Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP040432 Stenotrophomonas maltophilia strain sm-RA9 chromosome, complete genome 15 crisprs WYL,DEDDh,csa3,cas3,PD-DExK,DinG 0 1 4 0

Results visualization

1. NZ_CP040432
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040432_1 1163557-1163687 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040432_2 1538616-1538708 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040432_3 2442770-2442891 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040432_4 2455759-2455833 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040432_5 2465136-2465246 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040432_6 2676718-2676830 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040432_7 2712170-2712266 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040432_8 3179489-3179588 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040432_9 3510792-3510895 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040432_10 3875845-3875943 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040432_11 4033458-4033611 Unclear NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040432_12 4239647-4239726 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040432_13 4596719-4596829 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040432_14 4603640-4603738 Orphan NA
1 spacers
PD-DExK

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040432_15 4934094-4934196 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP040432_12 12.1|4239673|28|NZ_CP040432|CRISPRCasFinder 4239673-4239700 28 NZ_CP048424 Rhizobium daejeonense strain KACC 13094 plasmid unnamed1, complete sequence 238673-238700 5 0.821
NZ_CP040432_12 12.1|4239673|28|NZ_CP040432|CRISPRCasFinder 4239673-4239700 28 NZ_CP022299 Acinetobacter johnsonii strain IC001 plasmid pIC001A, complete sequence 13387-13414 7 0.75

1. spacer 12.1|4239673|28|NZ_CP040432|CRISPRCasFinder matches to NZ_CP048424 (Rhizobium daejeonense strain KACC 13094 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

aggttcatggcgtcggcggaataggtgc	CRISPR spacer
gggttcatggcatctgcggaatagccgc	Protospacer
.**********.** ********* .**

2. spacer 12.1|4239673|28|NZ_CP040432|CRISPRCasFinder matches to NZ_CP022299 (Acinetobacter johnsonii strain IC001 plasmid pIC001A, complete sequence) position: , mismatch: 7, identity: 0.75

aggttcatggcgtcggcggaataggtgc	CRISPR spacer
gcgatcatggcgtcgccggaatagggag	Protospacer
. * *********** ********* . 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 596515 : 603952 7 Enterobacteria_phage(42.86%) NA NA
DBSCAN-SWA_2 1082157 : 1088933 8 Acinetobacter_phage(50.0%) NA NA
DBSCAN-SWA_3 1834569 : 1874078 45 Stenotrophomonas_phage(91.18%) integrase,portal,terminase attL 1834361:1834408|attR 1875001:1875048
DBSCAN-SWA_4 3704787 : 3773055 55 Thermus_phage(15.38%) transposase,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage