Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP043481 Komagataeibacter oboediens strain BPZTR01 chromosome, complete genome 3 crisprs csa3,DEDDh,DinG 0 1 0 0

Results visualization

1. NZ_CP043481
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP043481_1 718988-719103 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP043481_2 1866386-1866483 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP043481_3 2289441-2289535 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP043481_3 3.1|2289471|35|NZ_CP043481|CRISPRCasFinder 2289471-2289505 35 MG944235 Xanthomonas phage XPV2, complete genome 2251-2285 8 0.771
NZ_CP043481_3 3.1|2289471|35|NZ_CP043481|CRISPRCasFinder 2289471-2289505 35 MG944236 Xanthomonas phage XPV3, complete genome 41225-41259 8 0.771
NZ_CP043481_3 3.1|2289471|35|NZ_CP043481|CRISPRCasFinder 2289471-2289505 35 MG944234 Xanthomonas phage XPV1, complete genome 41792-41826 8 0.771
NZ_CP043481_3 3.1|2289471|35|NZ_CP043481|CRISPRCasFinder 2289471-2289505 35 NC_014155 Thiomonas intermedia K12 plasmid pTINT02, complete sequence 2923-2957 10 0.714
NZ_CP043481_3 3.1|2289471|35|NZ_CP043481|CRISPRCasFinder 2289471-2289505 35 MG944231 Xanthomonas phage XPP6, complete genome 43853-43887 11 0.686
NZ_CP043481_3 3.1|2289471|35|NZ_CP043481|CRISPRCasFinder 2289471-2289505 35 MG944232 Xanthomonas phage XPP8, complete genome 2395-2429 11 0.686
NZ_CP043481_3 3.1|2289471|35|NZ_CP043481|CRISPRCasFinder 2289471-2289505 35 MG944228 Xanthomonas phage XPP2, complete genome 12129-12163 11 0.686
NZ_CP043481_3 3.1|2289471|35|NZ_CP043481|CRISPRCasFinder 2289471-2289505 35 MG944229 Xanthomonas phage XPP3, complete genome 15283-15317 11 0.686
NZ_CP043481_3 3.1|2289471|35|NZ_CP043481|CRISPRCasFinder 2289471-2289505 35 MG944227 Xanthomonas phage XPP1, complete genome 19414-19448 11 0.686
NZ_CP043481_3 3.1|2289471|35|NZ_CP043481|CRISPRCasFinder 2289471-2289505 35 MG944230 Xanthomonas phage XPP4, complete genome 20509-20543 11 0.686
NZ_CP043481_3 3.1|2289471|35|NZ_CP043481|CRISPRCasFinder 2289471-2289505 35 MG944233 Xanthomonas phage XPP9, complete genome 19299-19333 11 0.686

1. spacer 3.1|2289471|35|NZ_CP043481|CRISPRCasFinder matches to MG944235 (Xanthomonas phage XPV2, complete genome) position: , mismatch: 8, identity: 0.771

gaaagcccgccgcaaggcgggtttttcgtatgtac	CRISPR spacer
aaaaacccgccgaaaggcgggttttttttacgatc	Protospacer
.***.******* *************. **.*  *

2. spacer 3.1|2289471|35|NZ_CP043481|CRISPRCasFinder matches to MG944236 (Xanthomonas phage XPV3, complete genome) position: , mismatch: 8, identity: 0.771

gaaagcccgccgcaaggcgggtttttcgtatgtac-	CRISPR spacer
aaaaacccgccgaaaggcgggtttttt-tacgatct	Protospacer
.***.******* *************. **.*  * 

3. spacer 3.1|2289471|35|NZ_CP043481|CRISPRCasFinder matches to MG944234 (Xanthomonas phage XPV1, complete genome) position: , mismatch: 8, identity: 0.771

gaaagcccgccgcaaggcgggtttttcgtatgtac	CRISPR spacer
aaaaacccgccgaaaggcgggttttttttacgatc	Protospacer
.***.******* *************. **.*  *

4. spacer 3.1|2289471|35|NZ_CP043481|CRISPRCasFinder matches to NC_014155 (Thiomonas intermedia K12 plasmid pTINT02, complete sequence) position: , mismatch: 10, identity: 0.714

gaaagcccgccgcaaggcgggtttttcgtatgtac	CRISPR spacer
caaaacccgccgcgaggcgggtttttttcatccgg	Protospacer
 ***.********.************. .** .. 

5. spacer 3.1|2289471|35|NZ_CP043481|CRISPRCasFinder matches to MG944231 (Xanthomonas phage XPP6, complete genome) position: , mismatch: 11, identity: 0.686

gaaagcccgccgcaaggcgggtttttcgtatgtac	CRISPR spacer
aaaaacccgccgaaaggcgggttttttacgatctc	Protospacer
.***.******* *************....  . *

6. spacer 3.1|2289471|35|NZ_CP043481|CRISPRCasFinder matches to MG944232 (Xanthomonas phage XPP8, complete genome) position: , mismatch: 11, identity: 0.686

gaaagcccgccgcaaggcgggtttttcgtatgtac	CRISPR spacer
aaaaacccgccgaaaggcgggttttttacgatctc	Protospacer
.***.******* *************....  . *

7. spacer 3.1|2289471|35|NZ_CP043481|CRISPRCasFinder matches to MG944228 (Xanthomonas phage XPP2, complete genome) position: , mismatch: 11, identity: 0.686

gaaagcccgccgcaaggcgggtttttcgtatgtac	CRISPR spacer
aaaaacccgccgaaaggcgggttttttacgatctc	Protospacer
.***.******* *************....  . *

8. spacer 3.1|2289471|35|NZ_CP043481|CRISPRCasFinder matches to MG944229 (Xanthomonas phage XPP3, complete genome) position: , mismatch: 11, identity: 0.686

gaaagcccgccgcaaggcgggtttttcgtatgtac	CRISPR spacer
aaaaacccgccgaaaggcgggttttttacgatctc	Protospacer
.***.******* *************....  . *

9. spacer 3.1|2289471|35|NZ_CP043481|CRISPRCasFinder matches to MG944227 (Xanthomonas phage XPP1, complete genome) position: , mismatch: 11, identity: 0.686

gaaagcccgccgcaaggcgggtttttcgtatgtac	CRISPR spacer
aaaaacccgccgaaaggcgggttttttacgatctc	Protospacer
.***.******* *************....  . *

10. spacer 3.1|2289471|35|NZ_CP043481|CRISPRCasFinder matches to MG944230 (Xanthomonas phage XPP4, complete genome) position: , mismatch: 11, identity: 0.686

gaaagcccgccgcaaggcgggtttttcgtatgtac	CRISPR spacer
aaaaacccgccgaaaggcgggttttttacgatctc	Protospacer
.***.******* *************....  . *

11. spacer 3.1|2289471|35|NZ_CP043481|CRISPRCasFinder matches to MG944233 (Xanthomonas phage XPP9, complete genome) position: , mismatch: 11, identity: 0.686

gaaagcccgccgcaaggcgggtttttcgtatgtac	CRISPR spacer
aaaaacccgccgaaaggcgggttttttacgatctc	Protospacer
.***.******* *************....  . *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage