Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP045811 Bacillus subtilis strain P9_B1 chromosome, complete genome 4 crisprs csa3,cas3,DEDDh,WYL,DinG 0 1 11 0

Results visualization

1. NZ_CP045811
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045811_1 917030-917135 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045811_2 2537304-2537414 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045811_3 3019801-3019908 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045811_4 3562562-3562674 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP045811_3 3.1|3019825|60|NZ_CP045811|CRISPRCasFinder 3019825-3019884 60 NZ_CP024037 Bacillus aryabhattai strain K13 plasmid unnamed2 10417-10476 7 0.883
NZ_CP045811_3 3.1|3019825|60|NZ_CP045811|CRISPRCasFinder 3019825-3019884 60 NZ_CP026740 Bacillus megaterium strain YC4-R4 plasmid unnamed4 70764-70823 7 0.883
NZ_CP045811_3 3.1|3019825|60|NZ_CP045811|CRISPRCasFinder 3019825-3019884 60 NC_017139 Bacillus megaterium WSH-002 plasmid WSH-002_p1, complete sequence 1318-1377 7 0.883
NZ_CP045811_3 3.1|3019825|60|NZ_CP045811|CRISPRCasFinder 3019825-3019884 60 NZ_CP010587 Bacillus megaterium Q3 plasmid p1, complete sequence 838-897 7 0.883
NZ_CP045811_3 3.1|3019825|60|NZ_CP045811|CRISPRCasFinder 3019825-3019884 60 NZ_CP023319 Bacillus megaterium strain A plasmid p2, complete sequence 75825-75884 7 0.883
NZ_CP045811_3 3.1|3019825|60|NZ_CP045811|CRISPRCasFinder 3019825-3019884 60 NC_020451 Vibrio coralliilyticus strain ATCC BAA-450 plasmid, complete sequence 1960-2019 9 0.85
NZ_CP045811_3 3.1|3019825|60|NZ_CP045811|CRISPRCasFinder 3019825-3019884 60 NZ_CP015440 Anoxybacillus amylolyticus strain DSM 15939 plasmid pDSM15939_2, complete sequence 64773-64832 12 0.8
NZ_CP045811_3 3.1|3019825|60|NZ_CP045811|CRISPRCasFinder 3019825-3019884 60 NZ_CP033045 Bacillus foraminis strain Bac44 plasmid unnamed, complete sequence 483791-483850 13 0.783
NZ_CP045811_3 3.1|3019825|60|NZ_CP045811|CRISPRCasFinder 3019825-3019884 60 NZ_LR134399 Listeria monocytogenes strain NCTC7974 plasmid 2, complete sequence 57361-57420 14 0.767

1. spacer 3.1|3019825|60|NZ_CP045811|CRISPRCasFinder matches to NZ_CP024037 (Bacillus aryabhattai strain K13 plasmid unnamed2) position: , mismatch: 7, identity: 0.883

cagcttggaaggctgaggttttaccactaaactacacccgcaatttttatttggggcgat	CRISPR spacer
cagcttggaaggctgaggttttaccactaaactacacccgcatatttta-aagtggcggt	Protospacer
******************************************  *****   * ****.*

2. spacer 3.1|3019825|60|NZ_CP045811|CRISPRCasFinder matches to NZ_CP026740 (Bacillus megaterium strain YC4-R4 plasmid unnamed4) position: , mismatch: 7, identity: 0.883

cagcttggaaggctgaggttttaccactaaactacacccgcaatttttatttggggcgat	CRISPR spacer
cagcttggaaggctgaggttttaccactaaactacacccgcatatttta-aagtggcggt	Protospacer
******************************************  *****   * ****.*

3. spacer 3.1|3019825|60|NZ_CP045811|CRISPRCasFinder matches to NC_017139 (Bacillus megaterium WSH-002 plasmid WSH-002_p1, complete sequence) position: , mismatch: 7, identity: 0.883

cagcttggaaggctgaggttttaccactaaactacacccgcaatttttatttggggcgat	CRISPR spacer
cagcttggaaggctgaggttttaccactaaactacacccgcatatttta-aagtggcggt	Protospacer
******************************************  *****   * ****.*

4. spacer 3.1|3019825|60|NZ_CP045811|CRISPRCasFinder matches to NZ_CP010587 (Bacillus megaterium Q3 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.883

cagcttggaaggctgaggttttaccactaaactacacccgcaatttttatttggggcgat	CRISPR spacer
cagcttggaaggctgaggttttaccactaaactacacccgcatatttta-aagtggcggt	Protospacer
******************************************  *****   * ****.*

5. spacer 3.1|3019825|60|NZ_CP045811|CRISPRCasFinder matches to NZ_CP023319 (Bacillus megaterium strain A plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.883

cagcttggaaggctgaggttttaccactaaactacacccgcaatttttatttggggcgat	CRISPR spacer
cagcttggaaggctgaggttttaccactaaactacacccgcatatttta-aagtggcggt	Protospacer
******************************************  *****   * ****.*

6. spacer 3.1|3019825|60|NZ_CP045811|CRISPRCasFinder matches to NC_020451 (Vibrio coralliilyticus strain ATCC BAA-450 plasmid, complete sequence) position: , mismatch: 9, identity: 0.85

cagcttggaaggctgaggttttaccactaaactacacccgcaatttttatttggggcgat	CRISPR spacer
cagcttggaaggctgaggttttaccactaaactacacccgcattttagttatggcccggg	Protospacer
****************************************** ***   * ***  **. 

7. spacer 3.1|3019825|60|NZ_CP045811|CRISPRCasFinder matches to NZ_CP015440 (Anoxybacillus amylolyticus strain DSM 15939 plasmid pDSM15939_2, complete sequence) position: , mismatch: 12, identity: 0.8

cagcttggaaggctgaggttttaccactaaactacacccgca-------atttttatttg	CRISPR spacer
cagcttggaaggctgaggttttaccactaaactacacccgcataataatatataccattg	Protospacer
******************************************       ** * .  ***

8. spacer 3.1|3019825|60|NZ_CP045811|CRISPRCasFinder matches to NZ_CP033045 (Bacillus foraminis strain Bac44 plasmid unnamed, complete sequence) position: , mismatch: 13, identity: 0.783

cagcttggaaggctgaggttttaccactaaactacacccgc--------aatttttattt	CRISPR spacer
cagcttggaaggctgaggttttaccactaaactacacccgcatggttaaaagttttgcca	Protospacer
*****************************************        ** ****... 

9. spacer 3.1|3019825|60|NZ_CP045811|CRISPRCasFinder matches to NZ_LR134399 (Listeria monocytogenes strain NCTC7974 plasmid 2, complete sequence) position: , mismatch: 14, identity: 0.767

cagcttggaaggctgaggttttaccactaaactacacccgc---------aatttttatt	CRISPR spacer
cagcttggaaggctgtagttttaccactaaactacacccgcatagtaagtagttcttagt	Protospacer
*************** .************************         *.**.*** *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 679316 : 687682 8 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_2 1186841 : 1230615 49 Planktothrix_phage(25.0%) tRNA,coat NA
DBSCAN-SWA_3 1293477 : 1338313 57 Bacillus_phage(25.71%) protease,portal,terminase,holin,plate NA
DBSCAN-SWA_4 1847644 : 1854199 6 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_5 2038718 : 2044405 9 Bacillus_phage(100.0%) holin NA
DBSCAN-SWA_6 2269868 : 2275964 8 Staphylococcus_phage(66.67%) NA NA
DBSCAN-SWA_7 2505709 : 2535229 38 Bacillus_phage(38.1%) portal,terminase,holin,plate,tail NA
DBSCAN-SWA_8 2539066 : 2546785 16 uncultured_Caudovirales_phage(63.64%) NA NA
DBSCAN-SWA_9 2680270 : 2733587 56 uncultured_Mediterranean_phage(12.5%) protease,coat,tRNA NA
DBSCAN-SWA_10 3307350 : 3318547 14 Organic_Lake_phycodnavirus(50.0%) holin NA
DBSCAN-SWA_11 3681221 : 3757836 78 Bacillus_phage(26.67%) coat,protease,bacteriocin,tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage