Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP039989 Pseudomonas aeruginosa strain T2436 plasmid pBT2436, complete sequence 1 crisprs DEDDh 0 1 2 0
NZ_CP039988 Pseudomonas aeruginosa strain T2436 chromosome, complete genome 2 crisprs csa3,DEDDh,cas3,WYL,PD-DExK,DinG,RT 0 0 11 0

Results visualization

1. NZ_CP039989
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP039989_1 26532-26622 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP039989_1 1.1|26557|41|NZ_CP039989|CRISPRCasFinder 26557-26597 41 NZ_KY494864 Pseudomonas aeruginosa strain FFUP_PS_37 plasmid pJB37, complete sequence 210486-210526 0 1.0
NZ_CP039989_1 1.1|26557|41|NZ_CP039989|CRISPRCasFinder 26557-26597 41 NZ_LT969519 Pseudomonas aeruginosa isolate RW109 genome assembly, plasmid: RW109 plasmid 1 261779-261819 0 1.0
NZ_CP039989_1 1.1|26557|41|NZ_CP039989|CRISPRCasFinder 26557-26597 41 NZ_CP009975 Pseudomonas putida S12 plasmid pTTS12, complete sequence 209984-210024 0 1.0
NZ_CP039989_1 1.1|26557|41|NZ_CP039989|CRISPRCasFinder 26557-26597 41 NZ_CP029094 Pseudomonas aeruginosa strain AR441 plasmid unnamed3, complete sequence 46635-46675 0 1.0
NZ_CP039989_1 1.1|26557|41|NZ_CP039989|CRISPRCasFinder 26557-26597 41 NZ_CP040126 Pseudomonas aeruginosa strain PA298 plasmid pBM908, complete sequence 204335-204375 0 1.0
NZ_CP039989_1 1.1|26557|41|NZ_CP039989|CRISPRCasFinder 26557-26597 41 NZ_CP016215 Pseudomonas aeruginosa strain PA121617 plasmid pBM413, complete sequence 276757-276797 0 1.0
NZ_CP039989_1 1.1|26557|41|NZ_CP039989|CRISPRCasFinder 26557-26597 41 NZ_CP039989 Pseudomonas aeruginosa strain T2436 plasmid pBT2436, complete sequence 26557-26597 0 1.0
NZ_CP039989_1 1.1|26557|41|NZ_CP039989|CRISPRCasFinder 26557-26597 41 NZ_CP039991 Pseudomonas aeruginosa strain T2101 plasmid pBT2101, complete sequence 26715-26755 0 1.0
NZ_CP039989_1 1.1|26557|41|NZ_CP039989|CRISPRCasFinder 26557-26597 41 NZ_MN433457 Pseudomonas aeruginosa strain PAB546 plasmid pNK546-KPC, complete sequence 78857-78897 0 1.0
NZ_CP039989_1 1.1|26557|41|NZ_CP039989|CRISPRCasFinder 26557-26597 41 NZ_CP029096 Pseudomonas aeruginosa strain AR439 plasmid unnamed2, complete sequence 43163-43203 0 1.0
NZ_CP039989_1 1.1|26557|41|NZ_CP039989|CRISPRCasFinder 26557-26597 41 NZ_CP045003 Pseudomonas aeruginosa strain PAG5 plasmid pPAG5, complete sequence 352188-352228 0 1.0
NZ_CP039989_1 1.1|26557|41|NZ_CP039989|CRISPRCasFinder 26557-26597 41 NZ_CP045917 Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence 29964-30004 0 1.0
NZ_CP039989_1 1.1|26557|41|NZ_CP039989|CRISPRCasFinder 26557-26597 41 MF344571 Pseudomonas aeruginosa plasmid pR31014-IMP, complete sequence 28143-28183 0 1.0
NZ_CP039989_1 1.1|26557|41|NZ_CP039989|CRISPRCasFinder 26557-26597 41 MF344568 Pseudomonas aeruginosa plasmid p727-IMP, complete sequence 28143-28183 0 1.0
NZ_CP039989_1 1.1|26557|41|NZ_CP039989|CRISPRCasFinder 26557-26597 41 MF344569 Pseudomonas aeruginosa plasmid p12939-PER, complete sequence 27909-27949 0 1.0
NZ_CP039989_1 1.1|26557|41|NZ_CP039989|CRISPRCasFinder 26557-26597 41 MF344570 Pseudomonas aeruginosa plasmid pA681-IMP, complete sequence 29318-29358 0 1.0
NZ_CP039989_1 1.1|26557|41|NZ_CP039989|CRISPRCasFinder 26557-26597 41 NZ_CP039294 Pseudomonas aeruginosa strain PABL048 plasmid pPABL048, complete sequence 253489-253529 0 1.0
NZ_CP039989_1 1.1|26557|41|NZ_CP039989|CRISPRCasFinder 26557-26597 41 CP027478 Pseudomonas koreensis strain P19E3 plasmid p1, complete sequence 104456-104496 0 1.0
NZ_CP039989_1 1.1|26557|41|NZ_CP039989|CRISPRCasFinder 26557-26597 41 NZ_CP027170 Pseudomonas aeruginosa strain AR_0356 plasmid unnamed2, complete sequence 312300-312340 0 1.0
NZ_CP039989_1 1.1|26557|41|NZ_CP039989|CRISPRCasFinder 26557-26597 41 NZ_CP015879 Pseudomonas citronellolis strain SJTE-3 plasmid pRBL16, complete sequence 330177-330217 0 1.0
NZ_CP039989_1 1.1|26557|41|NZ_CP039989|CRISPRCasFinder 26557-26597 41 NZ_KY883660 Pseudomonas putida strain SY153 plasmid pSY153-MDR, complete sequence 29340-29380 0 1.0
NZ_CP039989_1 1.1|26557|41|NZ_CP039989|CRISPRCasFinder 26557-26597 41 NZ_KU130294 Pseudomonas putida strain 12969 plasmid p12969-DIM, complete sequence 26763-26803 1 0.976

1. spacer 1.1|26557|41|NZ_CP039989|CRISPRCasFinder matches to NZ_KY494864 (Pseudomonas aeruginosa strain FFUP_PS_37 plasmid pJB37, complete sequence) position: , mismatch: 0, identity: 1.0

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgactttcctgcggagcatccg	Protospacer
*****************************************

2. spacer 1.1|26557|41|NZ_CP039989|CRISPRCasFinder matches to NZ_LT969519 (Pseudomonas aeruginosa isolate RW109 genome assembly, plasmid: RW109 plasmid 1) position: , mismatch: 0, identity: 1.0

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgactttcctgcggagcatccg	Protospacer
*****************************************

3. spacer 1.1|26557|41|NZ_CP039989|CRISPRCasFinder matches to NZ_CP009975 (Pseudomonas putida S12 plasmid pTTS12, complete sequence) position: , mismatch: 0, identity: 1.0

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgactttcctgcggagcatccg	Protospacer
*****************************************

4. spacer 1.1|26557|41|NZ_CP039989|CRISPRCasFinder matches to NZ_CP029094 (Pseudomonas aeruginosa strain AR441 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgactttcctgcggagcatccg	Protospacer
*****************************************

5. spacer 1.1|26557|41|NZ_CP039989|CRISPRCasFinder matches to NZ_CP040126 (Pseudomonas aeruginosa strain PA298 plasmid pBM908, complete sequence) position: , mismatch: 0, identity: 1.0

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgactttcctgcggagcatccg	Protospacer
*****************************************

6. spacer 1.1|26557|41|NZ_CP039989|CRISPRCasFinder matches to NZ_CP016215 (Pseudomonas aeruginosa strain PA121617 plasmid pBM413, complete sequence) position: , mismatch: 0, identity: 1.0

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgactttcctgcggagcatccg	Protospacer
*****************************************

7. spacer 1.1|26557|41|NZ_CP039989|CRISPRCasFinder matches to NZ_CP039989 (Pseudomonas aeruginosa strain T2436 plasmid pBT2436, complete sequence) position: , mismatch: 0, identity: 1.0

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgactttcctgcggagcatccg	Protospacer
*****************************************

8. spacer 1.1|26557|41|NZ_CP039989|CRISPRCasFinder matches to NZ_CP039991 (Pseudomonas aeruginosa strain T2101 plasmid pBT2101, complete sequence) position: , mismatch: 0, identity: 1.0

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgactttcctgcggagcatccg	Protospacer
*****************************************

9. spacer 1.1|26557|41|NZ_CP039989|CRISPRCasFinder matches to NZ_MN433457 (Pseudomonas aeruginosa strain PAB546 plasmid pNK546-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgactttcctgcggagcatccg	Protospacer
*****************************************

10. spacer 1.1|26557|41|NZ_CP039989|CRISPRCasFinder matches to NZ_CP029096 (Pseudomonas aeruginosa strain AR439 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgactttcctgcggagcatccg	Protospacer
*****************************************

11. spacer 1.1|26557|41|NZ_CP039989|CRISPRCasFinder matches to NZ_CP045003 (Pseudomonas aeruginosa strain PAG5 plasmid pPAG5, complete sequence) position: , mismatch: 0, identity: 1.0

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgactttcctgcggagcatccg	Protospacer
*****************************************

12. spacer 1.1|26557|41|NZ_CP039989|CRISPRCasFinder matches to NZ_CP045917 (Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence) position: , mismatch: 0, identity: 1.0

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgactttcctgcggagcatccg	Protospacer
*****************************************

13. spacer 1.1|26557|41|NZ_CP039989|CRISPRCasFinder matches to MF344571 (Pseudomonas aeruginosa plasmid pR31014-IMP, complete sequence) position: , mismatch: 0, identity: 1.0

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgactttcctgcggagcatccg	Protospacer
*****************************************

14. spacer 1.1|26557|41|NZ_CP039989|CRISPRCasFinder matches to MF344568 (Pseudomonas aeruginosa plasmid p727-IMP, complete sequence) position: , mismatch: 0, identity: 1.0

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgactttcctgcggagcatccg	Protospacer
*****************************************

15. spacer 1.1|26557|41|NZ_CP039989|CRISPRCasFinder matches to MF344569 (Pseudomonas aeruginosa plasmid p12939-PER, complete sequence) position: , mismatch: 0, identity: 1.0

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgactttcctgcggagcatccg	Protospacer
*****************************************

16. spacer 1.1|26557|41|NZ_CP039989|CRISPRCasFinder matches to MF344570 (Pseudomonas aeruginosa plasmid pA681-IMP, complete sequence) position: , mismatch: 0, identity: 1.0

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgactttcctgcggagcatccg	Protospacer
*****************************************

17. spacer 1.1|26557|41|NZ_CP039989|CRISPRCasFinder matches to NZ_CP039294 (Pseudomonas aeruginosa strain PABL048 plasmid pPABL048, complete sequence) position: , mismatch: 0, identity: 1.0

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgactttcctgcggagcatccg	Protospacer
*****************************************

18. spacer 1.1|26557|41|NZ_CP039989|CRISPRCasFinder matches to CP027478 (Pseudomonas koreensis strain P19E3 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgactttcctgcggagcatccg	Protospacer
*****************************************

19. spacer 1.1|26557|41|NZ_CP039989|CRISPRCasFinder matches to NZ_CP027170 (Pseudomonas aeruginosa strain AR_0356 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgactttcctgcggagcatccg	Protospacer
*****************************************

20. spacer 1.1|26557|41|NZ_CP039989|CRISPRCasFinder matches to NZ_CP015879 (Pseudomonas citronellolis strain SJTE-3 plasmid pRBL16, complete sequence) position: , mismatch: 0, identity: 1.0

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgactttcctgcggagcatccg	Protospacer
*****************************************

21. spacer 1.1|26557|41|NZ_CP039989|CRISPRCasFinder matches to NZ_KY883660 (Pseudomonas putida strain SY153 plasmid pSY153-MDR, complete sequence) position: , mismatch: 0, identity: 1.0

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgactttcctgcggagcatccg	Protospacer
*****************************************

22. spacer 1.1|26557|41|NZ_CP039989|CRISPRCasFinder matches to NZ_KU130294 (Pseudomonas putida strain 12969 plasmid p12969-DIM, complete sequence) position: , mismatch: 1, identity: 0.976

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgaccttcctgcggagcatccg	Protospacer
***********************.*****************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 121154 : 128608 9 Acinetobacter_phage(33.33%) protease NA
DBSCAN-SWA_2 155105 : 202971 44 Salmonella_phage(22.22%) integrase,transposase attL 168833:168847|attR 182125:182139
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP039988
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP039988_1 3188544-3188638 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP039988_2 5991555-5991646 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 63098 : 118173 51 Shigella_phage(16.67%) plate,transposase NA
DBSCAN-SWA_2 636080 : 706305 68 uncultured_Caudovirales_phage(21.88%) tRNA,plate,tail,transposase NA
DBSCAN-SWA_3 1450070 : 1459099 8 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_4 2336949 : 2365975 40 Pseudomonas_phage(66.67%) tRNA,holin,terminase,transposase,integrase,tail attL 2337236:2337250|attR 2340581:2340595
DBSCAN-SWA_5 2604829 : 2658748 58 Pseudomonas_phage(71.7%) tRNA,integrase,terminase attL 2595838:2595854|attR 2625457:2625473
DBSCAN-SWA_6 2662773 : 2676157 8 Pseudomonas_phage(75.0%) holin NA
DBSCAN-SWA_7 3788235 : 3856810 63 Pseudomonas_phage(58.18%) tRNA,holin,terminase NA
DBSCAN-SWA_8 4725606 : 4768531 59 Pseudomonas_phage(75.51%) integrase,terminase,tail attL 4722609:4722668|attR 4767637:4767700
DBSCAN-SWA_9 4981249 : 4992569 15 Pseudomonas_phage(90.91%) integrase attL 4980706:4980732|attR 4991165:4991191
DBSCAN-SWA_10 5674965 : 5714481 34 Enterobacteria_phage(14.29%) tRNA,coat,integrase attL 5694075:5694090|attR 5718933:5718948
DBSCAN-SWA_11 5933937 : 5975120 55 Pseudomonas_phage(90.74%) capsid,head,transposase,integrase,tail attL 5943832:5943848|attR 5972667:5972683
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage