1. spacer 1.16|192218|30|NZ_CP046253|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021917 (Sagittula sp. P11 plasmid unnamed4, complete sequence) position: , mismatch: 4, identity: 0.867
tcggtcgcctccatctacggggcgcagtcg CRISPR spacer
tcggtcgcctcgatctacggggcgcggctg Protospacer
*********** *************.*..*
2. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP046917 (Paraburkholderia sp. DHF22 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.833
acaat-cgcggccggcgtgctcagcgcgggc CRISPR spacer
-cagcgcgcggccgacgtgctcaacgcgggc Protospacer
**.. ********.********.*******
3. spacer 1.12|191955|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NC_011961 (Thermomicrobium roseum DSM 5159 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833
-acgccgaagcccaacggattgccgaggaga CRISPR spacer
aacagc-aggcccaacggatcgccgaggaga Protospacer
**. * *.***********.**********
4. spacer 1.1|191229|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP010452 (Corynebacterium glutamicum strain B253 plasmid, complete sequence) position: , mismatch: 6, identity: 0.8
ttcggcgctgggcgaacgaccggaagaaat CRISPR spacer
tgcgtacctgggcgaacgcccgaaagaaat Protospacer
* ** *********** ***.*******
5. spacer 1.2|191295|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 6, identity: 0.8
ctttaccggtttcgaacgccagcgggatcg CRISPR spacer
cctaaacggtttcgaactccagcgggagcc Protospacer
*.* * *********** ********* *
6. spacer 1.3|191361|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 6, identity: 0.8
ctttaccggtttcgaacgccagcgggatcg CRISPR spacer
cctaaacggtttcgaactccagcgggagcc Protospacer
*.* * *********** ********* *
7. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP024907 (Paraburkholderia caledonica strain PHRS4 plasmid pPHRS4, complete sequence) position: , mismatch: 6, identity: 0.8
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
ggaatcgcggctggcgtgctcaacgcgagt Protospacer
. *********.**********.****.*.
8. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.8
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gcggtcgcggccggcctgctcggcgcgggg Protospacer
.*..*********** *****.*******
9. spacer 1.5|191493|30|NZ_CP046253|CRISPRCasFinder,CRT,PILER-CR matches to NC_042091 (Pseudomonas phage nickie, complete genome) position: , mismatch: 6, identity: 0.8
tcgatcgttgcttgagcgatggccgctgcc CRISPR spacer
tcgagcgttgcttgagcgttggctttagcc Protospacer
**** ************* ****. . ***
10. spacer 1.10|191823|30|NZ_CP046253|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025014 (Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence) position: , mismatch: 6, identity: 0.8
ttgaagtcgcgcttggcgctgccatggccg CRISPR spacer
tcgtcatcgggcttgccgctgccatggccg Protospacer
*.* .*** ***** **************
11. spacer 1.12|191955|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP049157 (Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence) position: , mismatch: 6, identity: 0.8
acgccgaagcccaacggattgccgaggaga CRISPR spacer
acctggacgcccaacggattggcgaggaca Protospacer
** . ** ************* ****** *
12. spacer 1.12|191955|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP049317 (Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence) position: , mismatch: 6, identity: 0.8
acgccgaagcccaacggattgccgaggaga CRISPR spacer
acctggacgcccaacggattggcgaggaca Protospacer
** . ** ************* ****** *
13. spacer 1.12|191955|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP054030 (Rhizobium sp. JKLM19E plasmid pPR19E03) position: , mismatch: 6, identity: 0.8
acgccgaagcccaacggattgccgaggaga CRISPR spacer
acgacgaagcccaacggattgtacagacga Protospacer
*** *****************. **. **
14. spacer 1.13|192021|30|NZ_CP046253|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022192 (Yangia pacifica strain YSBP01 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.8
cgatggag---atcattggcgatcagccggtcg CRISPR spacer
---tcgagcccgtccttggcgatcagccggtcg Protospacer
* *** .** ******************
15. spacer 1.14|192087|30|NZ_CP046253|CRISPRCasFinder,CRT,PILER-CR matches to JQ807224 (Environmental Halophage eHP-3, partial genome) position: , mismatch: 6, identity: 0.8
aaggcgacgacgaccccgacgaccggggaa CRISPR spacer
gcgacgacgacgcccccgacgacgggggta Protospacer
. *.******** ********** **** *
16. spacer 1.1|191229|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NC_019846 (Sinorhizobium meliloti GR4 plasmid pRmeGR4a, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggcgctgggcgaacgaccggaagaaat CRISPR spacer
ccaggcgctgggcgaacgcccggaagacgg Protospacer
.. *************** ******** .
17. spacer 1.1|191229|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NC_015724 (Cupriavidus necator N-1 plasmid pBB2, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggcgctgggcgaacgaccggaagaaat CRISPR spacer
cggaccgctgggccaaagaccggaagaaat Protospacer
. . ******** ** *************
18. spacer 1.2|191295|30|NZ_CP046253|CRISPRCasFinder,CRT matches to KT070868 (Bacillus phage PBC5, complete genome) position: , mismatch: 7, identity: 0.767
ctttaccggtttcgaacgccagcgggatcg CRISPR spacer
ctttaccgatttcgaacgccattttaatag Protospacer
********.************ . .** *
19. spacer 1.3|191361|30|NZ_CP046253|CRISPRCasFinder,CRT matches to KT070868 (Bacillus phage PBC5, complete genome) position: , mismatch: 7, identity: 0.767
ctttaccggtttcgaacgccagcgggatcg CRISPR spacer
ctttaccgatttcgaacgccattttaatag Protospacer
********.************ . .** *
20. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 7, identity: 0.767
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gggctcgcggccggggtgctcaacgcggcc Protospacer
. . ********** *******.***** *
21. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 7, identity: 0.767
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gggctcgcggccggggtgctcaacgcggcc Protospacer
. . ********** *******.***** *
22. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP029360 (Azospirillum sp. CFH 70021 plasmid unnamed5) position: , mismatch: 7, identity: 0.767
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
aacatcgcggccggcgtgctcggcgatgaa Protospacer
* ******************.*** *.
23. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to MH744425 (Mycobacterium phage Wamburgrxpress, complete genome) position: , mismatch: 7, identity: 0.767
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
aaaatcgcgggcgacgtgctcagcgccatt Protospacer
* ******** **.************ . .
24. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to JN600672 (Mycobacterium phage Fezzik, complete genome) position: , mismatch: 7, identity: 0.767
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
aaaatcgcgggcgacgtgctcagcgccatt Protospacer
* ******** **.************ . .
25. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to MN617841 (Mycobacterium phage DirkDirk, complete genome) position: , mismatch: 7, identity: 0.767
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
aaaatcgcgggcgacgtgctcagcgccatt Protospacer
* ******** **.************ . .
26. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to MK494100 (Mycobacterium phage Halena, complete genome) position: , mismatch: 7, identity: 0.767
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
aaaatcgcgggcgacgtgctcagcgccatt Protospacer
* ******** **.************ . .
27. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to JF704113 (Mycobacterium phage UPIE, complete sequence) position: , mismatch: 7, identity: 0.767
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
aaaatcgcgggcgacgtgctcagcgccatt Protospacer
* ******** **.************ . .
28. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 7, identity: 0.767
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
tcctgcgcgaccggcgtgcgcagcgcggtc Protospacer
* ****.********* ******** *
29. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP017320 (Xanthomonas campestris pv. campestris str. CN18 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
aggaacgcagccggcttgctcagcgcggct Protospacer
* .* ***.****** ************ .
30. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NC_008757 (Polaromonas naphthalenivorans CJ2 plasmid pPNAP01, complete sequence) position: , mismatch: 7, identity: 0.767
acaatcgcggccggcgtgctcagcgcgggc--- CRISPR spacer
caaatcgctgccggcgtgctca---ccggcctg Protospacer
****** ************* * ***
31. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_AP022849 (Bosea sp. ANAM02 plasmid pANAM02, complete sequence) position: , mismatch: 7, identity: 0.767
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gcgatcgcggccggcggcctcagcgcagca Protospacer
.*.************* ********.*
32. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP014581 (Burkholderia sp. OLGA172 plasmid pOLGA2, complete sequence) position: , mismatch: 7, identity: 0.767
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gcgagttcggccggctggctcagcgcgggc Protospacer
.*.* . ******** *************
33. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NC_048021 (Gordonia phage Daredevil, complete genome) position: , mismatch: 7, identity: 0.767
acaatcgcg---gccggcgtgctcagcgcgggc CRISPR spacer
---ggtgcgtacgccggcgtgctcaccgcgggc Protospacer
. .*** ************* *******
34. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to MN892485 (Gordonia phage Kuwabara, complete genome) position: , mismatch: 7, identity: 0.767
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
ccggtcgaggccggcgagctcagcgcgcac Protospacer
*..*** ******** ********** .*
35. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NC_048018 (Gordonia phage Apricot, complete genome) position: , mismatch: 7, identity: 0.767
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
ccggtcgaggccggcgagctcagcgcgcac Protospacer
*..*** ******** ********** .*
36. spacer 1.5|191493|30|NZ_CP046253|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022191 (Yangia pacifica strain YSBP01 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
tcgatcgttgcttgagcgatggccgctgcc CRISPR spacer
tcgatcgtggcttgagcggtggcgtcgaca Protospacer
******** *********.**** * .*
37. spacer 1.8|191691|30|NZ_CP046253|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP046568 (Dietzia sp. DQ12-45-1b plasmid pI, complete sequence) position: , mismatch: 7, identity: 0.767
ccctacagctatgaggatgatgtcgccgag CRISPR spacer
actgcccgctatgaggttgatgtcggcgag Protospacer
*. * ********* ******** ****
38. spacer 1.9|191757|30|NZ_CP046253|CRISPRCasFinder,CRT,PILER-CR matches to NC_017318 (Edwardsiella tarda FL6-60 plasmid pFL6-60, complete sequence) position: , mismatch: 7, identity: 0.767
aaagtgaggcggtgaaaacggtcgcccatg CRISPR spacer
tcagtgaggcgctgaaaacggtcgatgagg Protospacer
********* ************ . * *
39. spacer 1.10|191823|30|NZ_CP046253|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025798 (Vibrio owensii strain 051011B plasmid unnamed1) position: , mismatch: 7, identity: 0.767
ttgaagtcgcgcttggcgctgccatggccg CRISPR spacer
atgctcgtgcgcttggcgctgccatggtcg Protospacer
** .*******************.**
40. spacer 1.10|191823|30|NZ_CP046253|CRISPRCasFinder,CRT,PILER-CR matches to MT889373 (Arthrobacter phage Brynnie, complete genome) position: , mismatch: 7, identity: 0.767
ttgaagtcgcgcttggcgctgccatggccg CRISPR spacer
gcgtggacgcgctcggcgctgccatgggcg Protospacer
.* .* ******.************* **
41. spacer 1.12|191955|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NC_022049 (Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence) position: , mismatch: 7, identity: 0.767
acgccgaagcccaacggattgccgaggaga CRISPR spacer
aggccgaagcccaccggatcgccgagatct Protospacer
* *********** *****.******.
42. spacer 1.12|191955|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 7, identity: 0.767
acgccgaagcccaacggattgccgaggaga CRISPR spacer
ccgccgaggccgaacggattgccgacggcc Protospacer
******.*** ************* *.
43. spacer 1.12|191955|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP016288 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed7, complete sequence) position: , mismatch: 7, identity: 0.767
acgccgaagcccaacggattgccgaggaga CRISPR spacer
acgacgaagcccaacggattgtacaaacga Protospacer
*** *****************. *.. **
44. spacer 1.12|191955|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NC_022050 (Paracoccus aminophilus JCM 7686 plasmid pAMI8, complete sequence) position: , mismatch: 7, identity: 0.767
acgccgaagcccaacggattgccgaggaga CRISPR spacer
tggtcgaagcccagccgattgccgaggcgg Protospacer
*.*********.* *********** *.
45. spacer 1.13|192021|30|NZ_CP046253|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014767 (Pontibacter akesuensis strain AKS 1T plasmid Paks1, complete sequence) position: , mismatch: 7, identity: 0.767
cgatggagatcattggcgatcagccggtcg CRISPR spacer
cagacgagatcatgggcgatcaggcggtgg Protospacer
*.. ******** ********* **** *
46. spacer 1.13|192021|30|NZ_CP046253|CRISPRCasFinder,CRT,PILER-CR matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 7, identity: 0.767
cgatggagatcattggcgatcagccggtcg CRISPR spacer
cgatggagatcattgacgatcttctcgcgg Protospacer
***************.***** *. *. *
47. spacer 1.13|192021|30|NZ_CP046253|CRISPRCasFinder,CRT,PILER-CR matches to MN379651 (Chicken microvirus mg8_109, complete genome) position: , mismatch: 7, identity: 0.767
cgatggagatcattggcgatcagccggtcg CRISPR spacer
tgatggagctcattggcgatcatctattgg Protospacer
.******* ************* *.. * *
48. spacer 1.14|192087|30|NZ_CP046253|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.767
aaggcgacgacgaccccgacgaccggggaa CRISPR spacer
acggcgacgccgatcccgacgaccgtcgcg Protospacer
* ******* ***.*********** * .
49. spacer 1.14|192087|30|NZ_CP046253|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP042999 (Aquisphaera giovannonii strain OJF2 plasmid pOJF2_2, complete sequence) position: , mismatch: 7, identity: 0.767
aaggcgacgacgaccccgacgaccggggaa CRISPR spacer
tggccgacgacgaccccgatgaccgggatt Protospacer
.* ***************.*******.
50. spacer 1.14|192087|30|NZ_CP046253|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027239 (Dietzia sp. oral taxon 368 strain W5195 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
aaggcgacgacgaccccgacgaccggggaa CRISPR spacer
ccggcgacgacgaccccgacgccctgcaca Protospacer
******************* ** * . *
51. spacer 1.14|192087|30|NZ_CP046253|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP035092 (Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
aaggcgacgacgaccccgacgaccggggaa CRISPR spacer
gcgccgacgccgaccccgacgaccgaggcg Protospacer
. * ***** ***************.** .
52. spacer 1.14|192087|30|NZ_CP046253|CRISPRCasFinder,CRT,PILER-CR matches to NC_008688 (Paracoccus denitrificans PD1222 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.767
aaggcgacgacgaccccgacgaccggggaa CRISPR spacer
gcgccgacgccgaccccgacgaccgaggcg Protospacer
. * ***** ***************.** .
53. spacer 1.14|192087|30|NZ_CP046253|CRISPRCasFinder,CRT,PILER-CR matches to NC_020548 (Azoarcus sp. KH32C plasmid pAZKH, complete sequence) position: , mismatch: 7, identity: 0.767
aaggcgacgacgaccccgacgaccggggaa CRISPR spacer
gtggcgacgacgaccccgccggccggagcg Protospacer
. **************** **.****.* .
54. spacer 1.14|192087|30|NZ_CP046253|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134459 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence) position: , mismatch: 7, identity: 0.767
aaggcgacgacgaccccgacgaccggggaa CRISPR spacer
acggtgacgacgaccccggcgaccgcgacc Protospacer
* **.*************.****** *.
55. spacer 1.14|192087|30|NZ_CP046253|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
aaggcgacgacgaccccgacgaccggggaa CRISPR spacer
aaggcgacgacgacgacgacgacggtgcgc Protospacer
************** ******* * * .
56. spacer 1.14|192087|30|NZ_CP046253|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 7, identity: 0.767
aaggcgacgacgaccccgacgaccggggaa CRISPR spacer
agggcgtcgacgacctcgacgaccgcgatg Protospacer
*.**** ********.********* *. .
57. spacer 1.14|192087|30|NZ_CP046253|CRISPRCasFinder,CRT,PILER-CR matches to MF141540 (Mycobacterium phage Avocado, complete genome) position: , mismatch: 7, identity: 0.767
aaggcgacgacgaccccgacgaccggggaa CRISPR spacer
acgacggcgccgaccccgacgaccgggcgc Protospacer
* *.**.** ***************** .
58. spacer 1.14|192087|30|NZ_CP046253|CRISPRCasFinder,CRT,PILER-CR matches to KR080198 (Mycobacterium phage Cambiare, complete genome) position: , mismatch: 7, identity: 0.767
aaggcgacgacgaccccgacgaccggggaa CRISPR spacer
acgacggcgccgaccccgacgaccgggcgc Protospacer
* *.**.** ***************** .
59. spacer 1.1|191229|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP033968 (Cupriavidus pauculus strain FDAARGOS_614 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
ttcggcgctgggcgaacgaccggaagaaat CRISPR spacer
ttgggcgctgggcgaacgacctgcaagtcg Protospacer
** ****************** * *..
60. spacer 1.1|191229|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP037902 (Cupriavidus metallidurans strain BS1 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.733
ttcggcgctgggcgaacgaccggaagaaat CRISPR spacer
ttgggcgctgggcgaacgacctgcaagtcg Protospacer
** ****************** * *..
61. spacer 1.1|191229|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP046332 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed2) position: , mismatch: 8, identity: 0.733
ttcggcgctgggcgaacgaccggaagaaat CRISPR spacer
ttgggcgctgggcgaacgacctgcaagtcg Protospacer
** ****************** * *..
62. spacer 1.1|191229|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP026546 (Cupriavidus metallidurans strain Ni-2 plasmid unnamed2) position: , mismatch: 8, identity: 0.733
ttcggcgctgggcgaacgaccggaagaaat CRISPR spacer
ttgggcgctgggcgaacgacctgcaagtcg Protospacer
** ****************** * *..
63. spacer 1.1|191229|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NC_006466 (Cupriavidus metallidurans CH34 plasmid pMOL30, complete sequence) position: , mismatch: 8, identity: 0.733
ttcggcgctgggcgaacgaccggaagaaat CRISPR spacer
ttgggcgctgggcgaacgacctgcaagtcg Protospacer
** ****************** * *..
64. spacer 1.1|191229|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP043439 (Cupriavidus campinensis strain MJ1 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.733
ttcggcgctgggcgaacgaccggaagaaat CRISPR spacer
ttgggcgctgggcgaacgacctgcaagtcg Protospacer
** ****************** * *..
65. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.733
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
tatctcgcgggcggcgtgctcggcgcgctc Protospacer
****** **********.***** *
66. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 8, identity: 0.733
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
tatctcgcgggcggcgtgctcggcgcgctc Protospacer
****** **********.***** *
67. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NC_021289 (Burkholderia insecticola plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.733
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
tatctcgcgggcggcgtgctcggcgcgctc Protospacer
****** **********.***** *
68. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.733
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
ttcgacccggccggcgtgctcaccgcgcgc Protospacer
. . * *************** **** **
69. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.733
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
ctcctcgcggccggcgcgctcaccgcgctc Protospacer
. ************.***** **** *
70. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP045288 (Curtobacterium flaccumfaciens pv. flaccumfaciens strain P990 plasmid pCff1, complete sequence) position: , mismatch: 8, identity: 0.733
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gtgctcgcggcgggcctgctcagcgcgctc Protospacer
... ******* *** *********** *
71. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to CP041260 (Curtobacterium flaccumfaciens pv. flaccumfaciens strain Cff1037 plasmid pCFF113, complete sequence) position: , mismatch: 8, identity: 0.733
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gtgctcgcggcgggcctgctcagcgcgctc Protospacer
... ******* *** *********** *
72. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 8, identity: 0.733
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
tatctcgcgggcggcgtgctcggcgcgctc Protospacer
****** **********.***** *
73. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to MK279905 (Mycobacterium phage Acquire49, complete genome) position: , mismatch: 8, identity: 0.733
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
aagatcgcgggcgacgtgctcagcgccatt Protospacer
* .******* **.************ . .
74. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to MK310144 (Mycobacterium phage CicholasNage, complete genome) position: , mismatch: 8, identity: 0.733
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
aagatcgcgggcgacgtgctcagcgccatt Protospacer
* .******* **.************ . .
75. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to MN586018 (Mycobacterium phage Wyatt2, complete genome) position: , mismatch: 8, identity: 0.733
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
aagatcgcgggcgacgtgctcagcgccatt Protospacer
* .******* **.************ . .
76. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to MN586023 (Mycobacterium phage Zaria, complete genome) position: , mismatch: 8, identity: 0.733
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
aagatcgcgggcgacgtgctcagcgccatt Protospacer
* .******* **.************ . .
77. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to MT771349 (Mycobacterium phage Tyson, complete genome) position: , mismatch: 8, identity: 0.733
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
aagatcgcgggcgacgtgctcagcgccatt Protospacer
* .******* **.************ . .
78. spacer 1.5|191493|30|NZ_CP046253|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 8, identity: 0.733
tcgatcgttgcttgagcgatggccgctgcc CRISPR spacer
cgaggcgttgcttgaccgctggccgctggc Protospacer
. .. ********** ** ********* *
79. spacer 1.6|191559|30|NZ_CP046253|CRISPRCasFinder,CRT,PILER-CR matches to KC131024 (Marine gokushovirus isolate SOG1, complete genome) position: , mismatch: 8, identity: 0.733
tgcatagaattgagcataggcaaagcggcg CRISPR spacer
aaagcggcattgagcagaggcaaagcggcg Protospacer
. ...* ******** *************
80. spacer 1.8|191691|30|NZ_CP046253|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013635 (Rhizobium sp. N324 plasmid pRspN324e, complete sequence) position: , mismatch: 8, identity: 0.733
ccctacagctatgaggatgatgtcgccgag CRISPR spacer
gtcagcagctatgaggatgatgccgtcggc Protospacer
.* .*****************.**.**.
81. spacer 1.10|191823|30|NZ_CP046253|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 8, identity: 0.733
ttgaagtcgcgcttggcgctgccatggccg CRISPR spacer
agcgcgtcgcgcttggcgctgccgtcgcgg Protospacer
. ******************.* ** *
82. spacer 1.10|191823|30|NZ_CP046253|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
ttgaagtcgcgcttggcgctgccatggccg CRISPR spacer
gcgcaccgtcgcttggcggtgccatggccg Protospacer
.* * . ********* ***********
83. spacer 1.11|191889|30|NZ_CP046253|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025433 (Paracoccus zhejiangensis strain J6 plasmid pPZ03, complete sequence) position: , mismatch: 8, identity: 0.733
ggatgaattgatcgttgccgttcgtcacga CRISPR spacer
gatctggttgatcgttgccgtacgtcgcga Protospacer
*. . ..************** ****.***
84. spacer 1.11|191889|30|NZ_CP046253|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025432 (Paracoccus zhejiangensis strain J6 plasmid pPZ02, complete sequence) position: , mismatch: 8, identity: 0.733
ggatgaattgatcgttgccgttcgtcacga CRISPR spacer
gatctggttgatcgttgccgtacgtcgcga Protospacer
*. . ..************** ****.***
85. spacer 1.13|192021|30|NZ_CP046253|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
-------cgatggagatcattggcgatcagccggtcg CRISPR spacer
aacacatcg-------tcattgacgatcagccggtcg Protospacer
** ******.**************
86. spacer 1.14|192087|30|NZ_CP046253|CRISPRCasFinder,CRT,PILER-CR matches to NC_018583 (Gordonia sp. KTR9 plasmid pGKT3, complete sequence) position: , mismatch: 8, identity: 0.733
aaggcgacgacgaccccgacgaccggggaa CRISPR spacer
tgggcgacgacgaccccgacggcccgcccg Protospacer
.*******************.** * .
87. spacer 1.14|192087|30|NZ_CP046253|CRISPRCasFinder,CRT,PILER-CR matches to NC_020548 (Azoarcus sp. KH32C plasmid pAZKH, complete sequence) position: , mismatch: 8, identity: 0.733
aaggcgacgacgaccccgacgaccggggaa CRISPR spacer
tgggcgacgacgagcacgacgaccggcacg Protospacer
.*********** * ********** . .
88. spacer 1.14|192087|30|NZ_CP046253|CRISPRCasFinder,CRT,PILER-CR matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 8, identity: 0.733
aaggcgacgacgaccccgacgaccggggaa CRISPR spacer
acggcgacgacgacgccgacgacgcgcagg Protospacer
* ************ ******** * ...
89. spacer 1.14|192087|30|NZ_CP046253|CRISPRCasFinder,CRT,PILER-CR matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 8, identity: 0.733
aaggcgacgacgaccccgacgaccggggaa CRISPR spacer
tggacgccgacgaccccgacgagcgggccg Protospacer
.*.** *************** **** .
90. spacer 1.14|192087|30|NZ_CP046253|CRISPRCasFinder,CRT,PILER-CR matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 8, identity: 0.733
aaggcgacgacgaccccgacgaccggggaa CRISPR spacer
tggacgccgacgaccccgacgagcgggccg Protospacer
.*.** *************** **** .
91. spacer 1.14|192087|30|NZ_CP046253|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 8, identity: 0.733
aaggcgacgacgaccccgacgaccggggaa CRISPR spacer
ctcgccacgacgacgccgacgaccggcgcg Protospacer
** ******** *********** * .
92. spacer 1.14|192087|30|NZ_CP046253|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP018921 (Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence) position: , mismatch: 8, identity: 0.733
aaggcgacgacgaccccgacgaccggggaa CRISPR spacer
gcggcgacgacgacaccggcgaccgcgacg Protospacer
. ************ ***.****** *. .
93. spacer 1.14|192087|30|NZ_CP046253|CRISPRCasFinder,CRT,PILER-CR matches to MN693893 (Marine virus AFVG_250M400, complete genome) position: , mismatch: 8, identity: 0.733
aaggcgacgacgaccccgacgaccggggaa CRISPR spacer
aagactacgacgaccccgacgacgacgacg Protospacer
***.* ***************** . *. .
94. spacer 1.14|192087|30|NZ_CP046253|CRISPRCasFinder,CRT,PILER-CR matches to JN116822 (Rhodococcus phage RRH1, complete genome) position: , mismatch: 8, identity: 0.733
aaggcgacgacgaccccgacgaccggggaa CRISPR spacer
ccggcgccgacgcccccgacgaccgcgatc Protospacer
**** ***** ************ *.
95. spacer 1.14|192087|30|NZ_CP046253|CRISPRCasFinder,CRT,PILER-CR matches to KJ510412 (Mycobacterium phage ZoeJ, complete genome) position: , mismatch: 8, identity: 0.733
aaggcgacgacgaccccgacgaccggggaa CRISPR spacer
accgcgacgtcgaccccgacgacctgccgc Protospacer
* ****** ************** * .
96. spacer 1.14|192087|30|NZ_CP046253|CRISPRCasFinder,CRT,PILER-CR matches to MT521995 (Gordonia phage Moosehead, complete genome) position: , mismatch: 8, identity: 0.733
aaggcgacgacgaccccgacgaccggggaa CRISPR spacer
ccggcgacgacgacgcagacgaccgagccc Protospacer
************ * ********.*
97. spacer 1.14|192087|30|NZ_CP046253|CRISPRCasFinder,CRT,PILER-CR matches to MN694280 (Marine virus AFVG_250M397, complete genome) position: , mismatch: 8, identity: 0.733
aaggcgacgacgaccccgacgaccggggaa CRISPR spacer
aagactacgacgaccccgacgacgacgacg Protospacer
***.* ***************** . *. .
98. spacer 1.14|192087|30|NZ_CP046253|CRISPRCasFinder,CRT,PILER-CR matches to MH834601 (Mycobacterium phage BoostSeason, complete genome) position: , mismatch: 8, identity: 0.733
aaggcgacgacgaccccgacgaccggggaa CRISPR spacer
accgcgacgtcgaccccgacgacctgccgc Protospacer
* ****** ************** * .
99. spacer 1.14|192087|30|NZ_CP046253|CRISPRCasFinder,CRT,PILER-CR matches to MH825699 (Streptomyces phage Darolandstone, complete genome) position: , mismatch: 8, identity: 0.733
aaggcgacgacgaccccgacgaccggggaa CRISPR spacer
ccggcgacgacgacgccgacgacgacgggg Protospacer
************ ******** . **..
100. spacer 1.14|192087|30|NZ_CP046253|CRISPRCasFinder,CRT,PILER-CR matches to MN694299 (Marine virus AFVG_250M399, complete genome) position: , mismatch: 8, identity: 0.733
aaggcgacgacgaccccgacgaccggggaa CRISPR spacer
aagactacgacgaccccgacgacgacgacg Protospacer
***.* ***************** . *. .
101. spacer 1.14|192087|30|NZ_CP046253|CRISPRCasFinder,CRT,PILER-CR matches to NC_028759 (Mycobacterium phage Mufasa, complete genome) position: , mismatch: 8, identity: 0.733
aaggcgacgacgaccccgacgaccggggaa CRISPR spacer
accgcgacgtcgaccccgacgacctgccgc Protospacer
* ****** ************** * .
102. spacer 1.14|192087|30|NZ_CP046253|CRISPRCasFinder,CRT,PILER-CR matches to MN694718 (Marine virus AFVG_250M398, complete genome) position: , mismatch: 8, identity: 0.733
aaggcgacgacgaccccgacgaccggggaa CRISPR spacer
aagactacgacgaccccgacgacgacgacg Protospacer
***.* ***************** . *. .
103. spacer 1.14|192087|30|NZ_CP046253|CRISPRCasFinder,CRT,PILER-CR matches to JQ680374 (Unidentified phage clone 2209_scaffold441 genomic sequence) position: , mismatch: 8, identity: 0.733
aaggcgacgacgaccccgacgaccggggaa CRISPR spacer
aaggcgaggacgaccccgacaacaacgact Protospacer
******* ************.** . *.
104. spacer 1.14|192087|30|NZ_CP046253|CRISPRCasFinder,CRT,PILER-CR matches to MN585966 (Gordonia phage Faith5x5, complete genome) position: , mismatch: 8, identity: 0.733
aaggcgacgacgaccccgacgaccggggaa CRISPR spacer
tcggcgacgacgacgcagacgaccgagcct Protospacer
************ * ********.*
105. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gagcgcgcggccggcgtgctcggcgcgctg Protospacer
. . ****************.*****
106. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gagcgcgcggccggcgtgctcggcgcgctg Protospacer
. . ****************.*****
107. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gagcgcgcggccggcgtgctcggcgcgctg Protospacer
. . ****************.*****
108. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gagcgcgcggccggcgtgctcggcgcgctg Protospacer
. . ****************.*****
109. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gagcgcgcggccggcgtgctcggcgcgctg Protospacer
. . ****************.*****
110. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gagcgcgcggccggcgtgctcggcgcgctg Protospacer
. . ****************.*****
111. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gagcgcgcggccggcgtgctcggcgcgctg Protospacer
. . ****************.*****
112. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gagcgcgcggccggcgtgctcggcgcgctg Protospacer
. . ****************.*****
113. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gagcgcgcggccggcgtgctcggcgcgctg Protospacer
. . ****************.*****
114. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gagcgcgcggccggcgtgctcggcgcgctg Protospacer
. . ****************.*****
115. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gagcgcgcggccggcgtgctcggcgcgctg Protospacer
. . ****************.*****
116. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gagcgcgcggccggcgtgctcggcgcgctg Protospacer
. . ****************.*****
117. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gagcgcgcggccggcgtgctcggcgcgctg Protospacer
. . ****************.*****
118. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gagcgcgcggccggcgtgctcggcgcgctg Protospacer
. . ****************.*****
119. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gagcgcgcggccggcgtgctcggcgcgctg Protospacer
. . ****************.*****
120. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gagcgcgcggccggcgtgctcggcgcgctg Protospacer
. . ****************.*****
121. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gagcgcgcggccggcgtgctcggcgcgctg Protospacer
. . ****************.*****
122. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gagcgcgcggccggcgtgctcggcgcgctg Protospacer
. . ****************.*****
123. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gagcgcgcggccggcgtgctcggcgcgctg Protospacer
. . ****************.*****
124. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gagcgcgcggccggcgtgctcggcgcgctg Protospacer
. . ****************.*****
125. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gagcgcgcggccggcgtgctcggcgcgctg Protospacer
. . ****************.*****
126. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gagcgcgcggccggcgtgctcggcgcgctg Protospacer
. . ****************.*****
127. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gagcgcgcggccggcgtgctcggcgcgctg Protospacer
. . ****************.*****
128. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gagcgcgcggccggcgtgctcggcgcgctg Protospacer
. . ****************.*****
129. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gagcgcgcggccggcgtgctcggcgcgctg Protospacer
. . ****************.*****
130. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gagcgcgcggccggcgtgctcggcgcgctg Protospacer
. . ****************.*****
131. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gagcgcgcggccggcgtgctcggcgcgctg Protospacer
. . ****************.*****
132. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gagcgcgcggccggcgtgctcggcgcgctg Protospacer
. . ****************.*****
133. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gagcgcgcggccggcgtgctcggcgcgctg Protospacer
. . ****************.*****
134. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gagcgcgcggccggcgtgctcggcgcgctg Protospacer
. . ****************.*****
135. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gagcgcgcggccggcgtgctcggcgcgctg Protospacer
. . ****************.*****
136. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gagcgcgcggccggcgtgctcggcgcgctg Protospacer
. . ****************.*****
137. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gagcgcgcggccggcgtgctcggcgcgctg Protospacer
. . ****************.*****
138. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gagcgcgcggccggcgtgctcggcgcgctg Protospacer
. . ****************.*****
139. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gagcgcgcggccggcgtgctcggcgcgctg Protospacer
. . ****************.*****
140. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gagcgcgcggccggcgtgctcggcgcgctg Protospacer
. . ****************.*****
141. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gagcgcgcggccggcgtgctcggcgcgctg Protospacer
. . ****************.*****
142. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gagcgcgcggccggcgtgctcggcgcgctg Protospacer
. . ****************.*****
143. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gagcgcgcggccggcgtgctcggcgcgctg Protospacer
. . ****************.*****
144. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gagcgcgcggccggcgtgctcggcgcgctg Protospacer
. . ****************.*****
145. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gagcgcgcggccggcgtgctcggcgcgctg Protospacer
. . ****************.*****
146. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gagcgcgcggccggcgtgctcggcgcgctg Protospacer
. . ****************.*****
147. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gagcgcgcggccggcgtgctcggcgcgctg Protospacer
. . ****************.*****
148. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gagcgcgcggccggcgtgctcggcgcgctg Protospacer
. . ****************.*****
149. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gagcgcgcggccggcgtgctcggcgcgctg Protospacer
. . ****************.*****
150. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gagcgcgcggccggcgtgctcggcgcgctg Protospacer
. . ****************.*****
151. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gagcgcgcggccggcgtgctcggcgcgctg Protospacer
. . ****************.*****
152. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gagcgcgcggccggcgtgctcggcgcgctg Protospacer
. . ****************.*****
153. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gagcgcgcggccggcgtgctcggcgcgctg Protospacer
. . ****************.*****
154. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gagcgcgcggccggcgtgctcggcgcgctg Protospacer
. . ****************.*****
155. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gagcgcgcggccggcgtgctcggcgcgctg Protospacer
. . ****************.*****
156. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gagcgcgcggccggcgtgctcggcgcgctg Protospacer
. . ****************.*****
157. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gagcgcgcggccggcgtgctcggcgcgctg Protospacer
. . ****************.*****
158. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gagcgcgcggccggcgtgctcggcgcgctg Protospacer
. . ****************.*****
159. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gagcgcgcggccggcgtgctcggcgcgctg Protospacer
. . ****************.*****
160. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gagcgcgcggccggcgtgctcggcgcgctg Protospacer
. . ****************.*****
161. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gagcgcgcggccggcgtgctcggcgcgctg Protospacer
. . ****************.*****
162. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gagcgcgcggccggcgtgctcggcgcgctg Protospacer
. . ****************.*****
163. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gagcgcgcggccggcgtgctcggcgcgctg Protospacer
. . ****************.*****
164. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gagcgcgcggccggcgtgctcggcgcgctg Protospacer
. . ****************.*****
165. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gagcgcgcggccggcgtgctcggcgcgctg Protospacer
. . ****************.*****
166. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gagcgcgcggccggcgtgctcggcgcgctg Protospacer
. . ****************.*****
167. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gagcgcgcggccggcgtgctcggcgcgctg Protospacer
. . ****************.*****
168. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_LR134463 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 21, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gtccccgcgggcgacgtgctcagcgcggag Protospacer
.. .***** **.**************.
169. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP013415 (Burkholderia ubonensis strain MSMB2035 plasmid pMSMB2035, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
ctggccgcgaccggcgtgctcggcgcggtg Protospacer
....****.***********.******
170. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP007050 (Rhizobium leguminosarum bv. trifolii WSM1689 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
gtaatcgcggccgtcgtgctcggcggaacg Protospacer
..*********** *******.*** ..
171. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to MT771346 (Gordonia phage MichaelScott, complete genome) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
ctggaagcggccgacgtcctcagcgcgggg Protospacer
... *******.*** ***********
172. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to MK937609 (Gordonia phage Sekhmet, complete genome) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
ctggaagcggccgacgtcctcagcgcgggg Protospacer
... *******.*** ***********
173. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to KU252585 (Gordonia phage Howe, complete genome) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
ctggaagcggccgacgtcctcagcgcgggg Protospacer
... *******.*** ***********
174. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to MN428057 (Gordonia phage Suerte, complete genome) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
ctggaagcggccgacgtcctcagcgcgggg Protospacer
... *******.*** ***********
175. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to MK878902 (Gordonia phage Twinkle, complete genome) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
ctggaagcggccgacgtcctcagcgcgggg Protospacer
... *******.*** ***********
176. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to MK061406 (Gordonia phage Adora, complete genome) position: , mismatch: 9, identity: 0.7
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
ctggaagcggccgacgtcctcagcgcgggg Protospacer
... *******.*** ***********
177. spacer 1.10|191823|30|NZ_CP046253|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024200 (Thalassospira marina strain CSC3H3 plasmid pCSC3H3, complete sequence) position: , mismatch: 9, identity: 0.7
ttgaagtcgcgcttggcgctgccatggccg CRISPR spacer
ttgaaggcgcgcttggggctgccggtattt Protospacer
****** ********* ******. ...
178. spacer 1.10|191823|30|NZ_CP046253|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP054841 (Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ttgaagtcgcgcttggcgctgccatggccg CRISPR spacer
cccggctcgcgcgtggcgctgacatggccc Protospacer
.. .. ****** ******** *******
179. spacer 1.10|191823|30|NZ_CP046253|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045361 (Roseivivax sp. THAF40 plasmid pTHAF40_a, complete sequence) position: , mismatch: 9, identity: 0.7
ttgaagtcgcgcttggcgctgccatggccg CRISPR spacer
cccgccgcgcgctcggcactgccatggccg Protospacer
.. . ******.***.************
180. spacer 1.10|191823|30|NZ_CP046253|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045319 (Roseivivax sp. THAF197b plasmid pTHAF197b_a, complete sequence) position: , mismatch: 9, identity: 0.7
ttgaagtcgcgcttggcgctgccatggccg CRISPR spacer
cccgccgcgcgctcggcactgccatggccg Protospacer
.. . ******.***.************
181. spacer 1.12|191955|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NC_021289 (Burkholderia insecticola plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.7
acgccgaagcccaacggattgccgaggaga CRISPR spacer
ttgccgaagccgaacgtattgccgatccac Protospacer
.********* **** ******** .
182. spacer 1.12|191955|30|NZ_CP046253|CRISPRCasFinder,CRT matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7
acgccgaagcccaacggattgccgaggaga CRISPR spacer
gtgccgatgccgaacggattgccgattgcg Protospacer
..***** *** ************* . .
183. spacer 1.14|192087|30|NZ_CP046253|CRISPRCasFinder,CRT,PILER-CR matches to MH779514 (Mycobacterium phage Paito, complete genome) position: , mismatch: 9, identity: 0.7
aaggcgacgacgaccccgacgaccggggaa CRISPR spacer
ggcccgtcgacgaccccgacgaccggattc Protospacer
.. ** *******************.
184. spacer 1.14|192087|30|NZ_CP046253|CRISPRCasFinder,CRT,PILER-CR matches to NC_018022 (Mycolicibacterium chubuense NBB4 plasmid pMYCCH.01, complete sequence) position: , mismatch: 9, identity: 0.7
aaggcgacgacgaccccgacgaccggggaa CRISPR spacer
tcggcgacgacgaccgcgacgacgcgttcg Protospacer
************* ******* * .
185. spacer 1.14|192087|30|NZ_CP046253|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030863 (Streptomyces globosus strain LZH-48 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
aaggcgacgacgaccccgacgaccggggaa CRISPR spacer
ccggcgacgacgaccccgactacaacccga Protospacer
****************** ** . .*
186. spacer 1.14|192087|30|NZ_CP046253|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.7
aaggcgacgacgaccccgacgaccggggaa CRISPR spacer
ctcgccacgacgacgccgacgaccggctcg Protospacer
** ******** *********** .
187. spacer 1.14|192087|30|NZ_CP046253|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP011276 (Planctomyces sp. SH-PL62 plasmid pPL62-3, complete sequence) position: , mismatch: 9, identity: 0.7
aaggcgacgacgaccccgacgaccggggaa CRISPR spacer
cgacggacgacgacgccgacgaccggctga Protospacer
.. ********* *********** .*
188. spacer 1.14|192087|30|NZ_CP046253|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 9, identity: 0.7
aaggcgacgacgaccccgacgaccggggaa CRISPR spacer
ctcgccacgacgacgccgacgaccggctcg Protospacer
** ******** *********** .
189. spacer 1.14|192087|30|NZ_CP046253|CRISPRCasFinder,CRT,PILER-CR matches to NC_028914 (Mycobacterium phage Sheen, complete genome) position: , mismatch: 9, identity: 0.7
aaggcgacgacgaccccgacgaccggggaa CRISPR spacer
tcaagtacgacgaccaggacgaccggggat Protospacer
.. ********* ************
190. spacer 1.14|192087|30|NZ_CP046253|CRISPRCasFinder,CRT,PILER-CR matches to MF074189 (Sinorhizobium phage phiM5, complete genome) position: , mismatch: 9, identity: 0.7
aaggcgacgacgaccccgacgaccggggaa CRISPR spacer
atggcgacgacgacgccgacgacgatcagg Protospacer
* ************ ******** . ...
191. spacer 1.4|191427|30|NZ_CP046253|CRISPRCasFinder,CRT matches to MT498065 (Microbacterium phage PoRanda, complete genome) position: , mismatch: 10, identity: 0.667
acaatcgcggccggcgtgctcagcgcgggc CRISPR spacer
ctcggcgcggccggcgtgctcggcgctttg Protospacer
. . ****************.****
192. spacer 1.14|192087|30|NZ_CP046253|CRISPRCasFinder,CRT,PILER-CR matches to AP021850 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome) position: , mismatch: 10, identity: 0.667
aaggcgacgacgaccccgacgaccggggaa CRISPR spacer
tgatcgacgacgaccccgccgaccgcctgc Protospacer
.. ************** ****** .
