Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP046175 Haloactinobacterium sp. HY164 strain HY044 chromosome, complete genome 8 crisprs WYL,csa3,DEDDh,DinG,RT,cas3,PD-DExK 0 3 1 0

Results visualization

1. NZ_CP046175
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP046175_1 595116-595204 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP046175_2 1093905-1094065 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP046175_3 1465550-1465611 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP046175_4 2742464-2742580 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP046175_5 3411645-3411741 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP046175_6 4007488-4007576 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP046175_7 4514874-4514975 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP046175_8 5250669-5250830 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP046175_4 4.1|2742509|27|NZ_CP046175|CRISPRCasFinder 2742509-2742535 27 NZ_CP025613 Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence 299713-299739 4 0.852
NZ_CP046175_4 4.1|2742509|27|NZ_CP046175|CRISPRCasFinder 2742509-2742535 27 NZ_HG938354 Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence 309784-309810 4 0.852
NZ_CP046175_4 4.1|2742509|27|NZ_CP046175|CRISPRCasFinder 2742509-2742535 27 NC_008383 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL8, complete sequence 139172-139198 5 0.815
NZ_CP046175_4 4.1|2742509|27|NZ_CP046175|CRISPRCasFinder 2742509-2742535 27 NZ_CP018064 Rhodococcus sp. 2G plasmid p1, complete sequence 53323-53349 5 0.815
NZ_CP046175_4 4.1|2742509|27|NZ_CP046175|CRISPRCasFinder 2742509-2742535 27 NZ_CP035002 Rhizobium acidisoli strain FH23 plasmid pRapFH23d, complete sequence 78885-78911 6 0.778
NZ_CP046175_4 4.1|2742509|27|NZ_CP046175|CRISPRCasFinder 2742509-2742535 27 NZ_CP040822 Paraoceanicella profunda strain D4M1 plasmid pD4M1D, complete sequence 106477-106503 6 0.778
NZ_CP046175_8 8.1|5250687|33|NZ_CP046175|CRT 5250687-5250719 33 NC_023283 Streptomyces sp. FR1 plasmid pFRL3, complete sequence 430432-430464 7 0.788
NZ_CP046175_8 8.1|5250687|33|NZ_CP046175|CRT 5250687-5250719 33 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 1087276-1087308 7 0.788
NZ_CP046175_8 8.1|5250687|33|NZ_CP046175|CRT 5250687-5250719 33 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 1115352-1115384 7 0.788
NZ_CP046175_8 8.1|5250687|33|NZ_CP046175|CRT 5250687-5250719 33 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 524170-524202 7 0.788
NZ_CP046175_8 8.1|5250687|33|NZ_CP046175|CRT 5250687-5250719 33 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 272656-272688 7 0.788
NZ_CP046175_8 8.1|5250687|33|NZ_CP046175|CRT 5250687-5250719 33 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 392019-392051 7 0.788
NZ_CP046175_8 8.1|5250687|33|NZ_CP046175|CRT 5250687-5250719 33 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 1118968-1119000 7 0.788
NZ_CP046175_8 8.1|5250687|33|NZ_CP046175|CRT 5250687-5250719 33 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 1606500-1606532 7 0.788
NZ_CP046175_8 8.1|5250687|33|NZ_CP046175|CRT 5250687-5250719 33 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 845585-845617 7 0.788
NZ_CP046175_8 8.1|5250687|33|NZ_CP046175|CRT 5250687-5250719 33 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 753909-753941 7 0.788
NZ_CP046175_8 8.1|5250687|33|NZ_CP046175|CRT 5250687-5250719 33 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 1489133-1489165 7 0.788
NZ_CP046175_8 8.1|5250687|33|NZ_CP046175|CRT 5250687-5250719 33 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 753909-753941 7 0.788
NZ_CP046175_8 8.1|5250687|33|NZ_CP046175|CRT 5250687-5250719 33 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 586397-586429 7 0.788
NZ_CP046175_8 8.1|5250687|33|NZ_CP046175|CRT 5250687-5250719 33 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 753910-753942 7 0.788
NZ_CP046175_8 8.1|5250687|33|NZ_CP046175|CRT 5250687-5250719 33 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 586397-586429 7 0.788
NZ_CP046175_8 8.1|5250687|33|NZ_CP046175|CRT 5250687-5250719 33 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 753912-753944 7 0.788
NZ_CP046175_8 8.1|5250687|33|NZ_CP046175|CRT 5250687-5250719 33 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 586397-586429 7 0.788
NZ_CP046175_8 8.1|5250687|33|NZ_CP046175|CRT 5250687-5250719 33 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 586401-586433 7 0.788
NZ_CP046175_8 8.1|5250687|33|NZ_CP046175|CRT 5250687-5250719 33 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 753912-753944 7 0.788
NZ_CP046175_8 8.1|5250687|33|NZ_CP046175|CRT 5250687-5250719 33 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 414830-414862 7 0.788
NZ_CP046175_8 8.1|5250687|33|NZ_CP046175|CRT 5250687-5250719 33 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 753912-753944 7 0.788
NZ_CP046175_8 8.1|5250687|33|NZ_CP046175|CRT 5250687-5250719 33 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 753912-753944 7 0.788
NZ_CP046175_8 8.1|5250687|33|NZ_CP046175|CRT 5250687-5250719 33 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 586397-586429 7 0.788
NZ_CP046175_8 8.1|5250687|33|NZ_CP046175|CRT 5250687-5250719 33 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 753906-753938 7 0.788
NZ_CP046175_8 8.1|5250687|33|NZ_CP046175|CRT 5250687-5250719 33 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 753912-753944 7 0.788
NZ_CP046175_8 8.1|5250687|33|NZ_CP046175|CRT 5250687-5250719 33 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 408883-408915 7 0.788
NZ_CP046175_8 8.1|5250687|33|NZ_CP046175|CRT 5250687-5250719 33 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 753912-753944 7 0.788
NZ_CP046175_8 8.1|5250687|33|NZ_CP046175|CRT 5250687-5250719 33 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 753912-753944 7 0.788
NZ_CP046175_8 8.1|5250687|33|NZ_CP046175|CRT 5250687-5250719 33 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 408883-408915 7 0.788
NZ_CP046175_8 8.1|5250687|33|NZ_CP046175|CRT 5250687-5250719 33 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1548088-1548120 7 0.788
NZ_CP046175_8 8.1|5250687|33|NZ_CP046175|CRT 5250687-5250719 33 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 127477-127509 7 0.788
NZ_CP046175_8 8.1|5250687|33|NZ_CP046175|CRT 5250687-5250719 33 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 1619001-1619033 7 0.788
NZ_CP046175_8 8.1|5250687|33|NZ_CP046175|CRT 5250687-5250719 33 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 1624815-1624847 7 0.788
NZ_CP046175_8 8.1|5250687|33|NZ_CP046175|CRT 5250687-5250719 33 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1796997-1797029 7 0.788
NZ_CP046175_8 8.1|5250687|33|NZ_CP046175|CRT 5250687-5250719 33 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 1922837-1922869 7 0.788
NZ_CP046175_8 8.1|5250687|33|NZ_CP046175|CRT 5250687-5250719 33 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 1543636-1543668 7 0.788
NZ_CP046175_8 8.1|5250687|33|NZ_CP046175|CRT 5250687-5250719 33 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 2064341-2064373 7 0.788
NZ_CP046175_8 8.1|5250687|33|NZ_CP046175|CRT 5250687-5250719 33 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 1626461-1626493 7 0.788
NZ_CP046175_8 8.1|5250687|33|NZ_CP046175|CRT 5250687-5250719 33 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 1336100-1336132 7 0.788
NZ_CP046175_8 8.1|5250687|33|NZ_CP046175|CRT 5250687-5250719 33 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1556368-1556400 7 0.788
NZ_CP046175_8 8.1|5250687|33|NZ_CP046175|CRT 5250687-5250719 33 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 1586631-1586663 7 0.788
NZ_CP046175_8 8.1|5250687|33|NZ_CP046175|CRT 5250687-5250719 33 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1551185-1551217 7 0.788
NZ_CP046175_8 8.1|5250687|33|NZ_CP046175|CRT 5250687-5250719 33 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1510818-1510850 7 0.788
NZ_CP046175_8 8.1|5250687|33|NZ_CP046175|CRT 5250687-5250719 33 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 1550671-1550703 7 0.788
NZ_CP046175_8 8.1|5250687|33|NZ_CP046175|CRT 5250687-5250719 33 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 1637941-1637973 7 0.788
NZ_CP046175_8 8.1|5250687|33|NZ_CP046175|CRT 5250687-5250719 33 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 1636342-1636374 7 0.788
NZ_CP046175_8 8.1|5250687|33|NZ_CP046175|CRT 5250687-5250719 33 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 1624845-1624877 7 0.788
NZ_CP046175_8 8.1|5250687|33|NZ_CP046175|CRT 5250687-5250719 33 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 1538550-1538582 7 0.788
NZ_CP046175_8 8.1|5250687|33|NZ_CP046175|CRT 5250687-5250719 33 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 1636342-1636374 7 0.788
NZ_CP046175_8 8.1|5250687|33|NZ_CP046175|CRT 5250687-5250719 33 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 1539196-1539228 7 0.788
NZ_CP046175_8 8.1|5250687|33|NZ_CP046175|CRT 5250687-5250719 33 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 1636342-1636374 7 0.788
NZ_CP046175_8 8.1|5250687|33|NZ_CP046175|CRT 5250687-5250719 33 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 1636342-1636374 7 0.788
NZ_CP046175_8 8.1|5250687|33|NZ_CP046175|CRT 5250687-5250719 33 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 1636342-1636374 7 0.788
NZ_CP046175_8 8.1|5250687|33|NZ_CP046175|CRT 5250687-5250719 33 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 1538572-1538604 7 0.788
NZ_CP046175_8 8.1|5250687|33|NZ_CP046175|CRT 5250687-5250719 33 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 1544042-1544074 7 0.788
NZ_CP046175_8 8.1|5250687|33|NZ_CP046175|CRT 5250687-5250719 33 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 1524690-1524722 7 0.788
NZ_CP046175_8 8.1|5250687|33|NZ_CP046175|CRT 5250687-5250719 33 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 1577639-1577671 7 0.788
NZ_CP046175_8 8.1|5250687|33|NZ_CP046175|CRT 5250687-5250719 33 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 1616838-1616870 7 0.788
NZ_CP046175_8 8.1|5250687|33|NZ_CP046175|CRT 5250687-5250719 33 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 1633657-1633689 7 0.788
NZ_CP046175_8 8.1|5250687|33|NZ_CP046175|CRT 5250687-5250719 33 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 1538572-1538604 7 0.788
NZ_CP046175_8 8.1|5250687|33|NZ_CP046175|CRT 5250687-5250719 33 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 1645248-1645280 7 0.788
NZ_CP046175_8 8.1|5250687|33|NZ_CP046175|CRT 5250687-5250719 33 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 1538572-1538604 7 0.788
NZ_CP046175_8 8.1|5250687|33|NZ_CP046175|CRT 5250687-5250719 33 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 1538572-1538604 7 0.788
NZ_CP046175_8 8.1|5250687|33|NZ_CP046175|CRT 5250687-5250719 33 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 1636345-1636377 7 0.788
NZ_CP046175_8 8.3|5250780|33|NZ_CP046175|CRT 5250780-5250812 33 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 1188251-1188283 8 0.758
NZ_CP046175_8 8.3|5250780|33|NZ_CP046175|CRT 5250780-5250812 33 CP042595 Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence 180917-180949 8 0.758

1. spacer 4.1|2742509|27|NZ_CP046175|CRISPRCasFinder matches to NZ_CP025613 (Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852

-gcagcgatggcaccgacggcagcacca	CRISPR spacer
cgcttcgg-ggcaccgacggcagcacca	Protospacer
 **  **. *******************

2. spacer 4.1|2742509|27|NZ_CP046175|CRISPRCasFinder matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 4, identity: 0.852

gcagcgatggcaccgacggcagcacca	CRISPR spacer
gcagcgatggcacagacggccgcgcga	Protospacer
************* ****** **.* *

3. spacer 4.1|2742509|27|NZ_CP046175|CRISPRCasFinder matches to NC_008383 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL8, complete sequence) position: , mismatch: 5, identity: 0.815

gcagcgatggcaccgacggcagcacca	CRISPR spacer
ccagcgatggcaccggcggcaggcccg	Protospacer
 **************.******  **.

4. spacer 4.1|2742509|27|NZ_CP046175|CRISPRCasFinder matches to NZ_CP018064 (Rhodococcus sp. 2G plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.815

gcagcgatggcaccgacggcagcacca	CRISPR spacer
ggggcgatgtcaccgactgcagcaccg	Protospacer
* .****** ******* ********.

5. spacer 4.1|2742509|27|NZ_CP046175|CRISPRCasFinder matches to NZ_CP035002 (Rhizobium acidisoli strain FH23 plasmid pRapFH23d, complete sequence) position: , mismatch: 6, identity: 0.778

gcagcgatggcaccgacggcagcacca	CRISPR spacer
ttggcgatggcaccgacggcagcaagg	Protospacer
 ..*********************  .

6. spacer 4.1|2742509|27|NZ_CP046175|CRISPRCasFinder matches to NZ_CP040822 (Paraoceanicella profunda strain D4M1 plasmid pD4M1D, complete sequence) position: , mismatch: 6, identity: 0.778

gcagcgatggcaccgacggcagcacca	CRISPR spacer
tggtcgatggcaccaacggcagcatca	Protospacer
  . **********.*********.**

7. spacer 8.1|5250687|33|NZ_CP046175|CRT matches to NC_023283 (Streptomyces sp. FR1 plasmid pFRL3, complete sequence) position: , mismatch: 7, identity: 0.788

---ggactgctcgtgggcggctgcggccggtgcctg	CRISPR spacer
ttcgg---gctcgtgagcggctgcggccggcgccgc	Protospacer
   **   *******.**************.***  

8. spacer 8.1|5250687|33|NZ_CP046175|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.788

ggactgc--tcgtgggcggctgcggccggtgcctg	CRISPR spacer
--gccgccaccgtgggcggcagcggccagtgcctg	Protospacer
  .*.**  .********** ******.*******

9. spacer 8.1|5250687|33|NZ_CP046175|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 7, identity: 0.788

ggactgc--tcgtgggcggctgcggccggtgcctg	CRISPR spacer
--gccgccaccgtgggcggcagcggccagtgcctg	Protospacer
  .*.**  .********** ******.*******

10. spacer 8.1|5250687|33|NZ_CP046175|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

ggactgc--tcgtgggcggctgcggccggtgcctg	CRISPR spacer
--gccgccaccgtgggcggcagcggccagtgcctg	Protospacer
  .*.**  .********** ******.*******

11. spacer 8.1|5250687|33|NZ_CP046175|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

ggactgc--tcgtgggcggctgcggccggtgcctg	CRISPR spacer
--gccgccaccgtgggcggcagcggccagtgcctg	Protospacer
  .*.**  .********** ******.*******

12. spacer 8.1|5250687|33|NZ_CP046175|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ggactgc--tcgtgggcggctgcggccggtgcctg	CRISPR spacer
--gccgccaccgtgggcggcagcggccagtgcctg	Protospacer
  .*.**  .********** ******.*******

13. spacer 8.1|5250687|33|NZ_CP046175|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

ggactgc--tcgtgggcggctgcggccggtgcctg	CRISPR spacer
--gccgccaccgtgggcggcagcggccagtgcctg	Protospacer
  .*.**  .********** ******.*******

14. spacer 8.1|5250687|33|NZ_CP046175|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 7, identity: 0.788

ggactgc--tcgtgggcggctgcggccggtgcctg	CRISPR spacer
--gccgccaccgtgggcggcagcggccagtgcctg	Protospacer
  .*.**  .********** ******.*******

15. spacer 8.1|5250687|33|NZ_CP046175|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 7, identity: 0.788

ggactgc--tcgtgggcggctgcggccggtgcctg	CRISPR spacer
--gccgccaccgtgggcggcagcggccagtgcctg	Protospacer
  .*.**  .********** ******.*******

16. spacer 8.1|5250687|33|NZ_CP046175|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ggactgc--tcgtgggcggctgcggccggtgcctg	CRISPR spacer
--gccgccaccgtgggcggcagcggccagtgcctg	Protospacer
  .*.**  .********** ******.*******

17. spacer 8.1|5250687|33|NZ_CP046175|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 7, identity: 0.788

ggactgc--tcgtgggcggctgcggccggtgcctg	CRISPR spacer
--gccgccaccgtgggcggcagcggccagtgcctg	Protospacer
  .*.**  .********** ******.*******

18. spacer 8.1|5250687|33|NZ_CP046175|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ggactgc--tcgtgggcggctgcggccggtgcctg	CRISPR spacer
--gccgccaccgtgggcggcagcggccagtgcctg	Protospacer
  .*.**  .********** ******.*******

19. spacer 8.1|5250687|33|NZ_CP046175|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ggactgc--tcgtgggcggctgcggccggtgcctg	CRISPR spacer
--gccgccaccgtgggcggcagcggccagtgcctg	Protospacer
  .*.**  .********** ******.*******

20. spacer 8.1|5250687|33|NZ_CP046175|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ggactgc--tcgtgggcggctgcggccggtgcctg	CRISPR spacer
--gccgccaccgtgggcggcagcggccagtgcctg	Protospacer
  .*.**  .********** ******.*******

21. spacer 8.1|5250687|33|NZ_CP046175|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ggactgc--tcgtgggcggctgcggccggtgcctg	CRISPR spacer
--gccgccaccgtgggcggcagcggccagtgcctg	Protospacer
  .*.**  .********** ******.*******

22. spacer 8.1|5250687|33|NZ_CP046175|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ggactgc--tcgtgggcggctgcggccggtgcctg	CRISPR spacer
--gccgccaccgtgggcggcagcggccagtgcctg	Protospacer
  .*.**  .********** ******.*******

23. spacer 8.1|5250687|33|NZ_CP046175|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ggactgc--tcgtgggcggctgcggccggtgcctg	CRISPR spacer
--gccgccaccgtgggcggcagcggccagtgcctg	Protospacer
  .*.**  .********** ******.*******

24. spacer 8.1|5250687|33|NZ_CP046175|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ggactgc--tcgtgggcggctgcggccggtgcctg	CRISPR spacer
--gccgccaccgtgggcggcagcggccagtgcctg	Protospacer
  .*.**  .********** ******.*******

25. spacer 8.1|5250687|33|NZ_CP046175|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ggactgc--tcgtgggcggctgcggccggtgcctg	CRISPR spacer
--gccgccaccgtgggcggcagcggccagtgcctg	Protospacer
  .*.**  .********** ******.*******

26. spacer 8.1|5250687|33|NZ_CP046175|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

ggactgc--tcgtgggcggctgcggccggtgcctg	CRISPR spacer
--gccgccaccgtgggcggcagcggccagtgcctg	Protospacer
  .*.**  .********** ******.*******

27. spacer 8.1|5250687|33|NZ_CP046175|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ggactgc--tcgtgggcggctgcggccggtgcctg	CRISPR spacer
--gccgccaccgtgggcggcagcggccagtgcctg	Protospacer
  .*.**  .********** ******.*******

28. spacer 8.1|5250687|33|NZ_CP046175|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ggactgc--tcgtgggcggctgcggccggtgcctg	CRISPR spacer
--gccgccaccgtgggcggcagcggccagtgcctg	Protospacer
  .*.**  .********** ******.*******

29. spacer 8.1|5250687|33|NZ_CP046175|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ggactgc--tcgtgggcggctgcggccggtgcctg	CRISPR spacer
--gccgccaccgtgggcggcagcggccagtgcctg	Protospacer
  .*.**  .********** ******.*******

30. spacer 8.1|5250687|33|NZ_CP046175|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ggactgc--tcgtgggcggctgcggccggtgcctg	CRISPR spacer
--gccgccaccgtgggcggcagcggccagtgcctg	Protospacer
  .*.**  .********** ******.*******

31. spacer 8.1|5250687|33|NZ_CP046175|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ggactgc--tcgtgggcggctgcggccggtgcctg	CRISPR spacer
--gccgccaccgtgggcggcagcggccagtgcctg	Protospacer
  .*.**  .********** ******.*******

32. spacer 8.1|5250687|33|NZ_CP046175|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ggactgc--tcgtgggcggctgcggccggtgcctg	CRISPR spacer
--gccgccaccgtgggcggcagcggccagtgcctg	Protospacer
  .*.**  .********** ******.*******

33. spacer 8.1|5250687|33|NZ_CP046175|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ggactgc--tcgtgggcggctgcggccggtgcctg	CRISPR spacer
--gccgccaccgtgggcggcagcggccagtgcctg	Protospacer
  .*.**  .********** ******.*******

34. spacer 8.1|5250687|33|NZ_CP046175|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ggactgc--tcgtgggcggctgcggccggtgcctg	CRISPR spacer
--gccgccaccgtgggcggcagcggccagtgcctg	Protospacer
  .*.**  .********** ******.*******

35. spacer 8.1|5250687|33|NZ_CP046175|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ggactgc--tcgtgggcggctgcggccggtgcctg	CRISPR spacer
--gccgccaccgtgggcggcagcggccagtgcctg	Protospacer
  .*.**  .********** ******.*******

36. spacer 8.1|5250687|33|NZ_CP046175|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

ggactgc--tcgtgggcggctgcggccggtgcctg	CRISPR spacer
--gccgccaccgtgggcggcagcggccagtgcctg	Protospacer
  .*.**  .********** ******.*******

37. spacer 8.1|5250687|33|NZ_CP046175|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

ggactgc--tcgtgggcggctgcggccggtgcctg	CRISPR spacer
--gccgccaccgtgggcggcagcggccagtgcctg	Protospacer
  .*.**  .********** ******.*******

38. spacer 8.1|5250687|33|NZ_CP046175|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

ggactgc--tcgtgggcggctgcggccggtgcctg	CRISPR spacer
--gccgccaccgtgggcggcagcggccagtgcctg	Protospacer
  .*.**  .********** ******.*******

39. spacer 8.1|5250687|33|NZ_CP046175|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

ggactgc--tcgtgggcggctgcggccggtgcctg	CRISPR spacer
--gccgccaccgtgggcggcagcggccagtgcctg	Protospacer
  .*.**  .********** ******.*******

40. spacer 8.1|5250687|33|NZ_CP046175|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

ggactgc--tcgtgggcggctgcggccggtgcctg	CRISPR spacer
--gccgccaccgtgggcggcagcggccagtgcctg	Protospacer
  .*.**  .********** ******.*******

41. spacer 8.1|5250687|33|NZ_CP046175|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

ggactgc--tcgtgggcggctgcggccggtgcctg	CRISPR spacer
--gccgccaccgtgggcggcagcggccagtgcctg	Protospacer
  .*.**  .********** ******.*******

42. spacer 8.1|5250687|33|NZ_CP046175|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ggactgc--tcgtgggcggctgcggccggtgcctg	CRISPR spacer
--gccgccaccgtgggcggcagcggccagtgcctg	Protospacer
  .*.**  .********** ******.*******

43. spacer 8.1|5250687|33|NZ_CP046175|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 7, identity: 0.788

ggactgc--tcgtgggcggctgcggccggtgcctg	CRISPR spacer
--gccgccaccgtgggcggcagcggccagtgcctg	Protospacer
  .*.**  .********** ******.*******

44. spacer 8.1|5250687|33|NZ_CP046175|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

ggactgc--tcgtgggcggctgcggccggtgcctg	CRISPR spacer
--gccgccaccgtgggcggcagcggccagtgcctg	Protospacer
  .*.**  .********** ******.*******

45. spacer 8.1|5250687|33|NZ_CP046175|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

ggactgc--tcgtgggcggctgcggccggtgcctg	CRISPR spacer
--gccgccaccgtgggcggcagcggccagtgcctg	Protospacer
  .*.**  .********** ******.*******

46. spacer 8.1|5250687|33|NZ_CP046175|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

ggactgc--tcgtgggcggctgcggccggtgcctg	CRISPR spacer
--gccgccaccgtgggcggcagcggccagtgcctg	Protospacer
  .*.**  .********** ******.*******

47. spacer 8.1|5250687|33|NZ_CP046175|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

ggactgc--tcgtgggcggctgcggccggtgcctg	CRISPR spacer
--gccgccaccgtgggcggcagcggccagtgcctg	Protospacer
  .*.**  .********** ******.*******

48. spacer 8.1|5250687|33|NZ_CP046175|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

ggactgc--tcgtgggcggctgcggccggtgcctg	CRISPR spacer
--gccgccaccgtgggcggcagcggccagtgcctg	Protospacer
  .*.**  .********** ******.*******

49. spacer 8.1|5250687|33|NZ_CP046175|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

ggactgc--tcgtgggcggctgcggccggtgcctg	CRISPR spacer
--gccgccaccgtgggcggcagcggccagtgcctg	Protospacer
  .*.**  .********** ******.*******

50. spacer 8.1|5250687|33|NZ_CP046175|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

ggactgc--tcgtgggcggctgcggccggtgcctg	CRISPR spacer
--gccgccaccgtgggcggcagcggccagtgcctg	Protospacer
  .*.**  .********** ******.*******

51. spacer 8.1|5250687|33|NZ_CP046175|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

ggactgc--tcgtgggcggctgcggccggtgcctg	CRISPR spacer
--gccgccaccgtgggcggcagcggccagtgcctg	Protospacer
  .*.**  .********** ******.*******

52. spacer 8.1|5250687|33|NZ_CP046175|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ggactgc--tcgtgggcggctgcggccggtgcctg	CRISPR spacer
--gccgccaccgtgggcggcagcggccagtgcctg	Protospacer
  .*.**  .********** ******.*******

53. spacer 8.1|5250687|33|NZ_CP046175|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

ggactgc--tcgtgggcggctgcggccggtgcctg	CRISPR spacer
--gccgccaccgtgggcggcagcggccagtgcctg	Protospacer
  .*.**  .********** ******.*******

54. spacer 8.1|5250687|33|NZ_CP046175|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ggactgc--tcgtgggcggctgcggccggtgcctg	CRISPR spacer
--gccgccaccgtgggcggcagcggccagtgcctg	Protospacer
  .*.**  .********** ******.*******

55. spacer 8.1|5250687|33|NZ_CP046175|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ggactgc--tcgtgggcggctgcggccggtgcctg	CRISPR spacer
--gccgccaccgtgggcggcagcggccagtgcctg	Protospacer
  .*.**  .********** ******.*******

56. spacer 8.1|5250687|33|NZ_CP046175|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ggactgc--tcgtgggcggctgcggccggtgcctg	CRISPR spacer
--gccgccaccgtgggcggcagcggccagtgcctg	Protospacer
  .*.**  .********** ******.*******

57. spacer 8.1|5250687|33|NZ_CP046175|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ggactgc--tcgtgggcggctgcggccggtgcctg	CRISPR spacer
--gccgccaccgtgggcggcagcggccagtgcctg	Protospacer
  .*.**  .********** ******.*******

58. spacer 8.1|5250687|33|NZ_CP046175|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ggactgc--tcgtgggcggctgcggccggtgcctg	CRISPR spacer
--gccgccaccgtgggcggcagcggccagtgcctg	Protospacer
  .*.**  .********** ******.*******

59. spacer 8.1|5250687|33|NZ_CP046175|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ggactgc--tcgtgggcggctgcggccggtgcctg	CRISPR spacer
--gccgccaccgtgggcggcagcggccagtgcctg	Protospacer
  .*.**  .********** ******.*******

60. spacer 8.1|5250687|33|NZ_CP046175|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ggactgc--tcgtgggcggctgcggccggtgcctg	CRISPR spacer
--gccgccaccgtgggcggcagcggccagtgcctg	Protospacer
  .*.**  .********** ******.*******

61. spacer 8.1|5250687|33|NZ_CP046175|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

ggactgc--tcgtgggcggctgcggccggtgcctg	CRISPR spacer
--gccgccaccgtgggcggcagcggccagtgcctg	Protospacer
  .*.**  .********** ******.*******

62. spacer 8.1|5250687|33|NZ_CP046175|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

ggactgc--tcgtgggcggctgcggccggtgcctg	CRISPR spacer
--gccgccaccgtgggcggcagcggccagtgcctg	Protospacer
  .*.**  .********** ******.*******

63. spacer 8.1|5250687|33|NZ_CP046175|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

ggactgc--tcgtgggcggctgcggccggtgcctg	CRISPR spacer
--gccgccaccgtgggcggcagcggccagtgcctg	Protospacer
  .*.**  .********** ******.*******

64. spacer 8.1|5250687|33|NZ_CP046175|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

ggactgc--tcgtgggcggctgcggccggtgcctg	CRISPR spacer
--gccgccaccgtgggcggcagcggccagtgcctg	Protospacer
  .*.**  .********** ******.*******

65. spacer 8.1|5250687|33|NZ_CP046175|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ggactgc--tcgtgggcggctgcggccggtgcctg	CRISPR spacer
--gccgccaccgtgggcggcagcggccagtgcctg	Protospacer
  .*.**  .********** ******.*******

66. spacer 8.1|5250687|33|NZ_CP046175|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ggactgc--tcgtgggcggctgcggccggtgcctg	CRISPR spacer
--gccgccaccgtgggcggcagcggccagtgcctg	Protospacer
  .*.**  .********** ******.*******

67. spacer 8.1|5250687|33|NZ_CP046175|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 7, identity: 0.788

ggactgc--tcgtgggcggctgcggccggtgcctg	CRISPR spacer
--gccgccaccgtgggcggcagcggccagtgcctg	Protospacer
  .*.**  .********** ******.*******

68. spacer 8.1|5250687|33|NZ_CP046175|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ggactgc--tcgtgggcggctgcggccggtgcctg	CRISPR spacer
--gccgccaccgtgggcggcagcggccagtgcctg	Protospacer
  .*.**  .********** ******.*******

69. spacer 8.1|5250687|33|NZ_CP046175|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ggactgc--tcgtgggcggctgcggccggtgcctg	CRISPR spacer
--gccgccaccgtgggcggcagcggccagtgcctg	Protospacer
  .*.**  .********** ******.*******

70. spacer 8.1|5250687|33|NZ_CP046175|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

ggactgc--tcgtgggcggctgcggccggtgcctg	CRISPR spacer
--gccgccaccgtgggcggcagcggccagtgcctg	Protospacer
  .*.**  .********** ******.*******

71. spacer 8.3|5250780|33|NZ_CP046175|CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.758

ggactgctcctgggcccctccggccggcgcctg	CRISPR spacer
cgtcagcgcctgggccgctccggccggcgcgac	Protospacer
 * * ** ******** *************   

72. spacer 8.3|5250780|33|NZ_CP046175|CRT matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 8, identity: 0.758

ggactgc--tcctgggcccctccggccggcgcctg	CRISPR spacer
--accaccatcctgggcacctccggcctgcgccac	Protospacer
  **..*  ******** ********* *****  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 5526713 : 5597583 59 Staphylococcus_prophage(16.67%) tail,transposase,plate NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage