) holin,transposase,capsid,integrase,protease,lysis,head,tail,terminase attL 3712930:3712965|attR 3780586:3780621
DBSCAN-SWA_18 3998694 : 4053328 66 Enterobacteria_phage(64.15%) portal,transposase,capsid,integrase,protease,lysis,head,tail,terminase attL 4007175:4007221|attR 4053342:4053388
DBSCAN-SWA_19 4819475 : 4832943 10 Stx2-converting_phage(70.0%) protease,transposase NA
DBSCAN-SWA_20 4909304 : 4969210 58 Vibrio_phage(15.38%) protease,transposase,tRNA NA
DBSCAN-SWA_21 5116624 : 5165053 57 Enterobacteria_phage(48.08%) portal,holin,capsid,integrase,head,tail,terminase,tRNA attL 5107416:5107431|attR 5141939:5141954

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP045829
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2155 : 9914 7 Escherichia_phage(57.14%) NA NA
DBSCAN-SWA_2 17359 : 99884 92 Escherichia_phage(70.93%) tail,terminase,holin,integrase,transposase,head,portal NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP045828
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1261 : 61836 28 Stx2-converting_phage(44.44%) protease,integrase,transposase NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage