Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP045472 Staphylococcus aureus strain ZY05 chromosome, complete genome 12 crisprs DEDDh,cas3,WYL,csa3 5 2 222 1
NZ_CP045473 Staphylococcus aureus strain ZY05 plasmid pZY05, complete sequence 0 crisprs csa3 0 0 0 0

Results visualization

1. NZ_CP045472
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045472_1 124608-124687 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045472_2 332595-332687 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045472_3 743000-743085 Unclear NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045472_4 789391-789475 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045472_5 906829-906922 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045472_6 1571791-1571876 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045472_7 1838122-1838255 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045472_8 1841796-1841928 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045472_9 1938458-1938550 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045472_10 2092972-2093056 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045472_11 2400271-2400352 Orphan NA
1 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045472_12 2592963-2593042 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP045472_3 3.1|743027|32|NZ_CP045472|CRISPRCasFinder 743027-743058 32 NZ_CP045472.1 2058737-2058768 0 1.0
NZ_CP045472_6 6.1|1571821|26|NZ_CP045472|CRISPRCasFinder 1571821-1571846 26 NZ_CP045472.1 270020-270045 0 1.0
NZ_CP045472_6 6.1|1571821|26|NZ_CP045472|CRISPRCasFinder 1571821-1571846 26 NZ_CP045472.1 406978-407003 0 1.0
NZ_CP045472_6 6.1|1571821|26|NZ_CP045472|CRISPRCasFinder 1571821-1571846 26 NZ_CP045472.1 942987-943012 0 1.0
NZ_CP045472_3 3.1|743027|32|NZ_CP045472|CRISPRCasFinder 743027-743058 32 NZ_CP045472.1 269945-269976 1 0.969
NZ_CP045472_6 6.1|1571821|26|NZ_CP045472|CRISPRCasFinder 1571821-1571846 26 NZ_CP045472.1 733990-734015 1 0.962
NZ_CP045472_6 6.1|1571821|26|NZ_CP045472|CRISPRCasFinder 1571821-1571846 26 NZ_CP045472.1 2175406-2175431 1 0.962
NZ_CP045472_6 6.1|1571821|26|NZ_CP045472|CRISPRCasFinder 1571821-1571846 26 NZ_CP045472.1 2350602-2350627 1 0.962
NZ_CP045472_6 6.1|1571821|26|NZ_CP045472|CRISPRCasFinder 1571821-1571846 26 NZ_CP045472.1 779933-779958 1 0.962
NZ_CP045472_6 6.1|1571821|26|NZ_CP045472|CRISPRCasFinder 1571821-1571846 26 NZ_CP045472.1 779989-780014 1 0.962
NZ_CP045472_6 6.1|1571821|26|NZ_CP045472|CRISPRCasFinder 1571821-1571846 26 NZ_CP045472.1 2058670-2058695 1 0.962
NZ_CP045472_6 6.1|1571821|26|NZ_CP045472|CRISPRCasFinder 1571821-1571846 26 NZ_CP045472.1 2533557-2533582 1 0.962
NZ_CP045472_10 10.1|2093002|25|NZ_CP045472|CRISPRCasFinder 2093002-2093026 25 NZ_CP045472.1 2092946-2092970 1 0.96
NZ_CP045472_10 10.1|2093002|25|NZ_CP045472|CRISPRCasFinder 2093002-2093026 25 NZ_CP045472.1 2504712-2504736 1 0.96
NZ_CP045472_10 10.1|2093002|25|NZ_CP045472|CRISPRCasFinder 2093002-2093026 25 NZ_CP045472.1 407093-407117 1 0.96
NZ_CP045472_12 12.1|2592987|32|NZ_CP045472|CRISPRCasFinder 2592987-2593018 32 NZ_CP045472.1 411236-411267 1 0.969
NZ_CP045472_3 3.1|743027|32|NZ_CP045472|CRISPRCasFinder 743027-743058 32 NZ_CP045472.1 1571747-1571778 2 0.938
NZ_CP045472_4 4.1|789418|31|NZ_CP045472|CRISPRCasFinder 789418-789448 31 NZ_CP045472.1 748375-748405 2 0.935
NZ_CP045472_6 6.1|1571821|26|NZ_CP045472|CRISPRCasFinder 1571821-1571846 26 NZ_CP045472.1 2254407-2254432 2 0.923
NZ_CP045472_6 6.1|1571821|26|NZ_CP045472|CRISPRCasFinder 1571821-1571846 26 NZ_CP045472.1 2254745-2254770 2 0.923
NZ_CP045472_10 10.1|2093002|25|NZ_CP045472|CRISPRCasFinder 2093002-2093026 25 NZ_CP045472.1 407149-407173 2 0.92

1. spacer 3.1|743027|32|NZ_CP045472|CRISPRCasFinder matches to position: 2058737-2058768, mismatch: 0, identity: 1.0 

ggcaatgcgagttggggtgtgggccccaacac	CRISPR spacer
ggcaatgcgagttggggtgtgggccccaacac	Protospacer
********************************

2. spacer 6.1|1571821|26|NZ_CP045472|CRISPRCasFinder matches to position: 270020-270045, mismatch: 0, identity: 1.0 

cggggccccaacatagaagctggcgg	CRISPR spacer
cggggccccaacatagaagctggcgg	Protospacer
**************************

3. spacer 6.1|1571821|26|NZ_CP045472|CRISPRCasFinder matches to position: 406978-407003, mismatch: 0, identity: 1.0 

cggggccccaacatagaagctggcgg	CRISPR spacer
cggggccccaacatagaagctggcgg	Protospacer
**************************

4. spacer 6.1|1571821|26|NZ_CP045472|CRISPRCasFinder matches to position: 942987-943012, mismatch: 0, identity: 1.0 

cggggccccaacatagaagctggcgg	CRISPR spacer
cggggccccaacatagaagctggcgg	Protospacer
**************************

5. spacer 3.1|743027|32|NZ_CP045472|CRISPRCasFinder matches to position: 269945-269976, mismatch: 1, identity: 0.969 

ggcaatgcgagttggggtgtgggccccaacac	CRISPR spacer
ggcaatgcaagttggggtgtgggccccaacac	Protospacer
********.***********************

6. spacer 6.1|1571821|26|NZ_CP045472|CRISPRCasFinder matches to position: 733990-734015, mismatch: 1, identity: 0.962 

cggggccccaacatagaagctggcgg	CRISPR spacer
cggggccccaacacagaagctggcgg	Protospacer
*************.************

7. spacer 6.1|1571821|26|NZ_CP045472|CRISPRCasFinder matches to position: 2175406-2175431, mismatch: 1, identity: 0.962 

cggggccccaacatagaagctggcgg	CRISPR spacer
cggggccccaacacagaagctggcgg	Protospacer
*************.************

8. spacer 6.1|1571821|26|NZ_CP045472|CRISPRCasFinder matches to position: 2350602-2350627, mismatch: 1, identity: 0.962 

cggggccccaacatagaagctggcgg	CRISPR spacer
cggggccccaacatagaagctgtcgg	Protospacer
********************** ***

9. spacer 6.1|1571821|26|NZ_CP045472|CRISPRCasFinder matches to position: 779933-779958, mismatch: 1, identity: 0.962 

cggggccccaacatagaagctggcgg	CRISPR spacer
cggggccccaacacagaagctggcgg	Protospacer
*************.************

10. spacer 6.1|1571821|26|NZ_CP045472|CRISPRCasFinder matches to position: 779989-780014, mismatch: 1, identity: 0.962 

cggggccccaacatagaagctggcgg	CRISPR spacer
cggggccccaacacagaagctggcgg	Protospacer
*************.************

11. spacer 6.1|1571821|26|NZ_CP045472|CRISPRCasFinder matches to position: 2058670-2058695, mismatch: 1, identity: 0.962 

cggggccccaacatagaagctggcgg	CRISPR spacer
cggggccccaacacagaagctggcgg	Protospacer
*************.************

12. spacer 6.1|1571821|26|NZ_CP045472|CRISPRCasFinder matches to position: 2533557-2533582, mismatch: 1, identity: 0.962 

cggggccccaacatagaagctggcgg	CRISPR spacer
cggggccccaacatagtagctggcgg	Protospacer
**************** *********

13. spacer 10.1|2093002|25|NZ_CP045472|CRISPRCasFinder matches to position: 2092946-2092970, mismatch: 1, identity: 0.96 

cggggccccaacacagaagctgaca	CRISPR spacer
cggggccccaacatagaagctgaca	Protospacer
*************.***********

14. spacer 10.1|2093002|25|NZ_CP045472|CRISPRCasFinder matches to position: 2504712-2504736, mismatch: 1, identity: 0.96 

cggggccccaacacagaagctgaca	CRISPR spacer
cggggccccaacatagaagctgaca	Protospacer
*************.***********

15. spacer 10.1|2093002|25|NZ_CP045472|CRISPRCasFinder matches to position: 407093-407117, mismatch: 1, identity: 0.96 

cggggccccaacacagaagctgaca	CRISPR spacer
cggggccccaacacagaagctggca	Protospacer
**********************.**

16. spacer 12.1|2592987|32|NZ_CP045472|CRISPRCasFinder matches to position: 411236-411267, mismatch: 1, identity: 0.969 

ctatgttgggtcccaccccaacttgcattgtt	CRISPR spacer
ctatgttggggcccaccccaacttgcattgtt	Protospacer
********** *********************

17. spacer 3.1|743027|32|NZ_CP045472|CRISPRCasFinder matches to position: 1571747-1571778, mismatch: 2, identity: 0.938 

ggcaatgcgagttggggtgtgggccccaacac	CRISPR spacer
ggcaatgcgagttggggtgagggccctaacac	Protospacer
******************* ******.*****

18. spacer 4.1|789418|31|NZ_CP045472|CRISPRCasFinder matches to position: 748375-748405, mismatch: 2, identity: 0.935 

cctgtagaaattggcgttccaatttctctgt	CRISPR spacer
cctgtagaaattggtgttccaatttctttgt	Protospacer
**************.************.***

19. spacer 6.1|1571821|26|NZ_CP045472|CRISPRCasFinder matches to position: 2254407-2254432, mismatch: 2, identity: 0.923 

cggggccccaacatagaagctggcgg	CRISPR spacer
cggggccccaacacaaaagctggcgg	Protospacer
*************.*.**********

20. spacer 6.1|1571821|26|NZ_CP045472|CRISPRCasFinder matches to position: 2254745-2254770, mismatch: 2, identity: 0.923 

cggggccccaacatagaagctggcgg	CRISPR spacer
cggggccccaagacagaagctggcgg	Protospacer
*********** *.************

21. spacer 10.1|2093002|25|NZ_CP045472|CRISPRCasFinder matches to position: 407149-407173, mismatch: 2, identity: 0.92 

cggggccccaacacagaagctgaca	CRISPR spacer
cggggccccaacatagaagctggca	Protospacer
*************.********.**

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP045472_4 4.1|789418|31|NZ_CP045472|CRISPRCasFinder 789418-789448 31 KC139649 Salmonella phage FSL SP-069 hypothetical proteins, RdgC exonuclease, hypothetical proteins, TerL, hypothetical proteins, deoxyuridine 5'-triphosphate nucleotidohydrolase, hypothetical proteins, NinH, head morphogenesis protein, hypothetical proteins, capsid related protein, hypothetical proteins, enolase-like protein, hypothetical proteins, tail fiber, hypothetical protein, putative endolysin, hypothetical proteins, and DNA polymerase genes, complete cds 9668-9698 7 0.774
NZ_CP045472_4 4.1|789418|31|NZ_CP045472|CRISPRCasFinder 789418-789448 31 KC139636 Salmonella phage FSL SP-062 hypothetical proteins, RdgC exonuclease, hypothetical proteins, TerL, and hypothetical proteins genes, complete cds 9668-9698 7 0.774
NZ_CP045472_4 4.1|789418|31|NZ_CP045472|CRISPRCasFinder 789418-789448 31 NC_025443 Salmonella phage 9NA, complete genome 7834-7864 7 0.774
NZ_CP045472_11 11.1|2400296|32|NZ_CP045472|CRISPRCasFinder 2400296-2400327 32 NZ_CP024776 Bacillus thuringiensis LM1212 plasmid pLM8, complete sequence 3826-3857 9 0.719
NZ_CP045472_11 11.1|2400296|32|NZ_CP045472|CRISPRCasFinder 2400296-2400327 32 NZ_CP009062 Borreliella afzelii K78 plasmid lp28-1, complete sequence 16532-16563 10 0.688
NZ_CP045472_11 11.1|2400296|32|NZ_CP045472|CRISPRCasFinder 2400296-2400327 32 NZ_CP018749 Borreliella garinii strain CIP 103362 isolate 20047 plasmid lp28-7 15178-15209 10 0.688
NZ_CP045472_11 11.1|2400296|32|NZ_CP045472|CRISPRCasFinder 2400296-2400327 32 NZ_CP028869 Borreliella garinii strain 20047 plasmid lp28-7, complete sequence 11910-11941 10 0.688
NZ_CP045472_11 11.1|2400296|32|NZ_CP045472|CRISPRCasFinder 2400296-2400327 32 NZ_CP028878 Borreliella bavariensis PBi plasmid lp28-7, complete sequence 4741-4772 10 0.688
NZ_CP045472_11 11.1|2400296|32|NZ_CP045472|CRISPRCasFinder 2400296-2400327 32 NZ_CP028879 Borreliella bavariensis PBi plasmid lp28-9, complete sequence 11876-11907 10 0.688
NZ_CP045472_11 11.1|2400296|32|NZ_CP045472|CRISPRCasFinder 2400296-2400327 32 NC_018987 Borrelia burgdorferi 297 plasmid 297_lp28-6, complete sequence 12713-12744 10 0.688
NZ_CP045472_11 11.1|2400296|32|NZ_CP045472|CRISPRCasFinder 2400296-2400327 32 NC_017412 Borreliella burgdorferi JD1 plasmid JD1 lp28-7, complete sequence 17252-17283 10 0.688
NZ_CP045472_11 11.1|2400296|32|NZ_CP045472|CRISPRCasFinder 2400296-2400327 32 NC_017419 Borreliella burgdorferi N40 plasmid N40_lp28-2, complete sequence 17030-17061 10 0.688
NZ_CP045472_11 11.1|2400296|32|NZ_CP045472|CRISPRCasFinder 2400296-2400327 32 NC_017408 Borreliella burgdorferi JD1 plasmid JD1 lp28-6, complete sequence 14812-14843 10 0.688
NZ_CP045472_11 11.1|2400296|32|NZ_CP045472|CRISPRCasFinder 2400296-2400327 32 NC_015920 Borreliella bissettii DN127 plasmid lp56, complete sequence 16601-16632 10 0.688
NZ_CP045472_11 11.1|2400296|32|NZ_CP045472|CRISPRCasFinder 2400296-2400327 32 NC_011779 Borreliella burgdorferi ZS7 plasmid ZS7_lp28-2, complete sequence 16934-16965 10 0.688
NZ_CP045472_11 11.1|2400296|32|NZ_CP045472|CRISPRCasFinder 2400296-2400327 32 NC_001852 Borreliella burgdorferi B31 plasmid lp28-2, complete sequence 16891-16922 10 0.688
NZ_CP045472_11 11.1|2400296|32|NZ_CP045472|CRISPRCasFinder 2400296-2400327 32 NZ_CP017219 Borreliella burgdorferi strain B331 plasmid B331_lp56, complete sequence 14876-14907 10 0.688
NZ_CP045472_11 11.1|2400296|32|NZ_CP045472|CRISPRCasFinder 2400296-2400327 32 NZ_CP017215 Borreliella burgdorferi strain B331 plasmid B331_lp28_6, complete sequence 11994-12025 15 0.531

1. spacer 4.1|789418|31|NZ_CP045472|CRISPRCasFinder matches to KC139649 (Salmonella phage FSL SP-069 hypothetical proteins, RdgC exonuclease, hypothetical proteins, TerL, hypothetical proteins, deoxyuridine 5'-triphosphate nucleotidohydrolase, hypothetical proteins, NinH, head morphogenesis protein, hypothetical proteins, capsid related protein, hypothetical proteins, enolase-like protein, hypothetical proteins, tail fiber, hypothetical protein, putative endolysin, hypothetical proteins, and DNA polymerase genes, complete cds) position: , mismatch: 7, identity: 0.774 

cctgtagaaattggcgttccaatt-tctctgt	CRISPR spacer
gatgtagaaattggcgtaccaattaaagctg-	Protospacer
  *************** ******    ***

2. spacer 4.1|789418|31|NZ_CP045472|CRISPRCasFinder matches to KC139636 (Salmonella phage FSL SP-062 hypothetical proteins, RdgC exonuclease, hypothetical proteins, TerL, and hypothetical proteins genes, complete cds) position: , mismatch: 7, identity: 0.774 

cctgtagaaattggcgttccaatt-tctctgt	CRISPR spacer
gatgtagaaattggcgtaccaattaaagctg-	Protospacer
  *************** ******    ***

3. spacer 4.1|789418|31|NZ_CP045472|CRISPRCasFinder matches to NC_025443 (Salmonella phage 9NA, complete genome) position: , mismatch: 7, identity: 0.774 

cctgtagaaattggcgttccaatt-tctctgt	CRISPR spacer
gatgtagaaattggcgtaccaattaaagctg-	Protospacer
  *************** ******    ***

4. spacer 11.1|2400296|32|NZ_CP045472|CRISPRCasFinder matches to NZ_CP024776 (Bacillus thuringiensis LM1212 plasmid pLM8, complete sequence) position: , mismatch: 9, identity: 0.719 

tagagaatttcgaaaaaagaaattctacaggt	CRISPR spacer
tcaaggatttcgaaaaaagaaatcctaatttg	Protospacer
* .**.*****************.***

5. spacer 11.1|2400296|32|NZ_CP045472|CRISPRCasFinder matches to NZ_CP009062 (Borreliella afzelii K78 plasmid lp28-1, complete sequence) position: , mismatch: 10, identity: 0.688 

tagagaatttcgaaaaaagaaattctacaggt	CRISPR spacer
acaagaatttctaaaaaacaaattctatttcc	Protospacer
  .******** ****** ********.   .

6. spacer 11.1|2400296|32|NZ_CP045472|CRISPRCasFinder matches to NZ_CP018749 (Borreliella garinii strain CIP 103362 isolate 20047 plasmid lp28-7) position: , mismatch: 10, identity: 0.688 

tagagaatttcgaaaaaagaaattctacaggt	CRISPR spacer
acaagaatttctaaaaaacaaattctatttcc	Protospacer
  .******** ****** ********.   .

7. spacer 11.1|2400296|32|NZ_CP045472|CRISPRCasFinder matches to NZ_CP028869 (Borreliella garinii strain 20047 plasmid lp28-7, complete sequence) position: , mismatch: 10, identity: 0.688 

tagagaatttcgaaaaaagaaattctacaggt	CRISPR spacer
acaagaatttctaaaaaacaaattctatttcc	Protospacer
  .******** ****** ********.   .

8. spacer 11.1|2400296|32|NZ_CP045472|CRISPRCasFinder matches to NZ_CP028878 (Borreliella bavariensis PBi plasmid lp28-7, complete sequence) position: , mismatch: 10, identity: 0.688 

tagagaatttcgaaaaaagaaattctacaggt	CRISPR spacer
acaagaatttctaaaaaacaaattctatttcc	Protospacer
  .******** ****** ********.   .

9. spacer 11.1|2400296|32|NZ_CP045472|CRISPRCasFinder matches to NZ_CP028879 (Borreliella bavariensis PBi plasmid lp28-9, complete sequence) position: , mismatch: 10, identity: 0.688 

tagagaatttcgaaaaaagaaattctacaggt	CRISPR spacer
acaagaatttctaaaaaacaaattctatttcc	Protospacer
  .******** ****** ********.   .

10. spacer 11.1|2400296|32|NZ_CP045472|CRISPRCasFinder matches to NC_018987 (Borrelia burgdorferi 297 plasmid 297_lp28-6, complete sequence) position: , mismatch: 10, identity: 0.688 

tagagaatttcgaaaaaagaaattctacaggt	CRISPR spacer
acaagaatttctaaaaaacaaattctgttgcc	Protospacer
  .******** ****** *******.. * .

11. spacer 11.1|2400296|32|NZ_CP045472|CRISPRCasFinder matches to NC_017412 (Borreliella burgdorferi JD1 plasmid JD1 lp28-7, complete sequence) position: , mismatch: 10, identity: 0.688 

tagagaatttcgaaaaaagaaattctacaggt	CRISPR spacer
acaagaatttctaaaaaacaaattctgttgcc	Protospacer
  .******** ****** *******.. * .

12. spacer 11.1|2400296|32|NZ_CP045472|CRISPRCasFinder matches to NC_017419 (Borreliella burgdorferi N40 plasmid N40_lp28-2, complete sequence) position: , mismatch: 10, identity: 0.688 

tagagaatttcgaaaaaagaaattctacaggt	CRISPR spacer
acaagaatttctaaaaaacaaattctgttgcc	Protospacer
  .******** ****** *******.. * .

13. spacer 11.1|2400296|32|NZ_CP045472|CRISPRCasFinder matches to NC_017408 (Borreliella burgdorferi JD1 plasmid JD1 lp28-6, complete sequence) position: , mismatch: 10, identity: 0.688 

tagagaatttcgaaaaaagaaattctacaggt	CRISPR spacer
acaagaatttctaaaaaacaaattctgttgcc	Protospacer
  .******** ****** *******.. * .

14. spacer 11.1|2400296|32|NZ_CP045472|CRISPRCasFinder matches to NC_015920 (Borreliella bissettii DN127 plasmid lp56, complete sequence) position: , mismatch: 10, identity: 0.688 

tagagaatttcgaaaaaagaaattctacaggt	CRISPR spacer
acaagaatttctaaaaaacaaattctgttgcc	Protospacer
  .******** ****** *******.. * .

15. spacer 11.1|2400296|32|NZ_CP045472|CRISPRCasFinder matches to NC_011779 (Borreliella burgdorferi ZS7 plasmid ZS7_lp28-2, complete sequence) position: , mismatch: 10, identity: 0.688 

tagagaatttcgaaaaaagaaattctacaggt	CRISPR spacer
acaagaatttctaaaaaacaaattctgttgcc	Protospacer
  .******** ****** *******.. * .

16. spacer 11.1|2400296|32|NZ_CP045472|CRISPRCasFinder matches to NC_001852 (Borreliella burgdorferi B31 plasmid lp28-2, complete sequence) position: , mismatch: 10, identity: 0.688 

tagagaatttcgaaaaaagaaattctacaggt	CRISPR spacer
acaagaatttctaaaaaacaaattctgttgcc	Protospacer
  .******** ****** *******.. * .

17. spacer 11.1|2400296|32|NZ_CP045472|CRISPRCasFinder matches to NZ_CP017219 (Borreliella burgdorferi strain B331 plasmid B331_lp56, complete sequence) position: , mismatch: 10, identity: 0.688 

tagagaatttcgaaaaaagaaattctacaggt	CRISPR spacer
acaagaatttctaaaaaacaaattctgttgcc	Protospacer
  .******** ****** *******.. * .

18. spacer 11.1|2400296|32|NZ_CP045472|CRISPRCasFinder matches to NZ_CP017215 (Borreliella burgdorferi strain B331 plasmid B331_lp28_6, complete sequence) position: , mismatch: 15, identity: 0.531 

---tagagaatttcgaaaaaagaaattctacaggt	CRISPR spacer
ggcaacagaatttgttttttagaaattcttgt---	Protospacer
    * *******       *********

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 59154 59 Staphylococcus_phage(64.71%) capsid,tail,portal,head,protease,holin,tRNA NA
DBSCAN-SWA_2 62845 : 63523 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_3 72798 : 73677 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_4 112047 : 121441 13 Staphylococcus_phage(60.0%) NA NA
DBSCAN-SWA_5 125204 : 127216 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_6 133386 : 134178 1 Halovirus(100.0%) NA NA
DBSCAN-SWA_7 137719 : 143351 8 Lactobacillus_phage(33.33%) lysis,protease NA
DBSCAN-SWA_8 151196 : 152798 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_9 157224 : 160680 3 Indivirus(50.0%) NA NA
DBSCAN-SWA_10 164094 : 164796 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_11 172312 : 174667 3 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_12 178985 : 180248 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_13 189894 : 194288 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_14 200065 : 201712 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_15 205381 : 206503 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_16 210653 : 216309 7 Phage_Wrath(25.0%) NA NA
DBSCAN-SWA_17 226480 : 227014 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_18 232436 : 239940 14 Staphylococcus_phage(87.5%) capsid NA
DBSCAN-SWA_19 245010 : 245487 1 Fowlpox_virus(100.0%) NA NA
DBSCAN-SWA_20 251429 : 257910 4 Acanthocystis_turfacea_Chlorella_virus(33.33%) NA NA
DBSCAN-SWA_21 267325 : 268369 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_22 273047 : 278591 4 Bacillus_virus(33.33%) NA NA
DBSCAN-SWA_23 283732 : 295547 9 Klosneuvirus(33.33%) tRNA NA
DBSCAN-SWA_24 299820 : 300591 1 Flavobacterium_phage(100.0%) NA NA
DBSCAN-SWA_25 305365 : 318129 10 Erwinia_phage(20.0%) protease,tRNA NA
DBSCAN-SWA_26 331424 : 333545 3 Acanthamoeba_polyphaga_mimivirus(33.33%) NA NA
DBSCAN-SWA_27 343915 : 345910 1 Moumouvirus(100.0%) NA NA
DBSCAN-SWA_28 349057 : 349993 1 Prochlorococcus_phage(100.0%) tRNA NA
DBSCAN-SWA_29 354998 : 357255 3 Methanothermobacter_phage(50.0%) NA NA
DBSCAN-SWA_30 360770 : 361382 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_31 365349 : 369960 4 Halovirus(33.33%) NA NA
DBSCAN-SWA_32 375719 : 378473 1 Orpheovirus(100.0%) tRNA NA
DBSCAN-SWA_33 398055 : 398244 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_34 407441 : 409401 3 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_35 423466 : 428024 3 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_36 432901 : 433960 1 Orpheovirus(100.0%) tRNA NA
DBSCAN-SWA_37 445906 : 448817 5 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_38 460291 : 462139 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_39 470274 : 479108 9 Mycoplasma_phage(25.0%) NA NA
DBSCAN-SWA_40 488196 : 489369 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_41 492548 : 507309 14 Prochlorococcus_phage(22.22%) NA NA
DBSCAN-SWA_42 517630 : 546589 29 Staphylococcus_phage(42.86%) bacteriocin,protease,transposase NA
DBSCAN-SWA_43 552556 : 557764 3 Pithovirus(33.33%) protease NA
DBSCAN-SWA_44 578980 : 580789 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_45 584738 : 590489 5 Bacillus_virus(66.67%) transposase NA
DBSCAN-SWA_46 594141 : 596155 2 Organic_Lake_phycodnavirus(50.0%) NA NA
DBSCAN-SWA_47 604748 : 611558 4 Micromonas_sp._RCC1109_virus(33.33%) NA NA
DBSCAN-SWA_48 616782 : 620436 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_49 631189 : 638297 6 Paramecium_bursaria_Chlorella_virus(33.33%) NA NA
DBSCAN-SWA_50 648231 : 651849 3 Mycoplasma_phage(50.0%) NA NA
DBSCAN-SWA_51 655893 : 658562 2 Pseudomonas_phage(50.0%) NA NA
DBSCAN-SWA_52 671859 : 696120 35 Staphylococcus_phage(75.0%) terminase,integrase,coat attL 677132:677153|attR 697793:697814
DBSCAN-SWA_53 699462 : 704640 8 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_54 708047 : 709291 2 Lactococcus_phage(50.0%) NA NA
DBSCAN-SWA_55 718663 : 727423 8 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_56 738635 : 744336 5 Streptococcus_phage(40.0%) NA NA
DBSCAN-SWA_57 748729 : 751576 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_58 754894 : 755734 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_59 761818 : 767531 5 Streptococcus_phage(66.67%) NA NA
DBSCAN-SWA_60 776813 : 800156 19 uncultured_Caudovirales_phage(35.71%) NA NA
DBSCAN-SWA_61 803303 : 813150 12 Pandoravirus(12.5%) NA NA
DBSCAN-SWA_62 824692 : 826066 1 Powai_lake_megavirus(100.0%) NA NA
DBSCAN-SWA_63 831043 : 837322 6 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_64 844518 : 844992 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_65 850255 : 851053 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_66 855882 : 856644 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_67 861018 : 862062 1 Acanthamoeba_polyphaga_moumouvirus(100.0%) NA NA
DBSCAN-SWA_68 868585 : 869383 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_69 872610 : 876569 3 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_70 883503 : 884247 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_71 895198 : 895759 1 Streptococcus_phage(100.0%) integrase attL 889352:889366|attR 899350:899364
DBSCAN-SWA_72 903713 : 904199 1 Lactococcus_phage(100.0%) transposase NA
DBSCAN-SWA_73 909384 : 912738 3 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_74 921449 : 922772 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_75 929959 : 930445 1 Lactococcus_phage(100.0%) transposase NA
DBSCAN-SWA_76 934815 : 935472 1 Elephant_endotheliotropic_herpesvirus(100.0%) NA NA
DBSCAN-SWA_77 939140 : 942461 2 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_78 948720 : 953751 3 Staphylococcus_virus(50.0%) transposase NA
DBSCAN-SWA_79 968063 : 968726 1 Enterococcus_phage(100.0%) NA NA
DBSCAN-SWA_80 975301 : 976489 1 Emiliania_huxleyi_virus(100.0%) NA NA
DBSCAN-SWA_81 979517 : 990471 6 Streptococcus_phage(33.33%) NA NA
DBSCAN-SWA_82 994154 : 998937 8 Bacillus_virus(50.0%) tRNA NA
DBSCAN-SWA_83 1004949 : 1007406 1 Escherichia_phage(100.0%) protease NA
DBSCAN-SWA_84 1026871 : 1037157 10 Catovirus(16.67%) tRNA NA
DBSCAN-SWA_85 1046413 : 1049739 3 Hokovirus(33.33%) transposase NA
DBSCAN-SWA_86 1055501 : 1058599 2 Hokovirus(50.0%) tRNA NA
DBSCAN-SWA_87 1062505 : 1063123 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_88 1071976 : 1073674 1 Streptococcus_virus(100.0%) NA NA
DBSCAN-SWA_89 1090324 : 1096564 6 Lactobacillus_phage(33.33%) NA NA
DBSCAN-SWA_90 1114195 : 1116242 2 Escherichia_phage(50.0%) transposase NA
DBSCAN-SWA_91 1122428 : 1125087 2 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_92 1134480 : 1134966 1 Lactococcus_phage(100.0%) transposase NA
DBSCAN-SWA_93 1146216 : 1149249 2 Hokovirus(50.0%) NA NA
DBSCAN-SWA_94 1158207 : 1159731 1 Enterococcus_phage(100.0%) NA NA
DBSCAN-SWA_95 1169394 : 1177930 10 Staphylococcus_phage(33.33%) transposase NA
DBSCAN-SWA_96 1187851 : 1188694 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_97 1208661 : 1211396 3 Bodo_saltans_virus(50.0%) NA NA
DBSCAN-SWA_98 1229623 : 1230301 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_99 1246018 : 1250467 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_100 1261072 : 1262735 2 Amsacta_moorei_entomopoxvirus(50.0%) NA NA
DBSCAN-SWA_101 1271511 : 1272948 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_102 1276708 : 1281248 3 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_103 1290574 : 1291618 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_104 1298832 : 1300362 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_105 1309238 : 1310744 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_106 1321948 : 1327307 3 Tetraselmis_virus(50.0%) NA NA
DBSCAN-SWA_107 1337621 : 1339681 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_108 1348216 : 1349809 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_109 1366469 : 1367654 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_110 1372511 : 1379687 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_111 1384800 : 1387797 4 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_112 1391136 : 1393621 2 Catovirus(50.0%) NA NA
DBSCAN-SWA_113 1400638 : 1407203 6 Catovirus(50.0%) NA NA
DBSCAN-SWA_114 1411227 : 1412403 1 Clostridium_phage(100.0%) NA NA
DBSCAN-SWA_115 1417861 : 1418635 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_116 1425780 : 1428334 2 Staphylococcus_virus(50.0%) transposase NA
DBSCAN-SWA_117 1433271 : 1434252 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_118 1437810 : 1439013 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_119 1447279 : 1451489 4 Lactococcus_phage(50.0%) NA NA
DBSCAN-SWA_120 1454764 : 1455250 1 Lactococcus_phage(100.0%) transposase NA
DBSCAN-SWA_121 1476874 : 1478921 2 Lactococcus_phage(50.0%) transposase NA
DBSCAN-SWA_122 1496790 : 1506038 8 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_123 1511115 : 1512257 1 Staphylococcus_phage(100.0%) transposase NA
DBSCAN-SWA_124 1520090 : 1523963 5 Staphylococcus_phage(50.0%) transposase NA
DBSCAN-SWA_125 1529101 : 1529965 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_126 1534094 : 1544098 7 Bacillus_phage(40.0%) NA NA
DBSCAN-SWA_127 1550784 : 1562118 8 Bacillus_virus(40.0%) transposase,tRNA NA
DBSCAN-SWA_128 1570650 : 1574063 5 Faecalibacterium_phage(33.33%) NA NA
DBSCAN-SWA_129 1578360 : 1579119 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_130 1593547 : 1595260 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_131 1600896 : 1601910 1 Faustovirus(100.0%) NA NA
DBSCAN-SWA_132 1614842 : 1615535 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_133 1644988 : 1646848 1 Enterococcus_phage(100.0%) NA NA
DBSCAN-SWA_134 1672707 : 1674458 2 Ectocarpus_siliculosus_virus(50.0%) NA NA
DBSCAN-SWA_135 1677888 : 1678386 1 Canarypox_virus(100.0%) NA NA
DBSCAN-SWA_136 1683422 : 1685806 2 Enterococcus_phage(100.0%) NA NA
DBSCAN-SWA_137 1690683 : 1731556 40 Streptococcus_phage(52.38%) protease,holin,transposase NA
DBSCAN-SWA_138 1752842 : 1756623 3 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_139 1765056 : 1769226 3 Paramecium_bursaria_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_140 1778466 : 1781459 2 Enterobacteria_phage(50.0%) protease NA
DBSCAN-SWA_141 1788809 : 1795173 5 Yellowstone_lake_phycodnavirus(33.33%) NA NA
DBSCAN-SWA_142 1804467 : 1808072 4 Acanthocystis_turfacea_Chlorella_virus(50.0%) transposase NA
DBSCAN-SWA_143 1815277 : 1816924 1 Staphylococcus_phage(100.0%) transposase NA
DBSCAN-SWA_144 1822506 : 1823202 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_145 1842542 : 1843409 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_146 1853125 : 1858305 3 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_147 1861797 : 1863444 1 Staphylococcus_virus(100.0%) transposase NA
DBSCAN-SWA_148 1868970 : 1869666 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_149 1874865 : 1875684 1 Acanthamoeba_polyphaga_moumouvirus(100.0%) NA NA
DBSCAN-SWA_150 1883553 : 1885111 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_151 1891480 : 1895907 4 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_152 1899300 : 1900527 1 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_153 1918905 : 1927104 7 Bacillus_phage(50.0%) transposase NA
DBSCAN-SWA_154 1930489 : 1936261 6 Staphylococcus_phage(75.0%) NA NA
DBSCAN-SWA_155 1944105 : 1944837 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_156 1961648 : 1963208 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_157 1984549 : 1985584 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_158 1995524 : 2002082 8 Staphylococcus_phage(25.0%) NA NA
DBSCAN-SWA_159 2005820 : 2012439 5 Salmonella_phage(33.33%) transposase NA
DBSCAN-SWA_160 2021071 : 2021971 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_161 2035326 : 2036208 1 Diadromus_pulchellus_ascovirus(100.0%) NA NA
DBSCAN-SWA_162 2044086 : 2044722 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_163 2057732 : 2062124 4 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_164 2066041 : 2066851 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_165 2085831 : 2086437 1 Pithovirus(100.0%) NA NA
DBSCAN-SWA_166 2098467 : 2101635 1 Leptospira_phage(100.0%) NA NA
DBSCAN-SWA_167 2125228 : 2126895 2 Anomala_cuprea_entomopoxvirus(50.0%) NA NA
DBSCAN-SWA_168 2129936 : 2134828 3 Mycobacterium_phage(50.0%) NA NA
DBSCAN-SWA_169 2141674 : 2143984 3 Indivirus(50.0%) NA NA
DBSCAN-SWA_170 2150305 : 2151718 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_171 2155681 : 2157244 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_172 2167448 : 2168417 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_173 2184543 : 2185452 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_174 2189042 : 2196476 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_175 2202744 : 2205564 2 Only_Syngen_Nebraska_virus(50.0%) NA NA
DBSCAN-SWA_176 2218166 : 2221998 4 Clostridium_phage(50.0%) NA NA
DBSCAN-SWA_177 2229923 : 2231534 1 Only_Syngen_Nebraska_virus(100.0%) NA NA
DBSCAN-SWA_178 2239337 : 2247087 9 Bacillus_virus(25.0%) NA NA
DBSCAN-SWA_179 2257878 : 2260463 3 Escherichia_phage(33.33%) transposase NA
DBSCAN-SWA_180 2266637 : 2267285 1 Moumouvirus(100.0%) NA NA
DBSCAN-SWA_181 2274485 : 2276006 1 Diachasmimorpha_longicaudata_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_182 2281676 : 2283704 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_183 2288854 : 2292239 5 Clostridium_botulinum_C_phage(50.0%) NA NA
DBSCAN-SWA_184 2306353 : 2311077 4 Micromonas_sp._RCC1109_virus(50.0%) NA NA
DBSCAN-SWA_185 2314837 : 2329467 13 Moraxella_phage(16.67%) tRNA NA
DBSCAN-SWA_186 2336588 : 2338565 2 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_187 2342455 : 2346034 3 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_188 2351357 : 2353804 3 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_189 2359051 : 2359453 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_190 2363650 : 2365680 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_191 2369709 : 2371993 2 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_192 2375696 : 2382463 5 Gordonia_phage(33.33%) NA NA
DBSCAN-SWA_193 2389692 : 2394720 5 Catovirus(33.33%) NA NA
DBSCAN-SWA_194 2398173 : 2398587 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_195 2403641 : 2404271 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_196 2419751 : 2421488 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_197 2438037 : 2438766 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_198 2449490 : 2449835 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_199 2459469 : 2460210 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_200 2469070 : 2477385 10 Staphylococcus_phage(70.0%) transposase NA
DBSCAN-SWA_201 2482939 : 2530251 44 Staphylococcus_phage(94.44%) protease,tRNA NA
DBSCAN-SWA_202 2541773 : 2547101 3 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_203 2555684 : 2557391 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_204 2564006 : 2566637 2 Cronobacter_phage(50.0%) protease,tRNA NA
DBSCAN-SWA_205 2572402 : 2576537 4 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_206 2594306 : 2597504 1 Streptomyces_phage(100.0%) NA NA
DBSCAN-SWA_207 2602437 : 2604195 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_208 2609077 : 2617240 5 Feldmannia_irregularis_virus(25.0%) NA NA
DBSCAN-SWA_209 2621154 : 2632308 12 Brevibacillus_phage(20.0%) protease,tRNA NA
DBSCAN-SWA_210 2641878 : 2644509 1 Catovirus(100.0%) tRNA NA
DBSCAN-SWA_211 2654843 : 2690391 31 uncultured_Mediterranean_phage(18.75%) tRNA NA
DBSCAN-SWA_212 2697061 : 2700535 3 Lactococcus_phage(66.67%) transposase NA
DBSCAN-SWA_213 2707869 : 2714033 5 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_214 2717711 : 2720819 2 Micromonas_pusilla_virus(50.0%) NA NA
DBSCAN-SWA_215 2727289 : 2728237 1 Rhizobium_phage(100.0%) NA NA
DBSCAN-SWA_216 2731291 : 2745019 13 Klosneuvirus(25.0%) tRNA NA
DBSCAN-SWA_217 2751192 : 2751816 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_218 2757360 : 2760172 2 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_219 2767670 : 2774241 6 Indivirus(66.67%) NA NA
DBSCAN-SWA_220 2781070 : 2782477 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_221 2787123 : 2788608 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_222 2794272 : 2822045 58 Staphylococcus_phage(92.45%) integrase attL 2791109:2791123|attR 2809127:2809141

Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_CP045472.1|WP_001059079.1|1573862_1574063_-|cold-shock-protein 1573862_1574063_- 66 aa aa NA HTH_XRE,HTH_ParB NA 1570650-1574063 yes