1. spacer 8.13|8265870|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NC_004933 (Streptomyces lividans 1326 plasmid SLP2, complete sequence) position: , mismatch: 1, identity: 0.969
agctggtggtcgctgacgtcgaacggcccgaa CRISPR spacer
aggtggtggtcgctgacgtcgaacggcccgaa Protospacer
** *****************************
2. spacer 1.2|88333|32|NZ_CP045740|CRISPRCasFinder matches to NC_004934 (Streptomyces violaceoruber strain SANK95570 plasmid pSV2, complete sequence) position: , mismatch: 2, identity: 0.938
ctcgtgccgcatgacaccggccgcacgtggag CRISPR spacer
ctcgtgccgcacgacaccggccgcacgtggaa Protospacer
***********.*******************.
3. spacer 8.6|8265808|33|NZ_CP045740|PILER-CR matches to NC_023282 (Streptomyces sp. FR1 plasmid pFRL2, complete sequence) position: , mismatch: 2, identity: 0.939
cgcggtcgggcgccgcttccagctggcccgcga CRISPR spacer
cacggtcggccgccgcttccagctggcccgcga Protospacer
*.******* ***********************
4. spacer 8.12|8265809|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NC_023282 (Streptomyces sp. FR1 plasmid pFRL2, complete sequence) position: , mismatch: 2, identity: 0.938
gcggtcgggcgccgcttccagctggcccgcga CRISPR spacer
acggtcggccgccgcttccagctggcccgcga Protospacer
.******* ***********************
5. spacer 8.16|8266053|32|NZ_CP045740|CRISPRCasFinder,CRT matches to KT221034 (Streptomyces phage SF3, complete genome) position: , mismatch: 2, identity: 0.938
acgggcgacagcacggtcgaccacagccacga CRISPR spacer
acgggcgacagcaccgtcgaccagagccacga Protospacer
************** ******** ********
6. spacer 8.16|8266053|32|NZ_CP045740|CRISPRCasFinder,CRT matches to KT221033 (Streptomyces phage SF1, complete genome) position: , mismatch: 2, identity: 0.938
acgggcgacagcacggtcgaccacagccacga CRISPR spacer
acgggcgacagcaccgtcgaccagagccacga Protospacer
************** ******** ********
7. spacer 9.1|8267545|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LN831788 (Streptomyces leeuwenhoekii strain type strain (C34 = DSM 42122 = NRRL B-24963) plasmid pSLE1, complete sequence) position: , mismatch: 2, identity: 0.938
tcaacggactcgacatgccggccaaggccgaa CRISPR spacer
tcaacggcctcgacatgccggccaagaccgaa Protospacer
******* ******************.*****
8. spacer 9.5|8267789|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033583 (Streptomyces sp. ADI95-16 plasmid pADI95-16b, complete sequence) position: , mismatch: 2, identity: 0.938
gccggactccagacctactacgccacccgtgc CRISPR spacer
gccggtctgcagacctactacgccacccgtgc Protospacer
***** ** ***********************
9. spacer 1.2|88333|32|NZ_CP045740|CRISPRCasFinder matches to NZ_CP021119 (Streptomyces sp. CLI2509 strain CLI2905 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.906
ctcgtgccgcatgacaccggccgcacgtggag CRISPR spacer
gtcgtgccacatgacaccggccgcacgtggaa Protospacer
*******.**********************.
10. spacer 1.2|88333|32|NZ_CP045740|CRISPRCasFinder matches to NC_003903 (Streptomyces coelicolor A3(2) plasmid SCP1, complete sequence) position: , mismatch: 3, identity: 0.906
ctcgtgccgcatgacaccggccgcacgtggag CRISPR spacer
gtcgtgccgcacgacaccggccgcacgtggaa Protospacer
**********.*******************.
11. spacer 3.2|3060850|27|NZ_CP045740|CRT matches to NZ_CP015739 (Shinella sp. HZN7 plasmid pShin-03, complete sequence) position: , mismatch: 4, identity: 0.852
aagccggagaccgacgcccccgaggtc CRISPR spacer
aagccggagatcgacgccaccgacctc Protospacer
**********.******* **** **
12. spacer 3.2|3060850|27|NZ_CP045740|CRT matches to NC_021910 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetNIM1c, complete sequence) position: , mismatch: 4, identity: 0.852
aagccggagaccgacgcccccgaggtc CRISPR spacer
aagccggagatcgacgccaccgacctc Protospacer
**********.******* **** **
13. spacer 8.6|8265808|33|NZ_CP045740|PILER-CR matches to CP054922 (Streptomyces sp. NA03103 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.879
cgcggtcgggcgccgcttccagctggcccgcga CRISPR spacer
cgtcgtggggcgccgcttccagctggcccgtga Protospacer
**. ** ***********************.**
14. spacer 8.6|8265808|33|NZ_CP045740|PILER-CR matches to NZ_CP048642 (Streptomyces aureoverticillatus strain HN6 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.879
cgcggtcgggcgccgcttccagctggcccgcga CRISPR spacer
ctccgtcgggcggcgcttccagctggcccggga Protospacer
* * ******** ***************** **
15. spacer 8.6|8265808|33|NZ_CP045740|PILER-CR matches to NZ_CP026654 (Streptomyces dengpaensis strain XZHG99 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.879
cgcggtcgggcgccgcttccagctggcccgcga CRISPR spacer
cacagtcggccgccgctaccagctggcccgcga Protospacer
*.*.***** ******* ***************
16. spacer 8.12|8265809|32|NZ_CP045740|CRISPRCasFinder,CRT matches to CP054922 (Streptomyces sp. NA03103 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.875
gcggtcgggcgccgcttccagctggcccgcga CRISPR spacer
gtcgtggggcgccgcttccagctggcccgtga Protospacer
*. ** ***********************.**
17. spacer 8.12|8265809|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP048642 (Streptomyces aureoverticillatus strain HN6 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.875
gcggtcgggcgccgcttccagctggcccgcga CRISPR spacer
tccgtcgggcggcgcttccagctggcccggga Protospacer
* ******** ***************** **
18. spacer 8.12|8265809|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP026654 (Streptomyces dengpaensis strain XZHG99 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.875
gcggtcgggcgccgcttccagctggcccgcga CRISPR spacer
acagtcggccgccgctaccagctggcccgcga Protospacer
.*.***** ******* ***************
19. spacer 8.13|8265870|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP016084 (Streptomyces sp. SAT1 plasmid unnamed4, complete sequence) position: , mismatch: 4, identity: 0.875
agctggtggtcgctgacgtcgaacggcccgaa CRISPR spacer
cggtggtggtcgctgacgtcgaacggcgcgta Protospacer
* ************************ ** *
20. spacer 9.3|8267667|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to CP054917 (Streptomyces sp. NA02950 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.875
tccttcaggccgggcttgatgcaggcggccac CRISPR spacer
tccttcaggccgggcttgatgcatgcgacgat Protospacer
*********************** ***.* *.
21. spacer 10.2|8279087|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP040765 (Paracoccus sp. 2251 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.875
ccatccccgtcatcacccccgtcgtccccatc CRISPR spacer
ccatcgccgtcatcacccccgtcgtcatcacc Protospacer
***** ******************** .**.*
22. spacer 3.2|3060850|27|NZ_CP045740|CRT matches to MT024869 (Arthrobacter phage Lego, complete genome) position: , mismatch: 5, identity: 0.815
aagccggagaccgacgcccccgaggtc CRISPR spacer
gcgccggagaaggacgcccccgaggtg Protospacer
. ******** **************
23. spacer 8.12|8265809|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP026653 (Streptomyces dengpaensis strain XZHG99 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.844
gcggtcgggcgccgcttccagctggcccgcga CRISPR spacer
accgtcgggcgccgcttccagctggcaaggga Protospacer
.* *********************** * **
24. spacer 8.12|8265809|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP049157 (Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence) position: , mismatch: 5, identity: 0.844
gcggtcgggcgccgcttccagctggcc-cgcga CRISPR spacer
gcggtcgggcgccgcgtcaagctgctcacgcg- Protospacer
*************** ** ***** .* ****
25. spacer 8.12|8265809|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP049317 (Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence) position: , mismatch: 5, identity: 0.844
gcggtcgggcgccgcttccagctggcc-cgcga CRISPR spacer
gcggtcgggcgccgcgtcaagctgctcacgcg- Protospacer
*************** ** ***** .* ****
26. spacer 8.14|8265931|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 5, identity: 0.844
cagagcgcccgcgcgctccagaacgacgggtc CRISPR spacer
cagagcgcgcgcgcgccccagaacgacatgcc Protospacer
******** *******.**********. *.*
27. spacer 9.6|8267850|31|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053906 (Hymenobacter sp. BRD67 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.839
ccacgcccacagccgccgccaga-gcaggccg CRISPR spacer
ccacgcccaccgccgccgccaggcgcacgac- Protospacer
********** ***********. *** * *
28. spacer 9.14|8268337|32|NZ_CP045740|CRISPRCasFinder,CRT matches to MT310863 (Streptomyces phage Issmi, complete genome) position: , mismatch: 5, identity: 0.844
acgaacggcagcgcggagggagatggcgtcta CRISPR spacer
gacaacggcagcgcggagggcgacggcgtcta Protospacer
. ***************** **.********
29. spacer 10.4|8279209|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.844
gcgcccgcgtccggctccggcggcacgatgta- CRISPR spacer
gcgccggcgtccggctcctgcggc-cgttggag Protospacer
***** ************ ***** ** ** *
30. spacer 10.4|8279209|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.844
gcgcccgcgtccggctccggcggcacgatgta- CRISPR spacer
gcgccggcgtccggctcctgcggc-cgttggag Protospacer
***** ************ ***** ** ** *
31. spacer 1.2|88333|32|NZ_CP045740|CRISPRCasFinder matches to NZ_CP016084 (Streptomyces sp. SAT1 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.812
ctcgtgccgcatgacaccggccgcacgtggag CRISPR spacer
gtcgtgccgcacgacaccggccgcgcgggcaa Protospacer
**********.************.** * *.
32. spacer 1.2|88333|32|NZ_CP045740|CRISPRCasFinder matches to LN997844 (Streptomyces reticuli genome assembly TUE45, plasmid : III) position: , mismatch: 6, identity: 0.812
ctcgtgccgcatgacaccggccgcacgtggag CRISPR spacer
gtcgtgccgcacgacaccggccgcgcgggcaa Protospacer
**********.************.** * *.
33. spacer 3.2|3060850|27|NZ_CP045740|CRT matches to NZ_CP014598 (Yangia sp. CCB-MM3 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.778
aagccggagaccgacgcccccgaggtc CRISPR spacer
gcgccggagaccgacgcccctgaaacc Protospacer
. ******************.**...*
34. spacer 3.2|3060850|27|NZ_CP045740|CRT matches to MN908693 (Gordonia phage AnClar, complete genome) position: , mismatch: 6, identity: 0.778
aagccggagaccgacgcccccgaggtc CRISPR spacer
gagtcggagtccgacgcccccgagcct Protospacer
.**.***** ************** ..
35. spacer 3.2|3060850|27|NZ_CP045740|CRT matches to MN703413 (Arthrobacter phage Powerpuff, complete genome) position: , mismatch: 6, identity: 0.778
aagccggagaccgacgcccccgaggtc CRISPR spacer
gcaccggagaaggacgcccccgaggtg Protospacer
. .******* **************
36. spacer 3.2|3060850|27|NZ_CP045740|CRT matches to MK801725 (Gordonia phage Yago84, complete genome) position: , mismatch: 6, identity: 0.778
aagccggagaccgacgcccccgaggtc CRISPR spacer
gagtcggagtccgacgcccccgagcct Protospacer
.**.***** ************** ..
37. spacer 3.2|3060850|27|NZ_CP045740|CRT matches to MT024871 (Arthrobacter phage YesChef, complete genome) position: , mismatch: 6, identity: 0.778
aagccggagaccgacgcccccgaggtc CRISPR spacer
gcaccggagaaggacgcccccgaggtg Protospacer
. .******* **************
38. spacer 8.6|8265808|33|NZ_CP045740|PILER-CR matches to NZ_CP026305 (Streptomyces lunaelactis strain MM109 plasmid pSLUN1, complete sequence) position: , mismatch: 6, identity: 0.818
cgcggtcgggcgccgcttccagctggcccgcga CRISPR spacer
cgacgtcgggcgccgtttccagctggcctcgga Protospacer
** ***********.************. **
39. spacer 8.6|8265808|33|NZ_CP045740|PILER-CR matches to NZ_CP022542 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-2, complete sequence) position: , mismatch: 6, identity: 0.818
cgcggt-cgggcgccgcttccagctggcccgcga CRISPR spacer
-gcggcacatgcgccgctttcggctggcccgcga Protospacer
****. *. *********.*.************
40. spacer 8.6|8265808|33|NZ_CP045740|PILER-CR matches to NZ_CP049157 (Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence) position: , mismatch: 6, identity: 0.818
cgcggtcgggcgccgcttccagctggcc-cgcga CRISPR spacer
tgcggtcgggcgccgcgtcaagctgctcacgcg- Protospacer
.*************** ** ***** .* ****
41. spacer 8.6|8265808|33|NZ_CP045740|PILER-CR matches to NZ_CP049317 (Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence) position: , mismatch: 6, identity: 0.818
cgcggtcgggcgccgcttccagctggcc-cgcga CRISPR spacer
tgcggtcgggcgccgcgtcaagctgctcacgcg- Protospacer
.*************** ** ***** .* ****
42. spacer 8.12|8265809|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP026305 (Streptomyces lunaelactis strain MM109 plasmid pSLUN1, complete sequence) position: , mismatch: 6, identity: 0.812
gcggtcgggcgccgcttccagctggcccgcga CRISPR spacer
gacgtcgggcgccgtttccagctggcctcgga Protospacer
* ***********.************. **
43. spacer 8.12|8265809|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP022542 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-2, complete sequence) position: , mismatch: 6, identity: 0.812
gcggt-cgggcgccgcttccagctggcccgcga CRISPR spacer
-cggcacatgcgccgctttcggctggcccgcga Protospacer
***. *. *********.*.************
44. spacer 8.13|8265870|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.812
agctggtg-gtcgctgacgtcgaacggcccgaa CRISPR spacer
-gcgtgtgcgtcgctgacgccgaacgccccgac Protospacer
** *** **********.****** *****
45. spacer 8.15|8265992|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NC_047905 (Streptomyces phage Attoomi, complete genome) position: , mismatch: 6, identity: 0.812
cggcacgggccgatgaactccacgatggccag CRISPR spacer
cggcacgggccgacgaactccacggccgcgat Protospacer
*************.**********.. ** *
46. spacer 9.2|8267606|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NC_012528 (Deinococcus deserti VCD115 plasmid 3, complete sequence) position: , mismatch: 6, identity: 0.812
gtgatcgtgtcgatcgcgttgaa-cggcccatc CRISPR spacer
ttgctcgcgtcgatcgcgttgaaccggtccag- Protospacer
** ***.*************** ***.***
47. spacer 1.2|88333|32|NZ_CP045740|CRISPRCasFinder matches to NC_010311 (Streptomyces sp. HK1 plasmid pSHK1, complete sequence) position: , mismatch: 7, identity: 0.781
ctcgtgccgcatgacaccggccgcacgtggag CRISPR spacer
ctcgtgccgcacgacaccggccgggccggcaa Protospacer
***********.*********** .* * *.
48. spacer 1.2|88333|32|NZ_CP045740|CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 7, identity: 0.781
ctcgtgccgcatgacaccggccgcacgtggag CRISPR spacer
ctcgtgccgcacgacaccggccgggccggcaa Protospacer
***********.*********** .* * *.
49. spacer 1.2|88333|32|NZ_CP045740|CRISPRCasFinder matches to ASHF01000034 (Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence) position: , mismatch: 7, identity: 0.781
ctcgtgccgcatgacaccggccgcacgtggag CRISPR spacer
ctcgtgccgcacgacaccggccgggccggcaa Protospacer
***********.*********** .* * *.
50. spacer 3.3|3060916|33|NZ_CP045740|CRT matches to NZ_CP040721 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.788
gccgaggccacgacggacaccgccgaggtcgcg CRISPR spacer
gccgaggccacgacggacaccaccgttgttcat Protospacer
*********************.*** **.
51. spacer 3.3|3060916|33|NZ_CP045740|CRT matches to NZ_CP018064 (Rhodococcus sp. 2G plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.788
gccgaggccacgacggacaccgccgaggtcgcg CRISPR spacer
gccgaggccacgacggacaccaccgttgttcat Protospacer
*********************.*** **.
52. spacer 8.3|8265625|33|NZ_CP045740|PILER-CR matches to NZ_CP053565 (Pseudonocardia sp. Gen01 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.788
cggtgcccgggtgcgctgcgacggacgc-ctgta CRISPR spacer
caccgcccgggtgcgccgcgacggccgcaccgt- Protospacer
*. .************.******* *** *.**
53. spacer 8.3|8265625|33|NZ_CP045740|PILER-CR matches to MF185722 (Mycobacterium phage Peanam, complete genome) position: , mismatch: 7, identity: 0.788
cggtgcccgggtgcgctgcgacggacgcctgta- CRISPR spacer
cggtgcccgtgtgcgctgcggcgg-ccccggcgc Protospacer
********* **********.*** * ** *..
54. spacer 8.4|8265686|33|NZ_CP045740|PILER-CR matches to KY130461 (Mycobacterium phage Taptic, complete genome) position: , mismatch: 7, identity: 0.788
ccctcgacgccgagacgctcagccggcgaatca CRISPR spacer
cgcgtgacgccgaaacgctcagccgccgaggca Protospacer
* * .********.*********** ***. **
55. spacer 8.4|8265686|33|NZ_CP045740|PILER-CR matches to MK494131 (Mycobacterium phage GodPhather, complete genome) position: , mismatch: 7, identity: 0.788
ccctcgacgccgagacgctcagccggcgaatca CRISPR spacer
cgcgtgacgccgaaacgctcagccgccgaggca Protospacer
* * .********.*********** ***. **
56. spacer 8.4|8265686|33|NZ_CP045740|PILER-CR matches to MK494114 (Mycobacterium phage Argie, complete genome) position: , mismatch: 7, identity: 0.788
ccctcgacgccgagacgctcagccggcgaatca CRISPR spacer
cgcgtgacgccgaaacgctcagccgccgaggca Protospacer
* * .********.*********** ***. **
57. spacer 8.4|8265686|33|NZ_CP045740|PILER-CR matches to MK494132 (Mycobacterium phage Cepens, complete genome) position: , mismatch: 7, identity: 0.788
ccctcgacgccgagacgctcagccggcgaatca CRISPR spacer
cgcgtgacgccgaaacgctcagccgccgaggca Protospacer
* * .********.*********** ***. **
58. spacer 8.4|8265686|33|NZ_CP045740|PILER-CR matches to JN698995 (Mycobacterium phage Dori, complete genome) position: , mismatch: 7, identity: 0.788
ccctcgacgccgagacgctcagccggcgaatca CRISPR spacer
cgcgtgacgccgaaacgctcagccgccgaggca Protospacer
* * .********.*********** ***. **
59. spacer 8.6|8265808|33|NZ_CP045740|PILER-CR matches to NZ_CP030863 (Streptomyces globosus strain LZH-48 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.788
cgcggtcgggcgccgcttccagctggcccgcga CRISPR spacer
cagcgtcgggcgccgtttccagctggcctcgga Protospacer
*. ***********.************. **
60. spacer 8.8|8265565|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP033222 (Parasedimentitalea marina strain W43 plasmid pW43C, complete sequence) position: , mismatch: 7, identity: 0.781
aggcccgccacccggtccatctgatcccggaa CRISPR spacer
atcccggccacccggtctatctgatccccggc Protospacer
* ** ***********.********** *.
61. spacer 8.9|8265626|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP053565 (Pseudonocardia sp. Gen01 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
ggtgcccgggtgcgctgcgacggacgc-ctgta CRISPR spacer
accgcccgggtgcgccgcgacggccgcaccgt- Protospacer
. .************.******* *** *.**
62. spacer 8.9|8265626|32|NZ_CP045740|CRISPRCasFinder,CRT matches to MF185722 (Mycobacterium phage Peanam, complete genome) position: , mismatch: 7, identity: 0.781
ggtgcccgggtgcgctgcgacggacgcctgta- CRISPR spacer
ggtgcccgtgtgcgctgcggcgg-ccccggcgc Protospacer
******** **********.*** * ** *..
63. spacer 8.10|8265687|32|NZ_CP045740|CRISPRCasFinder,CRT matches to KY130461 (Mycobacterium phage Taptic, complete genome) position: , mismatch: 7, identity: 0.781
cctcgacgccgagacgctcagccggcgaatca CRISPR spacer
gcgtgacgccgaaacgctcagccgccgaggca Protospacer
* .********.*********** ***. **
64. spacer 8.10|8265687|32|NZ_CP045740|CRISPRCasFinder,CRT matches to MK494131 (Mycobacterium phage GodPhather, complete genome) position: , mismatch: 7, identity: 0.781
cctcgacgccgagacgctcagccggcgaatca CRISPR spacer
gcgtgacgccgaaacgctcagccgccgaggca Protospacer
* .********.*********** ***. **
65. spacer 8.10|8265687|32|NZ_CP045740|CRISPRCasFinder,CRT matches to MK494114 (Mycobacterium phage Argie, complete genome) position: , mismatch: 7, identity: 0.781
cctcgacgccgagacgctcagccggcgaatca CRISPR spacer
gcgtgacgccgaaacgctcagccgccgaggca Protospacer
* .********.*********** ***. **
66. spacer 8.10|8265687|32|NZ_CP045740|CRISPRCasFinder,CRT matches to MK494132 (Mycobacterium phage Cepens, complete genome) position: , mismatch: 7, identity: 0.781
cctcgacgccgagacgctcagccggcgaatca CRISPR spacer
gcgtgacgccgaaacgctcagccgccgaggca Protospacer
* .********.*********** ***. **
67. spacer 8.10|8265687|32|NZ_CP045740|CRISPRCasFinder,CRT matches to JN698995 (Mycobacterium phage Dori, complete genome) position: , mismatch: 7, identity: 0.781
cctcgacgccgagacgctcagccggcgaatca CRISPR spacer
gcgtgacgccgaaacgctcagccgccgaggca Protospacer
* .********.*********** ***. **
68. spacer 8.10|8265687|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 7, identity: 0.781
cctcgacgccgagacgctcagccggcgaatca CRISPR spacer
cggcgtcgtcgagacgctcagccggccattga Protospacer
* ** **.***************** * * *
69. spacer 8.10|8265687|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 7, identity: 0.781
cctcgacgccgagacgctcagccggcgaatca CRISPR spacer
cggcgtcgtcgagacgctcagccggccattga Protospacer
* ** **.***************** * * *
70. spacer 8.10|8265687|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP013503 (Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence) position: , mismatch: 7, identity: 0.781
cctcgacgccgagacgctcagccggcgaatca CRISPR spacer
cggcgtcgtcgagacgctcagccggccattga Protospacer
* ** **.***************** * * *
71. spacer 8.10|8265687|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 7, identity: 0.781
cctcgacgccgagacgctcagccggcgaatca CRISPR spacer
cggcgtcgtcgagacgctcagccggccattga Protospacer
* ** **.***************** * * *
72. spacer 8.10|8265687|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP013509 (Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence) position: , mismatch: 7, identity: 0.781
cctcgacgccgagacgctcagccggcgaatca CRISPR spacer
cggcgtcgtcgagacgctcagccggccattga Protospacer
* ** **.***************** * * *
73. spacer 8.10|8265687|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP013520 (Rhizobium sp. N113 plasmid pRspN113c, complete sequence) position: , mismatch: 7, identity: 0.781
cctcgacgccgagacgctcagccggcgaatca CRISPR spacer
cggcgtcgtcgagacgctcagccggccattga Protospacer
* ** **.***************** * * *
74. spacer 8.10|8265687|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP013493 (Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence) position: , mismatch: 7, identity: 0.781
cctcgacgccgagacgctcagccggcgaatca CRISPR spacer
cggcgtcgtcgagacgctcagccggccattga Protospacer
* ** **.***************** * * *
75. spacer 8.12|8265809|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP030863 (Streptomyces globosus strain LZH-48 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
gcggtcgggcgccgcttccagctggcccgcga CRISPR spacer
agcgtcgggcgccgtttccagctggcctcgga Protospacer
. ***********.************. **
76. spacer 8.12|8265809|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 7, identity: 0.781
gcggtcgggcgccgcttccagctggcccgcga CRISPR spacer
gcggtgggccgccgcttccagctcccgcccca Protospacer
***** ** ************** * * * *
77. spacer 8.12|8265809|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 7, identity: 0.781
gcggtcgggcgccgcttccagctggcccgcga CRISPR spacer
gccgtctggcgccgcttccagcttcgcatcga Protospacer
** *** **************** * ***
78. spacer 8.12|8265809|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 7, identity: 0.781
gcggtcgggcgccgcttccagctggcccgcga CRISPR spacer
gccgtctggcgccgcttccagcttcgcatcga Protospacer
** *** **************** * ***
79. spacer 8.12|8265809|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 7, identity: 0.781
gcggtcgggcgccgcttccagctggcccgcga CRISPR spacer
gccgtctggcgccgcttccagcttcgcatcga Protospacer
** *** **************** * ***
80. spacer 8.12|8265809|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NC_011366 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence) position: , mismatch: 7, identity: 0.781
gcggtcgggcgccgcttccagctggcccgcga CRISPR spacer
gccgtctggcgccgcttccagcttcgcatcga Protospacer
** *** **************** * ***
81. spacer 8.12|8265809|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 7, identity: 0.781
gcggtcgggcgccgcttccagctggcccgcga CRISPR spacer
gccgtctggcgccgcttccagcttcgcatcga Protospacer
** *** **************** * ***
82. spacer 8.12|8265809|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 7, identity: 0.781
gcggtcgggcgccgcttccagctggcccgcga CRISPR spacer
gccgtctggcgccgcttccagcttcgcatcga Protospacer
** *** **************** * ***
83. spacer 8.12|8265809|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 7, identity: 0.781
gcggtcgggcgccgcttccagctggcccgcga CRISPR spacer
gcggagctgcgccgctacctgctggcccgcgc Protospacer
**** ******** ** ***********
84. spacer 8.13|8265870|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP041652 (Streptomyces sp. RLB1-9 plasmid pRLB1-9.2, complete sequence) position: , mismatch: 7, identity: 0.781
agctggtggtcgctgacgtcgaacggcccgaa CRISPR spacer
ctctcgtggtcgctgacgtcgaacggcgccgc Protospacer
** ********************** * .
85. spacer 8.13|8265870|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP048642 (Streptomyces aureoverticillatus strain HN6 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
agctggtggtcgctgacgtcgaacggcccgaa CRISPR spacer
ctgtcgtggtcgctgacgtcgaacggcgcgtc Protospacer
* ********************** **
86. spacer 8.13|8265870|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP041605 (Streptomyces sp. S1D4-14 plasmid pS1D4-14.1, complete sequence) position: , mismatch: 7, identity: 0.781
agctggtggtcgctgacgtcgaacggcccgaa CRISPR spacer
ctctcgtggtcgctgacgtcgaacggcgctgc Protospacer
** ********************** * .
87. spacer 8.13|8265870|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 7, identity: 0.781
agctggtg-gtcgctgacgtcgaacggcccgaa CRISPR spacer
-gccgccgcctcgctgacggcgaacggctcgaa Protospacer
**.* .* ********* ********.****
88. spacer 8.14|8265931|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.781
cagagcgcccgcgcgctccagaacgacgggtc CRISPR spacer
cttgacgcccgcgcgctccagatcggcggggc Protospacer
* ..***************** **.**** *
89. spacer 8.15|8265992|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NC_023591 (Mycobacterium phage Adler, complete genome) position: , mismatch: 7, identity: 0.781
cggcacgg--gccgatgaactccacgatggccag CRISPR spacer
--gcgccgccgccgatgaactccacggcggccac Protospacer
**.* * ****************..*****
90. spacer 8.15|8265992|32|NZ_CP045740|CRISPRCasFinder,CRT matches to KF981876 (UNVERIFIED: Mycobacterium phage ADLER F1725, complete genome) position: , mismatch: 7, identity: 0.781
cggcacgg--gccgatgaactccacgatggccag CRISPR spacer
--gcgccgccgccgatgaactccacggcggccac Protospacer
**.* * ****************..*****
91. spacer 9.2|8267606|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to MT536174 (Stenotrophomonas phage vB_SmaS-AXL_3, complete genome) position: , mismatch: 7, identity: 0.781
gtgatcgtgtcgatcgcgttgaacggcccatc CRISPR spacer
ttgatcttgtcgatcgcgttgaacttcgcctt Protospacer
***** ***************** * * *.
92. spacer 9.3|8267667|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NC_023724 (Mycobacterium phage Larva, complete genome) position: , mismatch: 7, identity: 0.781
tccttcaggccgggcttgatgcaggcggccac CRISPR spacer
agctgttgcccgggcttgatgccggcggccac Protospacer
** . * ************* *********
93. spacer 9.3|8267667|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to MF185717 (Mycobacterium phage AlleyCat, complete genome) position: , mismatch: 7, identity: 0.781
tccttcaggccgggcttgatgcaggcggccac CRISPR spacer
agctgttgcccgggcttgatgccggcggccac Protospacer
** . * ************* *********
94. spacer 9.3|8267667|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to MF185719 (Mycobacterium phage Edugator, complete genome) position: , mismatch: 7, identity: 0.781
tccttcaggccgggcttgatgcaggcggccac CRISPR spacer
agctgttgcccgggcttgatgccggcggccac Protospacer
** . * ************* *********
95. spacer 9.3|8267667|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to MN586025 (Mycobacterium phage Mdavu, complete genome) position: , mismatch: 7, identity: 0.781
tccttcaggccgggcttgatgcaggcggccac CRISPR spacer
aactgctcgccgggcttgatgccagcggccac Protospacer
** * ************** .********
96. spacer 9.3|8267667|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to KT281789 (Mycobacterium phage Enkosi, complete genome) position: , mismatch: 7, identity: 0.781
tccttcaggccgggcttgatgcaggcggccac CRISPR spacer
aactgctcgccgggcttgatgccagcggccac Protospacer
** * ************** .********
97. spacer 9.3|8267667|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to MH020245 (Mycobacterium phage SgtBeansprout, complete genome) position: , mismatch: 7, identity: 0.781
tccttcaggccgggcttgatgcaggcggccac CRISPR spacer
aactgctcgccgggcttgatgccagcggccac Protospacer
** * ************** .********
98. spacer 9.3|8267667|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to KX808132 (Mycobacterium phage Amelie, complete genome) position: , mismatch: 7, identity: 0.781
tccttcaggccgggcttgatgcaggcggccac CRISPR spacer
aactgctcgccgggcttgatgccagcggccac Protospacer
** * ************** .********
99. spacer 9.3|8267667|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to MH399770 (Mycobacterium phage Biglebops, complete genome) position: , mismatch: 7, identity: 0.781
tccttcaggccgggcttgatgcaggcggccac CRISPR spacer
aactgctcgccgggcttgatgccagcggccac Protospacer
** * ************** .********
100. spacer 9.3|8267667|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NC_042325 (Mycobacterium virus Pixie, complete genome) position: , mismatch: 7, identity: 0.781
tccttcaggccgggcttgatgcaggcggccac CRISPR spacer
aactgctcgccgggcttgataccggcggccac Protospacer
** * ************.* *********
101. spacer 9.3|8267667|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to MF919518 (Mycobacterium phage LilPharaoh, complete genome) position: , mismatch: 7, identity: 0.781
tccttcaggccgggcttgatgcaggcggccac CRISPR spacer
aactgctcgccgggcttgatgccagcggccac Protospacer
** * ************** .********
102. spacer 9.6|8267850|31|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 7, identity: 0.774
ccacgcccacagccgccgccagagcaggccg CRISPR spacer
gcacgctcacagccgccgccacagccgccaa Protospacer
*****.************** *** * * .
103. spacer 9.6|8267850|31|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026519 (Deinococcus sp. NW-56 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.774
ccacgcccacagccgccgccagagcaggccg CRISPR spacer
cttggcccccagccgccgcgagagcagctcg Protospacer
*. **** ********** ******* .**
104. spacer 9.15|8268398|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP016618 (Microvirga ossetica strain V5/3m plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.781
ggcggacgcaagggcggaggcaacgcccagac CRISPR spacer
ggcggtggcaagggcggaggcaacggcaacgg Protospacer
***** ****************** * * .
105. spacer 9.16|8268459|31|NZ_CP045740|CRISPRCasFinder,CRT matches to MT310860 (Mycobacterium phage Chris, complete genome) position: , mismatch: 7, identity: 0.774
gccgcccggcgggtagttcacgtcccagggc CRISPR spacer
gcggcccggcgggcagttcacgtcgactgtc Protospacer
** **********.********** * *
106. spacer 9.17|8268519|34|NZ_CP045740|CRISPRCasFinder matches to NC_018023 (Mycolicibacterium chubuense NBB4 plasmid pMYCCH.02, complete sequence) position: , mismatch: 7, identity: 0.794
acgggcatgtcggtgacgacgccggtgccggggc CRISPR spacer
atcagcaggtcggtgacgacgtcggtgccggcga Protospacer
*. .*** *************.********* *
107. spacer 9.17|8268519|34|NZ_CP045740|CRISPRCasFinder matches to NZ_CP023152 (Mycobacterium chimaera strain FLAC0070 plasmid pFLAC0070_1, complete sequence) position: , mismatch: 7, identity: 0.794
acgggcatgtcggtgacgacgccggtgccggggc CRISPR spacer
atgaggatgtcggtgacgacctcggtgccggcga Protospacer
*.*.* ************** .********* *
108. spacer 9.17|8268519|34|NZ_CP045740|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 7, identity: 0.794
acgggcatgtcggtgacgacgccggtgccggggc CRISPR spacer
acgggcatgtcggtgccgatgccggactcaaggc Protospacer
*************** ***.***** .*..***
109. spacer 10.2|8279087|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NC_014534 (Gloeothece verrucosa PCC 7822 plasmid Cy782202, complete sequence) position: , mismatch: 7, identity: 0.781
ccatccccgtcatcacccccgtcgtccccatc CRISPR spacer
tcacccccgtcgtcacccccgtcgtcacaccc Protospacer
.**.*******.************** * .*
110. spacer 10.4|8279209|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 7, identity: 0.781
gcgcccgcgtccggctccggc-ggcacgatgta CRISPR spacer
gcgcccgggtacggctccggcgggcccggcgc- Protospacer
******* ** ********** *** **..*.
111. spacer 10.4|8279209|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 7, identity: 0.781
gcgcccgcgtccggctccggc-ggcacgatgta CRISPR spacer
gcgcccgggtacggctccggcgggcccggcgc- Protospacer
******* ** ********** *** **..*.
112. spacer 10.4|8279209|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP034351 (Streptomyces sp. W1SF4 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781
gcgcccgcgtccggctccggcggcacgatgta CRISPR spacer
gcgcccgcgtccggctccgtgggcgaggtgcg Protospacer
******************* ***. *.**..
113. spacer 10.4|8279209|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP045288 (Curtobacterium flaccumfaciens pv. flaccumfaciens strain P990 plasmid pCff1, complete sequence) position: , mismatch: 7, identity: 0.781
gcgcccgcgtccggctccggcggcacgatgta CRISPR spacer
gcaaccgcgtccgtctccggcgtcacgtggtc Protospacer
**. ********* ******** **** **
114. spacer 10.4|8279209|32|NZ_CP045740|CRISPRCasFinder,CRT matches to CP041260 (Curtobacterium flaccumfaciens pv. flaccumfaciens strain Cff1037 plasmid pCFF113, complete sequence) position: , mismatch: 7, identity: 0.781
gcgcccgcgtccggctccggcggcacgatgta CRISPR spacer
gcaaccgcgtccgtctccggcgtcacgtggtc Protospacer
**. ********* ******** **** **
115. spacer 10.4|8279209|32|NZ_CP045740|CRISPRCasFinder,CRT matches to MN813693 (Mycobacterium phage Imvubu, complete genome) position: , mismatch: 7, identity: 0.781
gcgcccgcgtccggctccggcggc-acgatgta CRISPR spacer
gtgcccgcgtccggcgacggcggcaacggttc- Protospacer
*.************* ******* ***.* .
116. spacer 10.11|8279636|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP018459 (Klebsiella pneumoniae strain Kp_Goe_39795 plasmid pKp_Goe_795-4, complete sequence) position: , mismatch: 7, identity: 0.781
ggtatcaggctgataccgctttgggcatggaa CRISPR spacer
gagtcgaggctgataccgttttgggcattgaa Protospacer
*. . ************.********* ***
117. spacer 1.2|88333|32|NZ_CP045740|CRISPRCasFinder matches to NZ_CP009292 (Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence) position: , mismatch: 8, identity: 0.75
ctcgtgccgcatgacaccggccgcacgtggag--- CRISPR spacer
ctcgcgccgaatgacaccggccg---gcgggtcct Protospacer
****.**** ************* *.**.
118. spacer 8.2|8265564|33|NZ_CP045740|PILER-CR matches to NZ_CP033222 (Parasedimentitalea marina strain W43 plasmid pW43C, complete sequence) position: , mismatch: 8, identity: 0.758
caggcccgccacccggtccatctgatcccggaa CRISPR spacer
aatcccggccacccggtctatctgatccccggc Protospacer
* ** ***********.********** *.
119. spacer 8.2|8265564|33|NZ_CP045740|PILER-CR matches to NZ_CP026547 (Cupriavidus metallidurans strain Ni-2 plasmid unnamed3) position: , mismatch: 8, identity: 0.758
caggcccgccacccggtccatctgatcccggaa CRISPR spacer
caggcccgccacacggttcatctgtgtattgaa Protospacer
************ ****.****** . . ***
120. spacer 8.7|8265504|32|NZ_CP045740|CRISPRCasFinder,CRT matches to MN856003 (Bacteriophage sp. isolate 1, complete genome) position: , mismatch: 8, identity: 0.75
tcctggaccggtactggagctaccggcccggc CRISPR spacer
ctcgggaccggtactggagatacaggccttga Protospacer
..* *************** *** ****. *
121. spacer 8.8|8265565|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP026547 (Cupriavidus metallidurans strain Ni-2 plasmid unnamed3) position: , mismatch: 8, identity: 0.75
aggcccgccacccggtccatctgatcccggaa CRISPR spacer
aggcccgccacacggttcatctgtgtattgaa Protospacer
*********** ****.****** . . ***
122. spacer 8.9|8265626|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP020811 (Mycobacterium dioxanotrophicus strain PH-06 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
ggtgcccgggtgcgctgcgacggacgcctgta CRISPR spacer
cgggcccgggtgcgcagcgacggacgggttgc Protospacer
* ************ ********** *
123. spacer 8.9|8265626|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP032156 (Mycobacterium sp. ELW1 plasmid pELW1-1, complete sequence) position: , mismatch: 8, identity: 0.75
ggtgcccgggtgcgctgcgacggacgcctgta CRISPR spacer
cgggcccgggtgcgcagcgacggacgggtcgc Protospacer
* ************ ********** *
124. spacer 8.9|8265626|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NC_015178 (Acidiphilium multivorum AIU301 plasmid pACMV1, complete sequence) position: , mismatch: 8, identity: 0.75
ggtgcccgggtgcgctgcgacggacgcctgta CRISPR spacer
gcggccggggtgcgctgcgaccgacggtggtg Protospacer
* *** ************** **** . **.
125. spacer 8.12|8265809|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_LN832560 (Paracoccus aminovorans isolate JCM7685 plasmid II, complete sequence) position: , mismatch: 8, identity: 0.75
gcggtcgggcgccgcttccagctggcccgcga CRISPR spacer
gttctgaagcgcggcgtccagctggcccgcga Protospacer
*. * ..**** ** ****************
126. spacer 8.12|8265809|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP040819 (Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence) position: , mismatch: 8, identity: 0.75
gcggtcgggcgccgcttccagctggcccgcga CRISPR spacer
gccttcgagcgccgcttccagcttgccgatca Protospacer
** ***.*************** *** .. *
127. spacer 8.12|8265809|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 8, identity: 0.75
gcggtcgggcgccgcttccagctggcccgcga CRISPR spacer
gatggtgcgcgccgcctccacctggcccgcgt Protospacer
* * .* *******.**** **********
128. spacer 8.12|8265809|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_AP014659 (Bradyrhizobium diazoefficiens strain NK6 plasmid pNK6a, complete sequence) position: , mismatch: 8, identity: 0.75
gcggtcgggcgccgcttccagctggcccgcga CRISPR spacer
gccctcgggcaccgcttcctgctggccttgca Protospacer
** ******.******** *******. *
129. spacer 8.13|8265870|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NC_004719 (Streptomyces avermitilis MA-4680 = NBRC 14893 plasmid SAP1, complete sequence) position: , mismatch: 8, identity: 0.75
agctggtggtcgctgacgtcgaacggcccgaa CRISPR spacer
ctctcgtggtcgctgacatcgaacggcgccgc Protospacer
** ************.********* * .
130. spacer 8.13|8265870|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP045548 (Streptomyces sp. SYP-A7193 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
agctggtggtcgctgacgtcgaacggcccgaa CRISPR spacer
tgatcgaggtcggtgacgtcgtacggcccggc Protospacer
* * * ***** ******** ********.
131. spacer 8.14|8265931|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75
cagagcgcccgcgcgctccagaacgacgggtc CRISPR spacer
ccggacgcccgcgcgctccaggacggcggtga Protospacer
* *..****************.***.***
132. spacer 8.14|8265931|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_LS974446 (Rhizobium selenitireducens ATCC BAA-1503 isolate T2.30D-1.1_plasmid plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75
cagagcgcccgcgcgctccagaacgacgggtc CRISPR spacer
cattacgcccgcgcgctcgagaacgccggcga Protospacer
** .************* ****** ***
133. spacer 8.14|8265931|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
cagagcgcccgcgcgctccagaacgacgggtc CRISPR spacer
cagaccgcgcgcgcgctccagaaggcctttcc Protospacer
**** *** ************** * * .*
134. spacer 8.14|8265931|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
cagagcgcccgcgcgctccagaacgacgggtc CRISPR spacer
cagaccgcgcgcgcgctccagaaggcctttcc Protospacer
**** *** ************** * * .*
135. spacer 8.14|8265931|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
cagagcgcccgcgcgctccagaacgacgggtc CRISPR spacer
cagaccgcgcgcgcgctccagaaggcctttcc Protospacer
**** *** ************** * * .*
136. spacer 8.14|8265931|32|NZ_CP045740|CRISPRCasFinder,CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
cagagcgcccgcgcgctccagaacgacgggtc CRISPR spacer
cagaccgcgcgcgcgctccagaaggcctttcc Protospacer
**** *** ************** * * .*
137. spacer 8.16|8266053|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP015204 (Rhodococcus sp. 008 plasmid pR8C1, complete sequence) position: , mismatch: 8, identity: 0.75
acgggcgacagcacggtcgaccacagccacga CRISPR spacer
atgtacgacagcgcggtcgacgacagcccccg Protospacer
*.* .*******.******** ****** * .
138. spacer 8.16|8266053|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP039918 (Agrobacterium tumefaciens strain CFBP6626 plasmid pAtCFBP6626a, complete sequence) position: , mismatch: 8, identity: 0.75
acgggcgacagcacggtcgaccacagccacga CRISPR spacer
accggcgacagcacggtcgatcagaacgagcg Protospacer
** *****************.** *.* * .
139. spacer 8.16|8266053|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_KM017071 (Sphingomonas sp. JE1 plasmid pJE1, complete sequence) position: , mismatch: 8, identity: 0.75
acgggcgacagcacggtcgaccacagccacga CRISPR spacer
ccgggcgacagcaaggtccaccaccagcgaga Protospacer
************ **** ***** . *. **
140. spacer 8.16|8266053|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP048633 (Rhizobium oryzihabitans strain M15 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75
acgggcgacagcacggtcgaccacagccacga CRISPR spacer
accggcgacagcacggtcgatcagaacgagcg Protospacer
** *****************.** *.* * .
141. spacer 8.17|8266114|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_LN831788 (Streptomyces leeuwenhoekii strain type strain (C34 = DSM 42122 = NRRL B-24963) plasmid pSLE1, complete sequence) position: , mismatch: 8, identity: 0.75
gcggcccgtatctgggcgaggatgccggacac CRISPR spacer
gccgggtcgatctgggcgaggaagccggccac Protospacer
** * . ************* ***** ***
142. spacer 8.17|8266114|32|NZ_CP045740|CRISPRCasFinder,CRT matches to MF919502 (Mycobacterium phage Demsculpinboyz, complete genome) position: , mismatch: 8, identity: 0.75
gcggcccgtatctgggcgagga-----tgccggacac CRISPR spacer
gcggcgcgtatctggtcgaggattcgttgctg----- Protospacer
***** ********* ****** ***.*
143. spacer 8.17|8266114|32|NZ_CP045740|CRISPRCasFinder,CRT matches to AY129336 (Mycobacteriophage Che9d, complete genome) position: , mismatch: 8, identity: 0.75
gcggcccgtatctgggcgagga-----tgccggacac CRISPR spacer
gcggcgcgtatctggtcgaggattcgttgctg----- Protospacer
***** ********* ****** ***.*
144. spacer 8.17|8266114|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NC_042030 (Mycobacterium phage Yoshi, complete sequence) position: , mismatch: 8, identity: 0.75
gcggcccgtatctgggcgagga-----tgccggacac CRISPR spacer
gcggcgcgtatctggtcgaggattcgttgctg----- Protospacer
***** ********* ****** ***.*
145. spacer 9.1|8267545|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to MN103533 (Mycobacterium phage Weirdo19, complete genome) position: , mismatch: 8, identity: 0.75
tcaacggactcgacatgccggccaaggccgaa CRISPR spacer
gccaggtcctcgacttgccggccaagcccgag Protospacer
* * * ****** *********** ****.
146. spacer 9.3|8267667|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015882 (Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence) position: , mismatch: 8, identity: 0.75
tccttcaggccgggcttgatgcaggcggccac CRISPR spacer
accttcaggccgggcttgatggagctgttacc Protospacer
******************** ** .* . *
147. spacer 9.3|8267667|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 8, identity: 0.75
tccttcaggccgggcttgatgcaggcggccac CRISPR spacer
accttcaggccgggcttgatggagctgttacc Protospacer
******************** ** .* . *
148. spacer 9.3|8267667|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to KX683428 (Mycobacterium phage TBond007, complete genome) position: , mismatch: 8, identity: 0.75
tccttcaggccgggcttgatgcaggcggccac CRISPR spacer
aactgttcgccgggcttgataccggcggccac Protospacer
** . ************.* *********
149. spacer 9.3|8267667|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to KR080206 (Mycobacterium phage ShedlockHolmes, complete genome) position: , mismatch: 8, identity: 0.75
tccttcaggccgggcttgatgcaggcggccac CRISPR spacer
aactgttcgccgggcttgataccggcggccac Protospacer
** . ************.* *********
150. spacer 9.3|8267667|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to KX657796 (Mycobacterium phage Urkel, complete genome) position: , mismatch: 8, identity: 0.75
tccttcaggccgggcttgatgcaggcggccac CRISPR spacer
agttgctcgccgggcttgataccggcggccac Protospacer
.* * ************.* *********
151. spacer 9.3|8267667|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to KX657794 (Mycobacterium phage SamuelLPlaqson, complete genome) position: , mismatch: 8, identity: 0.75
tccttcaggccgggcttgatgcaggcggccac CRISPR spacer
agttgctcgccgggcttgataccggcggccac Protospacer
.* * ************.* *********
152. spacer 9.3|8267667|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to KX657795 (Mycobacterium phage DrHayes, complete genome) position: , mismatch: 8, identity: 0.75
tccttcaggccgggcttgatgcaggcggccac CRISPR spacer
agttgctcgccgggcttgataccggcggccac Protospacer
.* * ************.* *********
153. spacer 9.3|8267667|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NC_026603 (Mycobacterium phage Keshu, complete genome) position: , mismatch: 8, identity: 0.75
tccttcaggccgggcttgatgcaggcggccac CRISPR spacer
aactgttcgccgggcttgataccggcggccac Protospacer
** . ************.* *********
154. spacer 9.4|8267728|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054022 (Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence) position: , mismatch: 8, identity: 0.75
gacggcgaaccgctccgggaagggccggacgg CRISPR spacer
gacggcgagcagctccgggaaggtattgcccg Protospacer
********.* ************ . * * *
155. spacer 9.4|8267728|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054032 (Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence) position: , mismatch: 8, identity: 0.75
gacggcgaaccgctccgggaagggccggacgg CRISPR spacer
gacggcgagcagctccgggaaggtattgcccg Protospacer
********.* ************ . * * *
156. spacer 9.5|8267789|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to AJ630128 (Bacteriophage S-PM2 complete genome) position: , mismatch: 8, identity: 0.75
gccggactccagacctactacgccacccgtgc CRISPR spacer
caagtattccagaactacaacgccacccgtga Protospacer
* *.****** **** ************
157. spacer 9.5|8267789|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NC_006820 (Synechococcus phage S-PM2, complete genome) position: , mismatch: 8, identity: 0.75
gccggactccagacctactacgccacccgtgc CRISPR spacer
caagtattccagaactacaacgccacccgtga Protospacer
* *.****** **** ************
158. spacer 9.5|8267789|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to LN828717 (Synechococcus phage S-PM2 spontaneous deletion mutant, complete genome) position: , mismatch: 8, identity: 0.75
gccggactccagacctactacgccacccgtgc CRISPR spacer
caagtattccagaactacaacgccacccgtga Protospacer
* *.****** **** ************
159. spacer 9.6|8267850|31|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041714 (Legionella geestiana strain HL-0438-4026 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742
ccacgcccacagccgccgccagagcaggccg CRISPR spacer
acctggtcaaagccgctgccagagcaggcca Protospacer
* .* .** ******.*************.
160. spacer 9.6|8267850|31|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NC_007901 (Rhodoferax ferrireducens T118 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742
ccacgcccacagccgccgccagagcaggccg CRISPR spacer
ccacccccaccgccgccgccagaatagatgt Protospacer
**** ***** ************..**..
161. spacer 9.6|8267850|31|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014361 (Methylomonas sp. DH-1 plasmid, complete sequence) position: , mismatch: 8, identity: 0.742
ccacgcccacagccgccgccagagcaggccg CRISPR spacer
ccacgcgcactgccgccgccagaattgccaa Protospacer
****** *** ************.. * * .
162. spacer 9.6|8267850|31|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021082 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence) position: , mismatch: 8, identity: 0.742
ccacgcccacagccgccgccagagcaggccg CRISPR spacer
gaaccgggacagccgccgccggagcaggtcg Protospacer
** ************.*******.**
163. spacer 9.11|8268154|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013345 (Sphingopyxis macrogoltabida strain 203N plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
----gtgacggcgtgtgggcgtgggaggggaacaag CRISPR spacer
agctggaac----tgtgggcgtgggagggggagaag Protospacer
* .** *****************.* ***
164. spacer 9.11|8268154|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to MT024859 (Gordonia phage DumpsterDude, complete genome) position: , mismatch: 8, identity: 0.75
gtgacggcgtgtgggcgtgggaggggaacaag CRISPR spacer
gcgacggcgtgtggacgtgggacggcgacgtc Protospacer
*.************.******* ** .**.
165. spacer 9.11|8268154|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to MK814750 (Gordonia phage Ewald, complete genome) position: , mismatch: 8, identity: 0.75
gtgacggcgtgtgggcgtgggaggggaacaag CRISPR spacer
gcgacggcgtgtggacgtgggacggcgacgtc Protospacer
*.************.******* ** .**.
166. spacer 9.12|8268215|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 8, identity: 0.75
agggcgtactggccgggaaccgggtcggtgat CRISPR spacer
gatgccggctggccggaaacagggtcggtgat Protospacer
.. ** .********.*** ***********
167. spacer 10.2|8279087|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NC_009479 (Clavibacter michiganensis subsp. michiganensis NCPPB 382 plasmid pCM2, complete sequence) position: , mismatch: 8, identity: 0.75
ccatccccgtcatcacccccgtcgtccccatc CRISPR spacer
gcatccgcgtcatcacgcccgtcgcctcgcta Protospacer
***** ********* *******.*.* *
168. spacer 10.3|8279148|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 8, identity: 0.75
atggcgga-catggagaacggcgtgtacgggac CRISPR spacer
-cggtgggccatggagaacggcatgtacgtcat Protospacer
.**.**. *************.****** *.
169. spacer 10.3|8279148|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 8, identity: 0.75
atggcgga-catggagaacggcgtgtacgggac CRISPR spacer
-cggtgggccatggagaacggcatgtacgtcat Protospacer
.**.**. *************.****** *.
170. spacer 10.4|8279209|32|NZ_CP045740|CRISPRCasFinder,CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 8, identity: 0.75
gcgcccgcgtccggctccggcggcacgatgta CRISPR spacer
gaactgctgtccggctccggcggcatgatgtc Protospacer
* .*. .*****************.*****
171. spacer 10.4|8279209|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NC_049478 (Arthrobacter phage Mufasa8, complete genome) position: , mismatch: 8, identity: 0.75
gcgcccgcgtccggctccggcggcacgatgta CRISPR spacer
ctgaccgcgtccggcaccggcggcaccatcgg Protospacer
.* *********** ********** ** .
172. spacer 10.4|8279209|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NC_011758 (Methylorubrum extorquens CM4 plasmid pCMU01, complete sequence) position: , mismatch: 8, identity: 0.75
gcgcccgcgtccggctccggcggcacgatgta CRISPR spacer
gcctccgcgtccggcacctgcggcacggcggg Protospacer
** .*********** ** ********..* .
173. spacer 10.7|8279392|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP010956 (Sphingobium sp. YBL2 plasmid 2pYBL2-2, complete sequence) position: , mismatch: 8, identity: 0.75
caggaccgcacgaacagcatccacccgatgtc CRISPR spacer
cggccccgccggaacagcatccacccgacacc Protospacer
*.* **** *****************...*
174. spacer 10.7|8279392|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP041018 (Sphingobium fuliginis ATCC 27551 plasmid pSF1, complete sequence) position: , mismatch: 8, identity: 0.75
caggaccgcacgaacagcatccacccgatgtc CRISPR spacer
cggctccgccggaacagcatccacccgacacc Protospacer
*.* **** *****************...*
175. spacer 10.8|8279453|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP035092 (Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgtcctcatcatccgcggactcgccgccggc CRISPR spacer
tctatcgcatcatccgcgaacttgccgccgag Protospacer
** .* ***********.***.*******.
176. spacer 10.8|8279453|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NC_008688 (Paracoccus denitrificans PD1222 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgtcctcatcatccgcggactcgccgccggc CRISPR spacer
tctatcgcatcatccgcgaacttgccgccgag Protospacer
** .* ***********.***.*******.
177. spacer 10.9|8279514|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP017244 (Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence) position: , mismatch: 8, identity: 0.75
gaacgccgtccactcgtcgagccggccgtagt CRISPR spacer
gccggccgtccattcgtcgagcaggccgtctg Protospacer
* ********.********* ******
178. spacer 10.9|8279514|32|NZ_CP045740|CRISPRCasFinder,CRT matches to MN369764 (Mycobacterium phage Rahalelujah, complete genome) position: , mismatch: 8, identity: 0.75
----gaacgccgtccactcgtcgagccggccgtagt CRISPR spacer
cttctgacg----ccactcgtcgcgccggcggtagt Protospacer
.*** ********** ****** *****
179. spacer 10.15|8279513|33|NZ_CP045740|PILER-CR matches to NZ_CP017244 (Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence) position: , mismatch: 8, identity: 0.758
cgaacgccgtccactcgtcgagccggccgtagt CRISPR spacer
cgccggccgtccattcgtcgagcaggccgtctg Protospacer
** ********.********* ******
180. spacer 10.17|8279635|33|NZ_CP045740|PILER-CR matches to NZ_CP018459 (Klebsiella pneumoniae strain Kp_Goe_39795 plasmid pKp_Goe_795-4, complete sequence) position: , mismatch: 8, identity: 0.758
cggtatcaggctgataccgctttgggcatggaa CRISPR spacer
tgagtcgaggctgataccgttttgggcattgaa Protospacer
.*. . ************.********* ***
181. spacer 1.2|88333|32|NZ_CP045740|CRISPRCasFinder matches to NZ_CP011519 (Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-2, complete sequence) position: , mismatch: 9, identity: 0.719
ctcgtgccgcatgacaccggccgcacgtggag CRISPR spacer
tactcgacgcatgacaccggccgcgcgcggca Protospacer
. * .* *****************.**.** .
182. spacer 8.1|8265503|33|NZ_CP045740|PILER-CR matches to MN856003 (Bacteriophage sp. isolate 1, complete genome) position: , mismatch: 9, identity: 0.727
ttcctggaccggtactggagctaccggcccggc CRISPR spacer
actcgggaccggtactggagatacaggccttga Protospacer
..* *************** *** ****. *
183. spacer 8.6|8265808|33|NZ_CP045740|PILER-CR matches to NZ_LN832560 (Paracoccus aminovorans isolate JCM7685 plasmid II, complete sequence) position: , mismatch: 9, identity: 0.727
cgcggtcgggcgccgcttccagctggcccgcga CRISPR spacer
tgttctgaagcgcggcgtccagctggcccgcga Protospacer
.*. * ..**** ** ****************
184. spacer 8.7|8265504|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 9, identity: 0.719
tcctggaccggtactggagctaccggcccggc CRISPR spacer
cgctggaccggttctggagcgaccgcctcatg Protospacer
. ********** ******* **** *.*.
185. spacer 8.8|8265565|32|NZ_CP045740|CRISPRCasFinder,CRT matches to LR606148 (Rhizobium sp. Q54 genome assembly, plasmid: 5) position: , mismatch: 9, identity: 0.719
aggcccgccacccggtccatctgatcccggaa CRISPR spacer
ccgcccgccaagcggtccatctgatcgtcaag Protospacer
******** ************** . .*.
186. spacer 8.9|8265626|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719
ggtgcccgggtgcgctgcgacggacgcctgta CRISPR spacer
ggcgcccgggtgcgccgcgacggggtcacgac Protospacer
**.************.*******. * .*
187. spacer 8.10|8265687|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_LR134459 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence) position: , mismatch: 9, identity: 0.719
cctcgacgccgagacgctcagccggcgaatca CRISPR spacer
cgaggacgccgccacgctcagccggcgtctgc Protospacer
* ******* ************** *
188. spacer 8.12|8265809|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gcggtcgggcgccgcttccagctggcccgcga CRISPR spacer
ctgcgcgcgcgccgcctccagctggcccttgc Protospacer
.* ** *******.************ .*
189. spacer 8.12|8265809|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gcggtcgggcgccgcttccagctggcccgcga CRISPR spacer
ctgcgcgcgcgccgcctccagctggcccttgc Protospacer
.* ** *******.************ .*
190. spacer 8.12|8265809|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gcggtcgggcgccgcttccagctggcccgcga CRISPR spacer
ctgcgcgcgcgccgcctccagctggcccttgc Protospacer
.* ** *******.************ .*
191. spacer 8.12|8265809|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.719
gcggtcgggcgccgcttccagctggcccgcga CRISPR spacer
ctgcgcgcgcgccgcctccagctggcccttgc Protospacer
.* ** *******.************ .*
192. spacer 8.12|8265809|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gcggtcgggcgccgcttccagctggcccgcga CRISPR spacer
ctgcgcgcgcgccgcctccagctggcccttgc Protospacer
.* ** *******.************ .*
193. spacer 8.12|8265809|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.719
gcggtcgggcgccgcttccagctggcccgcga CRISPR spacer
ctgcgcgcgcgccgcctccagctggcccttgc Protospacer
.* ** *******.************ .*
194. spacer 8.12|8265809|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gcggtcgggcgccgcttccagctggcccgcga CRISPR spacer
ctgcgcgcgcgccgcctccagctggcccttgc Protospacer
.* ** *******.************ .*
195. spacer 8.12|8265809|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 9, identity: 0.719
gcggtcgggcgccgcttccagctggcccgcga CRISPR spacer
ctgcgcgcgcgccgcctccagctggcccttgc Protospacer
.* ** *******.************ .*
196. spacer 8.12|8265809|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gcggtcgggcgccgcttccagctggcccgcga CRISPR spacer
ctgcgcgcgcgccgcctccagctggcccttgc Protospacer
.* ** *******.************ .*
197. spacer 8.12|8265809|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NC_014811 (Mycolicibacterium gilvum Spyr1 plasmid pMSPYR101, complete sequence) position: , mismatch: 9, identity: 0.719
gcggtcgggcgccgcttccagctggcccgcga CRISPR spacer
gcctgtcggcgccggatccagctggcccgcat Protospacer
** . ******* **************.
198. spacer 8.12|8265809|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 9, identity: 0.719
gcggtcgggcgccgcttccagctggcccgcga CRISPR spacer
aacttcgagcgccgcttccagcttgccgacca Protospacer
. ***.*************** *** .* *
199. spacer 8.12|8265809|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP032053 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL2, complete sequence) position: , mismatch: 9, identity: 0.719
gcggtcgggcgccgcttccagctggcccgcga CRISPR spacer
agcatcggccgccgtttccagctggcctcgga Protospacer
. .**** *****.************. **
200. spacer 8.12|8265809|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gcggtcgggcgccgcttccagctggcccgcga CRISPR spacer
ctgcgcgcgcgccgcctccagctggcccttgc Protospacer
.* ** *******.************ .*
201. spacer 8.12|8265809|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 9, identity: 0.719
gcggtcgggcgccgcttccagctggcccgcga CRISPR spacer
aacttcgagcgccgcttccagcttgccgacca Protospacer
. ***.*************** *** .* *
202. spacer 8.12|8265809|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP032156 (Mycobacterium sp. ELW1 plasmid pELW1-1, complete sequence) position: , mismatch: 9, identity: 0.719
gcggtcgggcgccgcttccagctggcccgcga CRISPR spacer
gcctgtcggcgccggatccagctggcccgcat Protospacer
** . ******* **************.
203. spacer 8.13|8265870|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP015203 (Rhodococcus sp. 008 plasmid pR8L1, complete sequence) position: , mismatch: 9, identity: 0.719
agctggtggtcgctgacgtcgaacggcccgaa CRISPR spacer
gcggggtgggcgctgacctcgaacggcgccga Protospacer
. ***** ******* ********* * .*
204. spacer 8.13|8265870|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP054022 (Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence) position: , mismatch: 9, identity: 0.719
agctggtggtcgctgacgtcgaacggcccgaa CRISPR spacer
aaagggcggtcgctgacgtcgatcggcgggcc Protospacer
*. **.*************** **** *
205. spacer 8.13|8265870|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP054032 (Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence) position: , mismatch: 9, identity: 0.719
agctggtggtcgctgacgtcgaacggcccgaa CRISPR spacer
aaagggcggtcgctgacgtcgatcggcgggcc Protospacer
*. **.*************** **** *
206. spacer 8.15|8265992|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP032678 (Pseudomonas sp. Leaf58 plasmid pBASL58, complete sequence) position: , mismatch: 9, identity: 0.719
cggcacgggccgatgaactccacgatggccag CRISPR spacer
aggcactggcccatgaactccacgaccctcgc Protospacer
***** **** *************. .*.
207. spacer 8.16|8266053|32|NZ_CP045740|CRISPRCasFinder,CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 9, identity: 0.719
acgggcgacagcacggtcgaccacagccacga CRISPR spacer
ttggcgaacagcacggtgaaccacagccacac Protospacer
.** .********** .***********.
208. spacer 8.16|8266053|32|NZ_CP045740|CRISPRCasFinder,CRT matches to KJ510412 (Mycobacterium phage ZoeJ, complete genome) position: , mismatch: 9, identity: 0.719
acgggcgacagcacggtcgaccacagccacga CRISPR spacer
gtcgtcgacagcacggtcggccgcagccgccg Protospacer
.. * **************.**.*****.* .
209. spacer 8.17|8266114|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP034347 (Roseovarius sp. MME-070 plasmid pMME07001, complete sequence) position: , mismatch: 9, identity: 0.719
gcggcccgtatctgggcgaggatgccggacac CRISPR spacer
ccggcacctatctgggcgaggatgacatcatc Protospacer
**** * **************** *. *
210. spacer 8.17|8266114|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP022365 (Azospirillum sp. TSH58 plasmid TSH58_p06, complete sequence) position: , mismatch: 9, identity: 0.719
gcggcccgtatctgggcgaggatgccggacac CRISPR spacer
ccggctcctatctgggcgaggatgacatcgtc Protospacer
****.* **************** *. *
211. spacer 8.17|8266114|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP019018 (Escherichia coli strain Ecol_244 plasmid pEC244_2, complete sequence) position: , mismatch: 9, identity: 0.719
gcggcccgtatctgggcgaggatgccggacac CRISPR spacer
ggctcccctatctgggcgaggataccgccgaa Protospacer
* *** ***************.*** *
212. spacer 8.17|8266114|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP049812 (Monaibacterium sp. ALG8 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
gcggcccgtatctgggcgaggatgccggacac CRISPR spacer
ccagccctgatctgggcgaggatgccaccacc Protospacer
*.**** *****************. *
213. spacer 9.1|8267545|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NC_020548 (Azoarcus sp. KH32C plasmid pAZKH, complete sequence) position: , mismatch: 9, identity: 0.719
tcaacggactcgacatgccggccaaggccgaa CRISPR spacer
tcagcggcctcgacatgccggcccatctctcg Protospacer
***.*** *************** * .* .
214. spacer 9.2|8267606|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039892 (Agrobacterium tumefaciens strain CFBP5499 plasmid pAtCFBP5499c, complete sequence) position: , mismatch: 9, identity: 0.719
gtgatcgtgtcgatcgcgttgaacggcccatc CRISPR spacer
aagagagtggcgatcgcgttgaacgtcccgca Protospacer
. ** *** *************** ***..
215. spacer 9.3|8267667|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029986 (Sphingomonas sp. FARSPH plasmid p01, complete sequence) position: , mismatch: 9, identity: 0.719
tccttcaggccgggcttgatgcaggcggccac CRISPR spacer
cccactcccccggccttggtgcaggcggccac Protospacer
.** .. **** ****.*************
216. spacer 9.3|8267667|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to MN856058 (Myoviridae sp. isolate 283, complete genome) position: , mismatch: 9, identity: 0.719
tccttcaggccgggcttgatgcaggcggccac CRISPR spacer
ctgtccttgccgggcttgcggcaggcggccag Protospacer
.. *.* ********** ***********
217. spacer 9.3|8267667|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to MT006237 (Bifidobacterium phage BigBern1, complete genome) position: , mismatch: 9, identity: 0.719
tccttcaggccgggcttgatgcaggcggccac CRISPR spacer
ctgtccttgccgggcttgcggcaggcggccag Protospacer
.. *.* ********** ***********
218. spacer 9.3|8267667|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to JX042579 (Mycobacterium virus MacnCheese, complete genome) position: , mismatch: 9, identity: 0.719
tccttcaggccgggcttgatgcaggcggccac CRISPR spacer
agttccgtaccgggcttgatcccggcggccac Protospacer
.*.*. .*********** * *********
219. spacer 9.4|8267728|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047055 (Clavibacter michiganensis subsp. michiganensis strain VL527 plasmid pVL1, complete sequence) position: , mismatch: 9, identity: 0.719
gacggcgaaccgctccgggaagggccggacgg CRISPR spacer
gacggcgaaccgcatcgggaaggtcattaacc Protospacer
************* .******** * *
220. spacer 9.4|8267728|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NC_009479 (Clavibacter michiganensis subsp. michiganensis NCPPB 382 plasmid pCM2, complete sequence) position: , mismatch: 9, identity: 0.719
gacggcgaaccgctccgggaagggccggacgg CRISPR spacer
gacggcgaaccgcatcgggaaggtcattaacc Protospacer
************* .******** * *
221. spacer 9.6|8267850|31|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NC_016138 (Pseudomonas aeruginosa plasmid pUM505, complete sequence) position: , mismatch: 9, identity: 0.71
ccacgcccacagccgccgccagagcaggccg CRISPR spacer
ctggctggacagcggccgccagaacaggccg Protospacer
*.. . ***** *********.*******
222. spacer 9.6|8267850|31|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030914 (Pseudomonas aeruginosa strain Y89 plasmid pY89, complete sequence) position: , mismatch: 9, identity: 0.71
ccacgcccacagccgccgccagagcaggccg CRISPR spacer
ctggctggacagcggccgccagaacaggccg Protospacer
*.. . ***** *********.*******
223. spacer 9.9|8268032|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024895 (Amycolatopsis sp. AA4 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
gaaaccctggccgcgtcggggaatcgtgggaa CRISPR spacer
aaaaccttggccgcgtcggcgaattctccggt Protospacer
.*****.************ ****. * *.
224. spacer 9.10|8268093|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021042 (Phaeobacter gallaeciensis strain P129 plasmid pP129_b, complete sequence) position: , mismatch: 9, identity: 0.719
aatccagttaccgtccgcgttacgactcacct CRISPR spacer
tatccagttaccatccgcgttgcgatgtcgat Protospacer
***********.********.***. . *
225. spacer 9.10|8268093|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021406 (Celeribacter manganoxidans strain DY25 plasmid pDY25-B, complete sequence) position: , mismatch: 9, identity: 0.719
aatccagttaccgtccgcgttacgactcacct CRISPR spacer
tatccagttaccatccgcgttgcgatgtcgat Protospacer
***********.********.***. . *
226. spacer 9.10|8268093|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021406 (Celeribacter manganoxidans strain DY25 plasmid pDY25-B, complete sequence) position: , mismatch: 9, identity: 0.719
aatccagttaccgtccgcgttacgactcacct CRISPR spacer
tatccagttaccatccgcgttgcgatgtcgat Protospacer
***********.********.***. . *
227. spacer 9.10|8268093|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040823 (Paraoceanicella profunda strain D4M1 plasmid pD4M1E, complete sequence) position: , mismatch: 9, identity: 0.719
aatccagttaccgtccgcgttacgactcacct CRISPR spacer
tatccagttaccatccgcgttgcgatgtcgat Protospacer
***********.********.***. . *
228. spacer 9.10|8268093|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022197 (Celeribacter ethanolicus strain TSPH2 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
aatccagttaccgtccgcgttacgactcacct CRISPR spacer
tatccagttaccatccgcgttgcgatgtcgat Protospacer
***********.********.***. . *
229. spacer 9.12|8268215|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 9, identity: 0.719
agggcgtactggccgggaaccgggtcggtgat CRISPR spacer
gacgccggctggccggagaccgggtcggtgac Protospacer
.. ** .********..*************.
230. spacer 9.12|8268215|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.719
agggcgtactggccgggaaccgggtcggtgat CRISPR spacer
gacgccggctggccggagaccgggtcggtgac Protospacer
.. ** .********..*************.
231. spacer 9.12|8268215|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.719
agggcgtactggccgggaaccgggtcggtgat CRISPR spacer
gacgccggctggccggagaccgggtcggtgac Protospacer
.. ** .********..*************.
232. spacer 9.12|8268215|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 9, identity: 0.719
agggcgtactggccgggaaccgggtcggtgat CRISPR spacer
gacgccggctggccggagaccgggtcggtgac Protospacer
.. ** .********..*************.
233. spacer 9.12|8268215|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719
agggcgtactggccgggaaccgggtcggtgat CRISPR spacer
gacgccggctggccggagaccgggtcggtgac Protospacer
.. ** .********..*************.
234. spacer 9.12|8268215|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 9, identity: 0.719
agggcgtactggccgggaaccgggtcggtgat CRISPR spacer
gacgccggctggccggagaccgggtcggtgac Protospacer
.. ** .********..*************.
235. spacer 9.12|8268215|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.719
agggcgtactggccgggaaccgggtcggtgat CRISPR spacer
gacgccggctggccggagaccgggtcggtgac Protospacer
.. ** .********..*************.
236. spacer 9.12|8268215|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 9, identity: 0.719
agggcgtactggccgggaaccgggtcggtgat CRISPR spacer
gacgccggctggccggagaccgggtcggtgac Protospacer
.. ** .********..*************.
237. spacer 9.12|8268215|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719
agggcgtactggccgggaaccgggtcggtgat CRISPR spacer
gacgccggctggccggagaccgggtcggtgac Protospacer
.. ** .********..*************.
238. spacer 9.12|8268215|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719
agggcgtactggccgggaaccgggtcggtgat CRISPR spacer
gacgccggctggccggagaccgggtcggtgac Protospacer
.. ** .********..*************.
239. spacer 9.12|8268215|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719
agggcgtactggccgggaaccgggtcggtgat CRISPR spacer
gacgccggctggccggagaccgggtcggtgac Protospacer
.. ** .********..*************.
240. spacer 9.12|8268215|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719
agggcgtactggccgggaaccgggtcggtgat CRISPR spacer
gacgccggctggccggagaccgggtcggtgac Protospacer
.. ** .********..*************.
241. spacer 9.12|8268215|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719
agggcgtactggccgggaaccgggtcggtgat CRISPR spacer
gacgccggctggccggagaccgggtcggtgac Protospacer
.. ** .********..*************.
242. spacer 9.12|8268215|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719
agggcgtactggccgggaaccgggtcggtgat CRISPR spacer
gacgccggctggccggagaccgggtcggtgac Protospacer
.. ** .********..*************.
243. spacer 9.12|8268215|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719
agggcgtactggccgggaaccgggtcggtgat CRISPR spacer
gacgccggctggccggagaccgggtcggtgac Protospacer
.. ** .********..*************.
244. spacer 9.12|8268215|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719
agggcgtactggccgggaaccgggtcggtgat CRISPR spacer
gacgccggctggccggagaccgggtcggtgac Protospacer
.. ** .********..*************.
245. spacer 9.12|8268215|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719
agggcgtactggccgggaaccgggtcggtgat CRISPR spacer
gacgccggctggccggagaccgggtcggtgac Protospacer
.. ** .********..*************.
246. spacer 9.12|8268215|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NC_009956 (Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI02, complete sequence) position: , mismatch: 9, identity: 0.719
agggcgtactggccgggaaccgggtcggtgat CRISPR spacer
tgccggtactggccgggaacgtggtcggcggg Protospacer
* *************** ******.*.
247. spacer 9.12|8268215|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.719
agggcgtactggccgggaaccgggtcggtgat CRISPR spacer
gacgccggctggccggagaccgggtcggtgac Protospacer
.. ** .********..*************.
248. spacer 9.12|8268215|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.719
agggcgtactggccgggaaccgggtcggtgat CRISPR spacer
gacgccggctggccggagaccgggtcggtgac Protospacer
.. ** .********..*************.
249. spacer 9.12|8268215|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.719
agggcgtactggccgggaaccgggtcggtgat CRISPR spacer
gacgccggctggccggagaccgggtcggtgac Protospacer
.. ** .********..*************.
250. spacer 9.12|8268215|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 9, identity: 0.719
agggcgtactggccgggaaccgggtcggtgat CRISPR spacer
gacgccggctggccggagaccgggtcggtgac Protospacer
.. ** .********..*************.
251. spacer 9.12|8268215|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.719
agggcgtactggccgggaaccgggtcggtgat CRISPR spacer
gacgccggctggccggagaccgggtcggtgac Protospacer
.. ** .********..*************.
252. spacer 9.14|8268337|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP053714 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed7, complete sequence) position: , mismatch: 9, identity: 0.719
acgaacggcagcgcggagggagatggcgtcta CRISPR spacer
agcgccggcagcgcgaagggagagggcgccgg Protospacer
* . **********.******* ****.* .
253. spacer 9.15|8268398|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP040720 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
ggcggacgcaagggcggaggcaacgcccagac CRISPR spacer
gagccgctcaagggcggcggtaacgcccagat Protospacer
*. .* ********* **.**********.
254. spacer 9.16|8268459|31|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP031960 (Phaeobacter sp. LSS9 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.71
gccgcccggcgggtagttcacgtcccagggc CRISPR spacer
gtggcccggctggtagtgcacgtccctcttg Protospacer
*. ******* ****** ********
255. spacer 9.16|8268459|31|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP010602 (Phaeobacter inhibens strain P83 plasmid pP83_c, complete sequence) position: , mismatch: 9, identity: 0.71
gccgcccggcgggtagttcacgtcccagggc CRISPR spacer
gtggcccggctggtagtgcacgtccctcttg Protospacer
*. ******* ****** ********
256. spacer 9.16|8268459|31|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP010769 (Phaeobacter piscinae strain P13 plasmid pP13_b, complete sequence) position: , mismatch: 9, identity: 0.71
gccgcccggcgggtagttcacgtcccagggc CRISPR spacer
gtggcccggctggtagtgcacgtccctcttg Protospacer
*. ******* ****** ********
257. spacer 9.16|8268459|31|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP010708 (Phaeobacter inhibens strain P66 plasmid pP66_c, complete sequence) position: , mismatch: 9, identity: 0.71
gccgcccggcgggtagttcacgtcccagggc CRISPR spacer
gtggcccggctggtagtgcacgtccctcttg Protospacer
*. ******* ****** ********
258. spacer 9.17|8268519|34|NZ_CP045740|CRISPRCasFinder matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 9, identity: 0.735
acgggcatgtcggtgacgacgccggtgccggggc CRISPR spacer
gtgatcatggcggtgacgatgccggtgccgaagg Protospacer
..*. **** *********.**********..*
259. spacer 9.17|8268519|34|NZ_CP045740|CRISPRCasFinder matches to NZ_CP004394 (Celeribacter indicus strain P73 plasmid pP73A, complete sequence) position: , mismatch: 9, identity: 0.735
acgggcatgtcggtgacgacgccggtgccggggc CRISPR spacer
gtggtcatgtcggtgacgacgtcggtgagctgga Protospacer
..** ****************.***** **
260. spacer 9.17|8268519|34|NZ_CP045740|CRISPRCasFinder matches to NZ_CP044544 (Bradyrhizobium betae strain PL7HG1 plasmid pBbPL7HG1, complete sequence) position: , mismatch: 9, identity: 0.735
acgggcatgtcggtgacgacgccggtgccggggc CRISPR spacer
aacaggatgtcgatgacgacgtcggtgccggcat Protospacer
* .* ******.********.********* ..
261. spacer 9.17|8268519|34|NZ_CP045740|CRISPRCasFinder matches to CP007642 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence) position: , mismatch: 9, identity: 0.735
acgggcatgtcggtgacgacgccggtgccggggc CRISPR spacer
ccgcgcttgtcggtgacgacgccggcggcatcga Protospacer
** ** ******************.* *. *
262. spacer 9.17|8268519|34|NZ_CP045740|CRISPRCasFinder matches to NC_031265 (Gordonia phage Guacamole, complete genome) position: , mismatch: 9, identity: 0.735
acgggcatgtcggtgacgacgccggtgccggggc CRISPR spacer
acgggcatgtcggtggcggcgccgaaccgggcat Protospacer
***************.**.*****. * ** ..
263. spacer 9.17|8268519|34|NZ_CP045740|CRISPRCasFinder matches to MK967389 (Gordonia phage JasperJr, complete genome) position: , mismatch: 9, identity: 0.735
acgggcatgtcggtgacgacgccggtgccggggc CRISPR spacer
acgggcatgtcggtggcggcgccgaaccgggcat Protospacer
***************.**.*****. * ** ..
264. spacer 10.4|8279209|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 9, identity: 0.719
gcgcccgcgtccggctccggcggcacgatgta CRISPR spacer
aggaccgcatccggctccggcggcacgggcgg Protospacer
. * ****.******************. .
265. spacer 10.4|8279209|32|NZ_CP045740|CRISPRCasFinder,CRT matches to MH509442 (Mycobacterium phage Aminay, complete genome) position: , mismatch: 9, identity: 0.719
gcgcccgcgtccggctccggcggcacgatgta CRISPR spacer
ccgcccgcggccggcgccggcggcggcttcaa Protospacer
******** ***** ********. * *
266. spacer 10.8|8279453|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NC_048098 (Arthrobacter phage Andrew, complete genome) position: , mismatch: 9, identity: 0.719
tcgtcctcatcatccgcggactcgccgccggc CRISPR spacer
cccatggcctcattcgcggagtcgccgccggc Protospacer
.* . * ****.****** ***********
267. spacer 10.9|8279514|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_AP014708 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_4p, complete sequence) position: , mismatch: 9, identity: 0.719
gaacgccgtccactcgtcgagccggccgtagt CRISPR spacer
cgccgccgtcccctcgtcgagccagcccacgc Protospacer
. ******** ***********.*** *.
268. spacer 10.9|8279514|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_LT703509 (Mycobacterium chimaera strain Mycobacterium chimaera MC045 isolate Mycobacterium chimaera plasmid 5) position: , mismatch: 9, identity: 0.719
gaacgccgtccactcgtcgagccggccgtagt CRISPR spacer
gcggcgcgaccactcgtcgagccgggcgttct Protospacer
* . ** **************** *** *
269. spacer 10.9|8279514|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP015274 (Mycobacterium chimaera strain ZUERICH-1 plasmid unnamed 2, complete sequence) position: , mismatch: 9, identity: 0.719
gaacgccgtccactcgtcgagccggccgtagt CRISPR spacer
gcggcgcgaccactcgtcgagccgggcgttct Protospacer
* . ** **************** *** *
270. spacer 10.9|8279514|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP019223 (Mycobacterium chimaera strain CDC 2015-22-71 plasmid pDHQP20152271_2, complete sequence) position: , mismatch: 9, identity: 0.719
gaacgccgtccactcgtcgagccggccgtagt CRISPR spacer
gcggcgcgaccactcgtcgagccgggcgttct Protospacer
* . ** **************** *** *
271. spacer 10.9|8279514|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP045965 (Mycobacterium chimaera strain AUSMDU00007395 plasmid pAUSMDU00007395_02, complete sequence) position: , mismatch: 9, identity: 0.719
gaacgccgtccactcgtcgagccggccgtagt CRISPR spacer
gcggcgcgaccactcgtcgagccgggcgttct Protospacer
* . ** **************** *** *
272. spacer 1.1|88272|32|NZ_CP045740|CRISPRCasFinder matches to NZ_CP007575 (Streptomyces albulus strain NK660 plasmid pNKL, complete sequence) position: , mismatch: 10, identity: 0.688
tgcaagaggtgtgccgtgcttgggcctggtgc CRISPR spacer
tgcaagaggtgtgccgtcgttggaagacaaac Protospacer
***************** ****. . .*
273. spacer 1.2|88333|32|NZ_CP045740|CRISPRCasFinder matches to NZ_CP025548 (Mycobacterium paragordonae strain 49061 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
ctcgtgccgcatgacaccggccgcacgtggag CRISPR spacer
ggcgtgccgcaccacaccggccgcaagcccct Protospacer
*********. ************ *.
274. spacer 3.1|3060775|36|NZ_CP045740|CRT matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.722
aaggcggacgcggtggagacggacgcggtggaggcc CRISPR spacer
tgccaggacgcggtgaagccggacgcggtggtcgcg Protospacer
. **********.** ************ **
275. spacer 3.1|3060775|36|NZ_CP045740|CRT matches to NZ_CP030762 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.722
aaggcggacgcggtggagacggacgcggtggaggcc CRISPR spacer
tgccaggacgcggtgaagccggacgcggtggtcgcg Protospacer
. **********.** ************ **
276. spacer 8.2|8265564|33|NZ_CP045740|PILER-CR matches to LR606148 (Rhizobium sp. Q54 genome assembly, plasmid: 5) position: , mismatch: 10, identity: 0.697
caggcccgccacccggtccatctgatcccggaa CRISPR spacer
accgcccgccaagcggtccatctgatcgtcaag Protospacer
******** ************** . .*.
277. spacer 8.2|8265564|33|NZ_CP045740|PILER-CR matches to NZ_CP038235 (Leisingera sp. NJS201 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.697
caggcccgccacccggtccatctgatcccggaa CRISPR spacer
cagggccgctacccggtccatctgcatatgacc Protospacer
**** ****.************** . .*.
278. spacer 8.2|8265564|33|NZ_CP045740|PILER-CR matches to NZ_CP038235 (Leisingera sp. NJS201 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.697
caggcccgccacccggtccatctgatcccggaa CRISPR spacer
cagggccgctacccggtccatctgcatatgacc Protospacer
**** ****.************** . .*.
279. spacer 8.8|8265565|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP038235 (Leisingera sp. NJS201 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
aggcccgccacccggtccatctgatcccggaa CRISPR spacer
agggccgctacccggtccatctgcatatgacc Protospacer
*** ****.************** . .*.
280. spacer 8.8|8265565|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP038235 (Leisingera sp. NJS201 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
aggcccgccacccggtccatctgatcccggaa CRISPR spacer
agggccgctacccggtccatctgcatatgacc Protospacer
*** ****.************** . .*.
281. spacer 8.8|8265565|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP022671 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR6, complete sequence) position: , mismatch: 10, identity: 0.688
aggcccgccacccggtccatctgatcccggaa CRISPR spacer
gcgataatcagccggtccatctgctcccggag Protospacer
. * . ..** ************ *******.
282. spacer 8.12|8265809|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 10, identity: 0.688
gcggtcgggcgccgcttccagctggcccgcga CRISPR spacer
aacttcgagcgccgcttccagcttgccgatta Protospacer
. ***.*************** *** .. *
283. spacer 8.12|8265809|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.688
gcggtcgggcgccgcttccagctggcccgcga CRISPR spacer
aacttcgagcgccgcttccagcttgccgatta Protospacer
. ***.*************** *** .. *
284. spacer 8.12|8265809|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP030354 (Novosphingobium sp. P6W plasmid pP6W1, complete sequence) position: , mismatch: 10, identity: 0.688
gcggtcgggcgccgcttccagctggcccgcga CRISPR spacer
tcattcgaacgccgcttccagctggccgattt Protospacer
*. ***..****************** ..
285. spacer 8.12|8265809|32|NZ_CP045740|CRISPRCasFinder,CRT matches to MN234173 (Arthrobacter phage Sporto, complete genome) position: , mismatch: 10, identity: 0.688
gcggtcgggcgccgcttccagctggcccgcga CRISPR spacer
aaaccttgccgcagcttccagctggcctgcga Protospacer
. . .. * *** **************.****
286. spacer 8.13|8265870|32|NZ_CP045740|CRISPRCasFinder,CRT matches to LR606148 (Rhizobium sp. Q54 genome assembly, plasmid: 5) position: , mismatch: 10, identity: 0.688
agctggtggtcgctgacgtcgaacggcccgaa CRISPR spacer
ccatcgtggtcgatgacgtggaacggccgagg Protospacer
* ******* ****** ******** ...
287. spacer 8.14|8265931|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.688
cagagcgcccgcgcgctccagaacgacgggtc CRISPR spacer
gcgagggccagcgcgctccagaacgtgacgcg Protospacer
*** *** *************** . *.
288. spacer 8.16|8266053|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP020539 (Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence) position: , mismatch: 10, identity: 0.688
acgggcgacagcacggtcgaccacagccacga CRISPR spacer
caacccgtcagcacggtcgacaacagccgcag Protospacer
. ** ************* ******.*..
289. spacer 8.16|8266053|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP029828 (Burkholderia sp. JP2-270 plasmid p2, complete sequence) position: , mismatch: 10, identity: 0.688
acgggcgacagcacggtcgaccacagccacga CRISPR spacer
ttcgcgaacagcacggtgaaccacagccacag Protospacer
. * .********** .***********..
290. spacer 8.16|8266053|32|NZ_CP045740|CRISPRCasFinder,CRT matches to NZ_CP029828 (Burkholderia sp. JP2-270 plasmid p2, complete sequence) position: , mismatch: 10, identity: 0.688
acgggcgacagcacggtcgaccacagccacga CRISPR spacer
ttcgcgaacagcacggtgaaccacagccacag Protospacer
. * .********** .***********..
291. spacer 9.3|8267667|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018472 (Xanthomonas perforans strain LH3 plasmid pLH3.1, complete sequence) position: , mismatch: 10, identity: 0.688
tccttcaggccgggcttgatgcaggcggccac CRISPR spacer
gtcttcaggccggccttgatgctggacatctg Protospacer
.*********** ******** ** ..*
292. spacer 9.3|8267667|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 10, identity: 0.688
tccttcaggccgggcttgatgcaggcggccac CRISPR spacer
agatcacggccgcgctggatgcaggcggccgg Protospacer
*. ***** *** *************.
293. spacer 9.3|8267667|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015006 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA01, complete sequence) position: , mismatch: 10, identity: 0.688
tccttcaggccgggcttgatgcaggcggccac CRISPR spacer
tgacggtcgccgtgcttgatgccggcggccat Protospacer
* . **** ********* ********.
294. spacer 9.3|8267667|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018726 (Xanthomonas vesicatoria ATCC 35937 strain LMG911 plasmid pLMG911.1, complete sequence) position: , mismatch: 10, identity: 0.688
tccttcaggccgggcttgatgcaggcggccac CRISPR spacer
gtcttcaggccggccttgatgctggacatctg Protospacer
.*********** ******** ** ..*
295. spacer 9.3|8267667|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018732 (Xanthomonas gardneri strain ICMP 7383 plasmid pICMP7383.1, complete sequence) position: , mismatch: 10, identity: 0.688
tccttcaggccgggcttgatgcaggcggccac CRISPR spacer
gtcttcaggccggccttgatgctggacatctg Protospacer
.*********** ******** ** ..*
296. spacer 9.8|8267971|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NC_012521 (Rhodococcus opacus B4 plasmid pROB02, complete sequence) position: , mismatch: 10, identity: 0.688
aaagcgggtgtcgacgggtcgaaaacggtcaa CRISPR spacer
cggtcggctgtcgacgggtcgaagacgtccgg Protospacer
.. *** ***************.*** .*..
297. spacer 9.17|8268519|34|NZ_CP045740|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 10, identity: 0.706
acgggcatgtcggtgacgacgccggtgccggggc CRISPR spacer
gtcatcatggcggtgacgatgccggtgccgaagg Protospacer
.. . **** *********.**********..*
298. spacer 9.17|8268519|34|NZ_CP045740|CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.706
acgggcatgtcggtgacgacgccggtgccggggc CRISPR spacer
gtcatcatggcggtgacgatgccggtgccgaagg Protospacer
.. . **** *********.**********..*
299. spacer 9.17|8268519|34|NZ_CP045740|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.706
acgggcatgtcggtgacgacgccggtgccggggc CRISPR spacer
gtcatcatggcggtgacgatgccggtgccgaagg Protospacer
.. . **** *********.**********..*
300. spacer 9.17|8268519|34|NZ_CP045740|CRISPRCasFinder matches to NZ_CP053566 (Pseudonocardia sp. Gen01 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.706
acgggcatgtcggtgacgacgccggtgccggggc CRISPR spacer
gtgccggtagcggtgacgacgccggagccggtgc Protospacer
..* .*. *************** ***** **
301. spacer 9.17|8268519|34|NZ_CP045740|CRISPRCasFinder matches to NZ_CP053566 (Pseudonocardia sp. Gen01 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.706
acgggcatgtcggtgacgacgccggtgccggggc CRISPR spacer
gtgccggtagcggtgacgacgccggagccggtgc Protospacer
..* .*. *************** ***** **
302. spacer 10.15|8279513|33|NZ_CP045740|PILER-CR matches to NZ_AP014708 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_4p, complete sequence) position: , mismatch: 10, identity: 0.697
cgaacgccgtccactcgtcgagccggccgtagt CRISPR spacer
gcgccgccgtcccctcgtcgagccagcccacgc Protospacer
. ******** ***********.*** *.
303. spacer 9.3|8267667|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019037 (Massilia putida strain 6NM-7 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.656
tccttcaggccgggcttgatgcaggcggccac CRISPR spacer
gttacggtgccgtgcttgatggaggcggccag Protospacer
.. . . **** ******** *********
304. spacer 9.4|8267728|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR723678 (Arsenite-oxidising bacterium NT-25 plasmid 2) position: , mismatch: 11, identity: 0.656
gacggcgaaccgctccgggaagggccggacgg CRISPR spacer
cggcgcgaaccgctgcgggaaaggccgagacc Protospacer
. ********** ******.*****..
305. spacer 9.4|8267728|32|NZ_CP045740|PILER-CR,CRISPRCasFinder,CRT matches to NZ_FO082821 (Rhizobium sp. NT-26 plasmid NT26_p1, complete sequence) position: , mismatch: 11, identity: 0.656
gacggcgaaccgctccgggaagggccggacgg CRISPR spacer
cggcgcgaaccgctgcgggaaaggccgagacc Protospacer
. ********** ******.*****..
306. spacer 9.17|8268519|34|NZ_CP045740|CRISPRCasFinder matches to NZ_CP014276 (Martelella sp. AD-3 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.676
acgggcatgtcggtgacgacgccggtgccggggc CRISPR spacer
gcgggcatgtcggtgacgccggcggccagcatgt Protospacer
.***************** ** ***. . *.
307. spacer 10.9|8279514|32|NZ_CP045740|CRISPRCasFinder,CRT matches to MN204493 (Streptomyces phage Zuko, complete genome) position: , mismatch: 11, identity: 0.656
gaacgccgtccactcgtcgagccggccgtagt CRISPR spacer
acacgctgtccactcgccgagccggtgtcctc Protospacer
. ****.*********.********. . .
