Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP046277 Salmonella enterica strain FDAARGOS_710 chromosome, complete genome 3 crisprs cas3,DEDDh,DinG,WYL,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2 0 6 8 0

Results visualization

1. NZ_CP046277
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP046277_1 4198737-4198837 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP046277_2 4556726-4556998 TypeI-E I-E
4 spacers
cas3,cas8e,cse2gr11,cas7

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP046277_3 4573120-4573575 TypeI-E I-E
7 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP046277_2 2.4|4556938|32|NZ_CP046277|CRISPRCasFinder,CRT 4556938-4556969 32 NZ_CP024424 Paracoccus yeei strain TT13 plasmid pTT13-2, complete sequence 112052-112083 5 0.844
NZ_CP046277_2 2.4|4556938|32|NZ_CP046277|CRISPRCasFinder,CRT 4556938-4556969 32 NZ_CP020440 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed2, complete sequence 224971-225002 5 0.844
NZ_CP046277_2 2.4|4556938|32|NZ_CP046277|CRISPRCasFinder,CRT 4556938-4556969 32 NZ_CP044082 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed4, complete sequence 90792-90823 5 0.844
NZ_CP046277_3 3.2|4573212|30|NZ_CP046277|PILER-CR 4573212-4573241 30 NZ_CP012477 Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence 679642-679671 5 0.833
NZ_CP046277_2 2.4|4556938|32|NZ_CP046277|CRISPRCasFinder,CRT 4556938-4556969 32 NZ_CP031080 Paracoccus yeei strain CCUG 32053 plasmid pYEE2, complete sequence 271400-271431 6 0.812
NZ_CP046277_3 3.5|4573210|32|NZ_CP046277|CRISPRCasFinder,CRT 4573210-4573241 32 NZ_CP012477 Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence 679642-679673 6 0.812
NZ_CP046277_2 2.4|4556938|32|NZ_CP046277|CRISPRCasFinder,CRT 4556938-4556969 32 NC_008826 Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence 343727-343758 7 0.781
NZ_CP046277_2 2.4|4556938|32|NZ_CP046277|CRISPRCasFinder,CRT 4556938-4556969 32 NC_009621 Sinorhizobium medicae WSM419 plasmid pSMED02, complete sequence 654402-654433 7 0.781
NZ_CP046277_3 3.2|4573212|30|NZ_CP046277|PILER-CR 4573212-4573241 30 MK765597 Tortoise microvirus 45 isolate 45_SP_116, complete genome 5398-5427 7 0.767
NZ_CP046277_3 3.2|4573212|30|NZ_CP046277|PILER-CR 4573212-4573241 30 MK765566 Tortoise microvirus 16 isolate 16_SP_72, complete genome 5398-5427 7 0.767
NZ_CP046277_3 3.8|4573393|32|NZ_CP046277|CRISPRCasFinder,CRT 4573393-4573424 32 NZ_CP037921 Hymenobacter sp. 17J36-26 plasmid unnamed1, complete sequence 150840-150871 7 0.781
NZ_CP046277_2 2.4|4556938|32|NZ_CP046277|CRISPRCasFinder,CRT 4556938-4556969 32 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 2052295-2052326 8 0.75
NZ_CP046277_3 3.5|4573210|32|NZ_CP046277|CRISPRCasFinder,CRT 4573210-4573241 32 MK765597 Tortoise microvirus 45 isolate 45_SP_116, complete genome 5398-5429 8 0.75
NZ_CP046277_3 3.5|4573210|32|NZ_CP046277|CRISPRCasFinder,CRT 4573210-4573241 32 MK765566 Tortoise microvirus 16 isolate 16_SP_72, complete genome 5398-5429 8 0.75
NZ_CP046277_3 3.9|4573454|32|NZ_CP046277|CRISPRCasFinder,CRT 4573454-4573485 32 NZ_KM406416 Bifidobacterium breve strain JCM 7017 plasmid megaplasmid pMP7017, complete sequence 52772-52803 8 0.75
NZ_CP046277_3 3.2|4573212|30|NZ_CP046277|PILER-CR 4573212-4573241 30 NZ_CP034093 Acinetobacter baumannii strain A52 plasmid pA52-1, complete sequence 108478-108507 9 0.7
NZ_CP046277_3 3.2|4573212|30|NZ_CP046277|PILER-CR 4573212-4573241 30 NZ_CP038645 Acinetobacter baumannii strain ACN21 plasmid unnamed1, complete sequence 48707-48736 9 0.7
NZ_CP046277_3 3.2|4573212|30|NZ_CP046277|PILER-CR 4573212-4573241 30 CP033517 Acinetobacter baumannii strain 2008S11-069 plasmid p2008S11-069-1, complete sequence 77863-77892 9 0.7
NZ_CP046277_3 3.2|4573212|30|NZ_CP046277|PILER-CR 4573212-4573241 30 NZ_CP016301 Acinetobacter baumannii strain CMC-CR-MDR-Ab66 plasmid pCMCVTAb1-Ab66, complete sequence 10113-10142 9 0.7
NZ_CP046277_3 3.2|4573212|30|NZ_CP046277|PILER-CR 4573212-4573241 30 NZ_CP016296 Acinetobacter baumannii strain CMC-CR-MDR-Ab4 plasmid pCMCVTAb1-Ab4, complete sequence 10113-10142 9 0.7
NZ_CP046277_3 3.2|4573212|30|NZ_CP046277|PILER-CR 4573212-4573241 30 NZ_CP016299 Acinetobacter baumannii strain CMC-MDR-Ab59 plasmid pCMCVTAb1-Ab59, complete sequence 10113-10142 9 0.7
NZ_CP046277_3 3.2|4573212|30|NZ_CP046277|PILER-CR 4573212-4573241 30 NZ_CP024125 Acinetobacter baumannii strain AYP-A2 plasmid pAYP-A2, complete sequence 48133-48162 9 0.7
NZ_CP046277_3 3.2|4573212|30|NZ_CP046277|PILER-CR 4573212-4573241 30 NZ_CP026128 Acinetobacter baumannii strain ABNIH28 plasmid pABA-1fe1, complete sequence 61932-61961 9 0.7
NZ_CP046277_3 3.2|4573212|30|NZ_CP046277|PILER-CR 4573212-4573241 30 NZ_CP020585 Acinetobacter baumannii strain CBA7 plasmid pCBA7_1, complete sequence 56900-56929 9 0.7
NZ_CP046277_3 3.2|4573212|30|NZ_CP046277|PILER-CR 4573212-4573241 30 NC_023031 Acinetobacter baumannii ZW85-1 plasmid ZW85p2, complete sequence 70372-70401 9 0.7
NZ_CP046277_3 3.2|4573212|30|NZ_CP046277|PILER-CR 4573212-4573241 30 NZ_MK386680 Acinetobacter baumannii strain ABAY04001 plasmid pABAY04001_1A, complete sequence 96499-96528 9 0.7
NZ_CP046277_3 3.2|4573212|30|NZ_CP046277|PILER-CR 4573212-4573241 30 NZ_CP018257 Acinetobacter baumannii strain AF-673 plasmid pAF-673, complete sequence 73224-73253 9 0.7
NZ_CP046277_3 3.2|4573212|30|NZ_CP046277|PILER-CR 4573212-4573241 30 NZ_CP010780 Acinetobacter baumannii strain XH386 plasmid pAB386, complete sequence 17801-17830 9 0.7
NZ_CP046277_3 3.2|4573212|30|NZ_CP046277|PILER-CR 4573212-4573241 30 MK765665 Tortoise microvirus 108 isolate 108_SP_3, complete genome 5472-5501 9 0.7
NZ_CP046277_3 3.2|4573212|30|NZ_CP046277|PILER-CR 4573212-4573241 30 NZ_CP039519 Acinetobacter baumannii strain TG22653 plasmid pTG22653, complete sequence 31340-31369 9 0.7
NZ_CP046277_3 3.2|4573212|30|NZ_CP046277|PILER-CR 4573212-4573241 30 NZ_CP033864 Acinetobacter sp. FDAARGOS_560 plasmid unnamed2 54149-54178 9 0.7
NZ_CP046277_3 3.2|4573212|30|NZ_CP046277|PILER-CR 4573212-4573241 30 NZ_CP010398 Acinetobacter baumannii strain 6200 plasmid p6200-114.848kb, complete sequence 33513-33542 9 0.7
NZ_CP046277_3 3.2|4573212|30|NZ_CP046277|PILER-CR 4573212-4573241 30 NZ_CP015484 Acinetobacter baumannii strain ORAB01 plasmid pORAB01-1, complete sequence 39457-39486 9 0.7
NZ_CP046277_3 3.2|4573212|30|NZ_CP046277|PILER-CR 4573212-4573241 30 NZ_CP018333 Acinetobacter baumannii strain A1296 isolate A1296 plasmid pA1296_1, complete sequence 100884-100913 9 0.7
NZ_CP046277_3 3.2|4573212|30|NZ_CP046277|PILER-CR 4573212-4573241 30 CP031744 Acinetobacter baumannii WM99c plasmid pWM99c-2, complete sequence 39457-39486 9 0.7
NZ_CP046277_3 3.2|4573212|30|NZ_CP046277|PILER-CR 4573212-4573241 30 NZ_CP050905 Acinetobacter baumannii strain DT-Ab057 plasmid unnamed1, complete sequence 45351-45380 9 0.7
NZ_CP046277_3 3.2|4573212|30|NZ_CP046277|PILER-CR 4573212-4573241 30 NC_020524 Acinetobacter baumannii MDR-TJ plasmid pABTJ2, complete sequence 39457-39486 9 0.7
NZ_CP046277_3 3.2|4573212|30|NZ_CP046277|PILER-CR 4573212-4573241 30 NZ_CP021327 Acinetobacter baumannii strain XH386 plasmid pXH386, complete sequence 102930-102959 9 0.7
NZ_CP046277_3 3.5|4573210|32|NZ_CP046277|CRISPRCasFinder,CRT 4573210-4573241 32 NC_021709 Alteromonas mediterranea 615 plasmid unnamed, complete sequence 120488-120519 9 0.719
NZ_CP046277_3 3.5|4573210|32|NZ_CP046277|CRISPRCasFinder,CRT 4573210-4573241 32 MK765665 Tortoise microvirus 108 isolate 108_SP_3, complete genome 5472-5503 10 0.688
NZ_CP046277_3 3.10|4573515|32|NZ_CP046277|CRISPRCasFinder,CRT 4573515-4573546 32 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1151729-1151760 10 0.688
NZ_CP046277_3 3.10|4573515|32|NZ_CP046277|CRISPRCasFinder,CRT 4573515-4573546 32 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 661429-661460 10 0.688
NZ_CP046277_3 3.5|4573210|32|NZ_CP046277|CRISPRCasFinder,CRT 4573210-4573241 32 NZ_CP034093 Acinetobacter baumannii strain A52 plasmid pA52-1, complete sequence 108478-108509 11 0.656
NZ_CP046277_3 3.5|4573210|32|NZ_CP046277|CRISPRCasFinder,CRT 4573210-4573241 32 NZ_CP038645 Acinetobacter baumannii strain ACN21 plasmid unnamed1, complete sequence 48707-48738 11 0.656
NZ_CP046277_3 3.5|4573210|32|NZ_CP046277|CRISPRCasFinder,CRT 4573210-4573241 32 NZ_CP039519 Acinetobacter baumannii strain TG22653 plasmid pTG22653, complete sequence 31338-31369 11 0.656
NZ_CP046277_3 3.5|4573210|32|NZ_CP046277|CRISPRCasFinder,CRT 4573210-4573241 32 CP033517 Acinetobacter baumannii strain 2008S11-069 plasmid p2008S11-069-1, complete sequence 77863-77894 11 0.656
NZ_CP046277_3 3.5|4573210|32|NZ_CP046277|CRISPRCasFinder,CRT 4573210-4573241 32 NZ_CP016301 Acinetobacter baumannii strain CMC-CR-MDR-Ab66 plasmid pCMCVTAb1-Ab66, complete sequence 10113-10144 11 0.656
NZ_CP046277_3 3.5|4573210|32|NZ_CP046277|CRISPRCasFinder,CRT 4573210-4573241 32 NZ_CP016296 Acinetobacter baumannii strain CMC-CR-MDR-Ab4 plasmid pCMCVTAb1-Ab4, complete sequence 10113-10144 11 0.656
NZ_CP046277_3 3.5|4573210|32|NZ_CP046277|CRISPRCasFinder,CRT 4573210-4573241 32 NZ_CP016299 Acinetobacter baumannii strain CMC-MDR-Ab59 plasmid pCMCVTAb1-Ab59, complete sequence 10113-10144 11 0.656
NZ_CP046277_3 3.5|4573210|32|NZ_CP046277|CRISPRCasFinder,CRT 4573210-4573241 32 NZ_CP024125 Acinetobacter baumannii strain AYP-A2 plasmid pAYP-A2, complete sequence 48133-48164 11 0.656
NZ_CP046277_3 3.5|4573210|32|NZ_CP046277|CRISPRCasFinder,CRT 4573210-4573241 32 NZ_CP026128 Acinetobacter baumannii strain ABNIH28 plasmid pABA-1fe1, complete sequence 61932-61963 11 0.656
NZ_CP046277_3 3.5|4573210|32|NZ_CP046277|CRISPRCasFinder,CRT 4573210-4573241 32 NZ_CP033864 Acinetobacter sp. FDAARGOS_560 plasmid unnamed2 54147-54178 11 0.656
NZ_CP046277_3 3.5|4573210|32|NZ_CP046277|CRISPRCasFinder,CRT 4573210-4573241 32 NZ_CP010398 Acinetobacter baumannii strain 6200 plasmid p6200-114.848kb, complete sequence 33511-33542 11 0.656
NZ_CP046277_3 3.5|4573210|32|NZ_CP046277|CRISPRCasFinder,CRT 4573210-4573241 32 NZ_CP015484 Acinetobacter baumannii strain ORAB01 plasmid pORAB01-1, complete sequence 39455-39486 11 0.656
NZ_CP046277_3 3.5|4573210|32|NZ_CP046277|CRISPRCasFinder,CRT 4573210-4573241 32 NZ_CP018333 Acinetobacter baumannii strain A1296 isolate A1296 plasmid pA1296_1, complete sequence 100882-100913 11 0.656
NZ_CP046277_3 3.5|4573210|32|NZ_CP046277|CRISPRCasFinder,CRT 4573210-4573241 32 NZ_CP020585 Acinetobacter baumannii strain CBA7 plasmid pCBA7_1, complete sequence 56900-56931 11 0.656
NZ_CP046277_3 3.5|4573210|32|NZ_CP046277|CRISPRCasFinder,CRT 4573210-4573241 32 NC_023031 Acinetobacter baumannii ZW85-1 plasmid ZW85p2, complete sequence 70372-70403 11 0.656
NZ_CP046277_3 3.5|4573210|32|NZ_CP046277|CRISPRCasFinder,CRT 4573210-4573241 32 CP031744 Acinetobacter baumannii WM99c plasmid pWM99c-2, complete sequence 39455-39486 11 0.656
NZ_CP046277_3 3.5|4573210|32|NZ_CP046277|CRISPRCasFinder,CRT 4573210-4573241 32 NZ_CP050905 Acinetobacter baumannii strain DT-Ab057 plasmid unnamed1, complete sequence 45349-45380 11 0.656
NZ_CP046277_3 3.5|4573210|32|NZ_CP046277|CRISPRCasFinder,CRT 4573210-4573241 32 NC_020524 Acinetobacter baumannii MDR-TJ plasmid pABTJ2, complete sequence 39455-39486 11 0.656
NZ_CP046277_3 3.5|4573210|32|NZ_CP046277|CRISPRCasFinder,CRT 4573210-4573241 32 NZ_CP021327 Acinetobacter baumannii strain XH386 plasmid pXH386, complete sequence 102928-102959 11 0.656
NZ_CP046277_3 3.5|4573210|32|NZ_CP046277|CRISPRCasFinder,CRT 4573210-4573241 32 NZ_MK386680 Acinetobacter baumannii strain ABAY04001 plasmid pABAY04001_1A, complete sequence 96499-96530 11 0.656
NZ_CP046277_3 3.5|4573210|32|NZ_CP046277|CRISPRCasFinder,CRT 4573210-4573241 32 NZ_CP018257 Acinetobacter baumannii strain AF-673 plasmid pAF-673, complete sequence 73224-73255 11 0.656
NZ_CP046277_3 3.5|4573210|32|NZ_CP046277|CRISPRCasFinder,CRT 4573210-4573241 32 NZ_CP010780 Acinetobacter baumannii strain XH386 plasmid pAB386, complete sequence 17801-17832 11 0.656

1. spacer 2.4|4556938|32|NZ_CP046277|CRISPRCasFinder,CRT matches to NZ_CP024424 (Paracoccus yeei strain TT13 plasmid pTT13-2, complete sequence) position: , mismatch: 5, identity: 0.844

gggatcgcgctggcggtcgcatccgttgccgt-	CRISPR spacer
gagatcgcgctggcggcctcatccg-tgccgca	Protospacer
*.**************.* ****** *****. 

2. spacer 2.4|4556938|32|NZ_CP046277|CRISPRCasFinder,CRT matches to NZ_CP020440 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.844

gggatcgcgctggcggtcgcatccgttgccgt-	CRISPR spacer
gagatcgcgctggcggcctcatccg-tgccgca	Protospacer
*.**************.* ****** *****. 

3. spacer 2.4|4556938|32|NZ_CP046277|CRISPRCasFinder,CRT matches to NZ_CP044082 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.844

gggatcgcgctggcggtcgcatccgttgccgt-	CRISPR spacer
gagatcgcgctggcggcctcatccg-tgccgca	Protospacer
*.**************.* ****** *****. 

4. spacer 3.2|4573212|30|NZ_CP046277|PILER-CR matches to NZ_CP012477 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.833

--gccgatatggctaaaacggcgcttgagaac	CRISPR spacer
gagtcg--atggctgaaacggcgcgtgagaac	Protospacer
  *.**  ******.********* *******

5. spacer 2.4|4556938|32|NZ_CP046277|CRISPRCasFinder,CRT matches to NZ_CP031080 (Paracoccus yeei strain CCUG 32053 plasmid pYEE2, complete sequence) position: , mismatch: 6, identity: 0.812

gggatcgcgctggcggtcgcatccgttgccgt-	CRISPR spacer
cagatcgcgctggcggcctcatccg-tgccgca	Protospacer
 .**************.* ****** *****. 

6. spacer 3.5|4573210|32|NZ_CP046277|CRISPRCasFinder,CRT matches to NZ_CP012477 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812

--gccgatatggctaaaacggcgcttgagaacag	CRISPR spacer
gagtcg--atggctgaaacggcgcgtgagaacgg	Protospacer
  *.**  ******.********* *******.*

7. spacer 2.4|4556938|32|NZ_CP046277|CRISPRCasFinder,CRT matches to NC_008826 (Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence) position: , mismatch: 7, identity: 0.781

gggatcgcgctggcggtcgcatccgttgccgt-	CRISPR spacer
gggatcgcggtggcggtcgc-ttcgaggaagtt	Protospacer
********* ********** *.**  *  ** 

8. spacer 2.4|4556938|32|NZ_CP046277|CRISPRCasFinder,CRT matches to NC_009621 (Sinorhizobium medicae WSM419 plasmid pSMED02, complete sequence) position: , mismatch: 7, identity: 0.781

gggatcgcgctggcggtcgcatccgttgccgt-	CRISPR spacer
cggctcgcgctggcggtcgcttcc-tcggcgcg	Protospacer
 ** **************** *** *.* **. 

9. spacer 3.2|4573212|30|NZ_CP046277|PILER-CR matches to MK765597 (Tortoise microvirus 45 isolate 45_SP_116, complete genome) position: , mismatch: 7, identity: 0.767

gccgatatggctaaaacggcgcttgagaac	CRISPR spacer
gataatttggctaaatcggcgcttgagcgc	Protospacer
* ..** ******** *********** .*

10. spacer 3.2|4573212|30|NZ_CP046277|PILER-CR matches to MK765566 (Tortoise microvirus 16 isolate 16_SP_72, complete genome) position: , mismatch: 7, identity: 0.767

gccgatatggctaaaacggcgcttgagaac	CRISPR spacer
gataatttggctaaatcggcgcttgagcgc	Protospacer
* ..** ******** *********** .*

11. spacer 3.8|4573393|32|NZ_CP046277|CRISPRCasFinder,CRT matches to NZ_CP037921 (Hymenobacter sp. 17J36-26 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

atgggcggaggcttaattggcggc--gctgccgg	CRISPR spacer
atgggcggaggcttgattcgcggcaaactgtt--	Protospacer
**************.*** *****  .***..  

12. spacer 2.4|4556938|32|NZ_CP046277|CRISPRCasFinder,CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 8, identity: 0.75

gggatcgcgctggcggtcgcatccgttgccgt	CRISPR spacer
cggctcgcgctcgcggtcgcatcctcggcccg	Protospacer
 ** ******* ************ . ***  

13. spacer 3.5|4573210|32|NZ_CP046277|CRISPRCasFinder,CRT matches to MK765597 (Tortoise microvirus 45 isolate 45_SP_116, complete genome) position: , mismatch: 8, identity: 0.75

gccgatatggctaaaacggcgcttgagaacag	CRISPR spacer
gataatttggctaaatcggcgcttgagcgctg	Protospacer
* ..** ******** *********** .* *

14. spacer 3.5|4573210|32|NZ_CP046277|CRISPRCasFinder,CRT matches to MK765566 (Tortoise microvirus 16 isolate 16_SP_72, complete genome) position: , mismatch: 8, identity: 0.75

gccgatatggctaaaacggcgcttgagaacag	CRISPR spacer
gataatttggctaaatcggcgcttgagcgctg	Protospacer
* ..** ******** *********** .* *

15. spacer 3.9|4573454|32|NZ_CP046277|CRISPRCasFinder,CRT matches to NZ_KM406416 (Bifidobacterium breve strain JCM 7017 plasmid megaplasmid pMP7017, complete sequence) position: , mismatch: 8, identity: 0.75

cagacgtagagattgagaacacaaatgactca	CRISPR spacer
cagacgtagagattgaaaaaacagaatgcaaa	Protospacer
****************.** ***.*  .*  *

16. spacer 3.2|4573212|30|NZ_CP046277|PILER-CR matches to NZ_CP034093 (Acinetobacter baumannii strain A52 plasmid pA52-1, complete sequence) position: , mismatch: 9, identity: 0.7

gccgatatggctaaaacggcgcttgagaac	CRISPR spacer
ctggatatggcacaaacggcgcttgaattt	Protospacer
 . ********  *************.  .

17. spacer 3.2|4573212|30|NZ_CP046277|PILER-CR matches to NZ_CP038645 (Acinetobacter baumannii strain ACN21 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7

gccgatatggctaaaacggcgcttgagaac	CRISPR spacer
ctggatatggcacaaacggcgcttgaattt	Protospacer
 . ********  *************.  .

18. spacer 3.2|4573212|30|NZ_CP046277|PILER-CR matches to CP033517 (Acinetobacter baumannii strain 2008S11-069 plasmid p2008S11-069-1, complete sequence) position: , mismatch: 9, identity: 0.7

gccgatatggctaaaacggcgcttgagaac	CRISPR spacer
ctggatatggcacaaacggcgcttgaattt	Protospacer
 . ********  *************.  .

19. spacer 3.2|4573212|30|NZ_CP046277|PILER-CR matches to NZ_CP016301 (Acinetobacter baumannii strain CMC-CR-MDR-Ab66 plasmid pCMCVTAb1-Ab66, complete sequence) position: , mismatch: 9, identity: 0.7

gccgatatggctaaaacggcgcttgagaac	CRISPR spacer
ctggatatggcacaaacggcgcttgaattt	Protospacer
 . ********  *************.  .

20. spacer 3.2|4573212|30|NZ_CP046277|PILER-CR matches to NZ_CP016296 (Acinetobacter baumannii strain CMC-CR-MDR-Ab4 plasmid pCMCVTAb1-Ab4, complete sequence) position: , mismatch: 9, identity: 0.7

gccgatatggctaaaacggcgcttgagaac	CRISPR spacer
ctggatatggcacaaacggcgcttgaattt	Protospacer
 . ********  *************.  .

21. spacer 3.2|4573212|30|NZ_CP046277|PILER-CR matches to NZ_CP016299 (Acinetobacter baumannii strain CMC-MDR-Ab59 plasmid pCMCVTAb1-Ab59, complete sequence) position: , mismatch: 9, identity: 0.7

gccgatatggctaaaacggcgcttgagaac	CRISPR spacer
ctggatatggcacaaacggcgcttgaattt	Protospacer
 . ********  *************.  .

22. spacer 3.2|4573212|30|NZ_CP046277|PILER-CR matches to NZ_CP024125 (Acinetobacter baumannii strain AYP-A2 plasmid pAYP-A2, complete sequence) position: , mismatch: 9, identity: 0.7

gccgatatggctaaaacggcgcttgagaac	CRISPR spacer
ctggatatggcacaaacggcgcttgaattt	Protospacer
 . ********  *************.  .

23. spacer 3.2|4573212|30|NZ_CP046277|PILER-CR matches to NZ_CP026128 (Acinetobacter baumannii strain ABNIH28 plasmid pABA-1fe1, complete sequence) position: , mismatch: 9, identity: 0.7

gccgatatggctaaaacggcgcttgagaac	CRISPR spacer
ctggatatggcacaaacggcgcttgaattt	Protospacer
 . ********  *************.  .

24. spacer 3.2|4573212|30|NZ_CP046277|PILER-CR matches to NZ_CP020585 (Acinetobacter baumannii strain CBA7 plasmid pCBA7_1, complete sequence) position: , mismatch: 9, identity: 0.7

gccgatatggctaaaacggcgcttgagaac	CRISPR spacer
ctggatatggcacaaacggcgcttgaattt	Protospacer
 . ********  *************.  .

25. spacer 3.2|4573212|30|NZ_CP046277|PILER-CR matches to NC_023031 (Acinetobacter baumannii ZW85-1 plasmid ZW85p2, complete sequence) position: , mismatch: 9, identity: 0.7

gccgatatggctaaaacggcgcttgagaac	CRISPR spacer
ctggatatggcacaaacggcgcttgaattt	Protospacer
 . ********  *************.  .

26. spacer 3.2|4573212|30|NZ_CP046277|PILER-CR matches to NZ_MK386680 (Acinetobacter baumannii strain ABAY04001 plasmid pABAY04001_1A, complete sequence) position: , mismatch: 9, identity: 0.7

gccgatatggctaaaacggcgcttgagaac	CRISPR spacer
ctggatatggcacaaacggcgcttgaattt	Protospacer
 . ********  *************.  .

27. spacer 3.2|4573212|30|NZ_CP046277|PILER-CR matches to NZ_CP018257 (Acinetobacter baumannii strain AF-673 plasmid pAF-673, complete sequence) position: , mismatch: 9, identity: 0.7

gccgatatggctaaaacggcgcttgagaac	CRISPR spacer
ctggatatggcacaaacggcgcttgaattt	Protospacer
 . ********  *************.  .

28. spacer 3.2|4573212|30|NZ_CP046277|PILER-CR matches to NZ_CP010780 (Acinetobacter baumannii strain XH386 plasmid pAB386, complete sequence) position: , mismatch: 9, identity: 0.7

gccgatatggctaaaacggcgcttgagaac	CRISPR spacer
ctggatatggcacaaacggcgcttgaattt	Protospacer
 . ********  *************.  .

29. spacer 3.2|4573212|30|NZ_CP046277|PILER-CR matches to MK765665 (Tortoise microvirus 108 isolate 108_SP_3, complete genome) position: , mismatch: 9, identity: 0.7

gccgatatggctaaaacggcgcttgagaac	CRISPR spacer
aataatttggctaaatcggcgcttgagcgt	Protospacer
. ..** ******** *********** ..

30. spacer 3.2|4573212|30|NZ_CP046277|PILER-CR matches to NZ_CP039519 (Acinetobacter baumannii strain TG22653 plasmid pTG22653, complete sequence) position: , mismatch: 9, identity: 0.7

gccgatatggctaaaacggcgcttgagaac	CRISPR spacer
ctggatatggcacaaacggcgcttgaattt	Protospacer
 . ********  *************.  .

31. spacer 3.2|4573212|30|NZ_CP046277|PILER-CR matches to NZ_CP033864 (Acinetobacter sp. FDAARGOS_560 plasmid unnamed2) position: , mismatch: 9, identity: 0.7

gccgatatggctaaaacggcgcttgagaac	CRISPR spacer
ctggatatggcacaaacggcgcttgaattt	Protospacer
 . ********  *************.  .

32. spacer 3.2|4573212|30|NZ_CP046277|PILER-CR matches to NZ_CP010398 (Acinetobacter baumannii strain 6200 plasmid p6200-114.848kb, complete sequence) position: , mismatch: 9, identity: 0.7

gccgatatggctaaaacggcgcttgagaac	CRISPR spacer
ctggatatggcacaaacggcgcttgaattt	Protospacer
 . ********  *************.  .

33. spacer 3.2|4573212|30|NZ_CP046277|PILER-CR matches to NZ_CP015484 (Acinetobacter baumannii strain ORAB01 plasmid pORAB01-1, complete sequence) position: , mismatch: 9, identity: 0.7

gccgatatggctaaaacggcgcttgagaac	CRISPR spacer
ctggatatggcacaaacggcgcttgaattt	Protospacer
 . ********  *************.  .

34. spacer 3.2|4573212|30|NZ_CP046277|PILER-CR matches to NZ_CP018333 (Acinetobacter baumannii strain A1296 isolate A1296 plasmid pA1296_1, complete sequence) position: , mismatch: 9, identity: 0.7

gccgatatggctaaaacggcgcttgagaac	CRISPR spacer
ctggatatggcacaaacggcgcttgaattt	Protospacer
 . ********  *************.  .

35. spacer 3.2|4573212|30|NZ_CP046277|PILER-CR matches to CP031744 (Acinetobacter baumannii WM99c plasmid pWM99c-2, complete sequence) position: , mismatch: 9, identity: 0.7

gccgatatggctaaaacggcgcttgagaac	CRISPR spacer
ctggatatggcacaaacggcgcttgaattt	Protospacer
 . ********  *************.  .

36. spacer 3.2|4573212|30|NZ_CP046277|PILER-CR matches to NZ_CP050905 (Acinetobacter baumannii strain DT-Ab057 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7

gccgatatggctaaaacggcgcttgagaac	CRISPR spacer
ctggatatggcacaaacggcgcttgaattt	Protospacer
 . ********  *************.  .

37. spacer 3.2|4573212|30|NZ_CP046277|PILER-CR matches to NC_020524 (Acinetobacter baumannii MDR-TJ plasmid pABTJ2, complete sequence) position: , mismatch: 9, identity: 0.7

gccgatatggctaaaacggcgcttgagaac	CRISPR spacer
ctggatatggcacaaacggcgcttgaattt	Protospacer
 . ********  *************.  .

38. spacer 3.2|4573212|30|NZ_CP046277|PILER-CR matches to NZ_CP021327 (Acinetobacter baumannii strain XH386 plasmid pXH386, complete sequence) position: , mismatch: 9, identity: 0.7

gccgatatggctaaaacggcgcttgagaac	CRISPR spacer
ctggatatggcacaaacggcgcttgaattt	Protospacer
 . ********  *************.  .

39. spacer 3.5|4573210|32|NZ_CP046277|CRISPRCasFinder,CRT matches to NC_021709 (Alteromonas mediterranea 615 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

gccgatatggctaaaacggcgcttgagaacag	CRISPR spacer
agtgaagctgctaaaaaggcgattgagaacag	Protospacer
. .** .. ******* **** **********

40. spacer 3.5|4573210|32|NZ_CP046277|CRISPRCasFinder,CRT matches to MK765665 (Tortoise microvirus 108 isolate 108_SP_3, complete genome) position: , mismatch: 10, identity: 0.688

gccgatatggctaaaacggcgcttgagaacag	CRISPR spacer
aataatttggctaaatcggcgcttgagcgttg	Protospacer
. ..** ******** *********** .. *

41. spacer 3.10|4573515|32|NZ_CP046277|CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 10, identity: 0.688

aggggcgttccgcagtcgacaagggctgaaaa	CRISPR spacer
ccgggcggtccgcagtcgacgagggtgaggga	Protospacer
  ***** ************.****. ....*

42. spacer 3.10|4573515|32|NZ_CP046277|CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 10, identity: 0.688

aggggcgttccgcagtcgacaagggctgaaaa	CRISPR spacer
ccgggcggtccgcagtcgacgagggtgaggga	Protospacer
  ***** ************.****. ....*

43. spacer 3.5|4573210|32|NZ_CP046277|CRISPRCasFinder,CRT matches to NZ_CP034093 (Acinetobacter baumannii strain A52 plasmid pA52-1, complete sequence) position: , mismatch: 11, identity: 0.656

gccgatatggctaaaacggcgcttgagaacag	CRISPR spacer
ctggatatggcacaaacggcgcttgaatttgt	Protospacer
 . ********  *************.  .. 

44. spacer 3.5|4573210|32|NZ_CP046277|CRISPRCasFinder,CRT matches to NZ_CP038645 (Acinetobacter baumannii strain ACN21 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.656

gccgatatggctaaaacggcgcttgagaacag	CRISPR spacer
ctggatatggcacaaacggcgcttgaatttgt	Protospacer
 . ********  *************.  .. 

45. spacer 3.5|4573210|32|NZ_CP046277|CRISPRCasFinder,CRT matches to NZ_CP039519 (Acinetobacter baumannii strain TG22653 plasmid pTG22653, complete sequence) position: , mismatch: 11, identity: 0.656

gccgatatggctaaaacggcgcttgagaacag	CRISPR spacer
ctggatatggcacaaacggcgcttgaatttgt	Protospacer
 . ********  *************.  .. 

46. spacer 3.5|4573210|32|NZ_CP046277|CRISPRCasFinder,CRT matches to CP033517 (Acinetobacter baumannii strain 2008S11-069 plasmid p2008S11-069-1, complete sequence) position: , mismatch: 11, identity: 0.656

gccgatatggctaaaacggcgcttgagaacag	CRISPR spacer
ctggatatggcacaaacggcgcttgaatttgt	Protospacer
 . ********  *************.  .. 

47. spacer 3.5|4573210|32|NZ_CP046277|CRISPRCasFinder,CRT matches to NZ_CP016301 (Acinetobacter baumannii strain CMC-CR-MDR-Ab66 plasmid pCMCVTAb1-Ab66, complete sequence) position: , mismatch: 11, identity: 0.656

gccgatatggctaaaacggcgcttgagaacag	CRISPR spacer
ctggatatggcacaaacggcgcttgaatttgt	Protospacer
 . ********  *************.  .. 

48. spacer 3.5|4573210|32|NZ_CP046277|CRISPRCasFinder,CRT matches to NZ_CP016296 (Acinetobacter baumannii strain CMC-CR-MDR-Ab4 plasmid pCMCVTAb1-Ab4, complete sequence) position: , mismatch: 11, identity: 0.656

gccgatatggctaaaacggcgcttgagaacag	CRISPR spacer
ctggatatggcacaaacggcgcttgaatttgt	Protospacer
 . ********  *************.  .. 

49. spacer 3.5|4573210|32|NZ_CP046277|CRISPRCasFinder,CRT matches to NZ_CP016299 (Acinetobacter baumannii strain CMC-MDR-Ab59 plasmid pCMCVTAb1-Ab59, complete sequence) position: , mismatch: 11, identity: 0.656

gccgatatggctaaaacggcgcttgagaacag	CRISPR spacer
ctggatatggcacaaacggcgcttgaatttgt	Protospacer
 . ********  *************.  .. 

50. spacer 3.5|4573210|32|NZ_CP046277|CRISPRCasFinder,CRT matches to NZ_CP024125 (Acinetobacter baumannii strain AYP-A2 plasmid pAYP-A2, complete sequence) position: , mismatch: 11, identity: 0.656

gccgatatggctaaaacggcgcttgagaacag	CRISPR spacer
ctggatatggcacaaacggcgcttgaatttgt	Protospacer
 . ********  *************.  .. 

51. spacer 3.5|4573210|32|NZ_CP046277|CRISPRCasFinder,CRT matches to NZ_CP026128 (Acinetobacter baumannii strain ABNIH28 plasmid pABA-1fe1, complete sequence) position: , mismatch: 11, identity: 0.656

gccgatatggctaaaacggcgcttgagaacag	CRISPR spacer
ctggatatggcacaaacggcgcttgaatttgt	Protospacer
 . ********  *************.  .. 

52. spacer 3.5|4573210|32|NZ_CP046277|CRISPRCasFinder,CRT matches to NZ_CP033864 (Acinetobacter sp. FDAARGOS_560 plasmid unnamed2) position: , mismatch: 11, identity: 0.656

gccgatatggctaaaacggcgcttgagaacag	CRISPR spacer
ctggatatggcacaaacggcgcttgaatttgt	Protospacer
 . ********  *************.  .. 

53. spacer 3.5|4573210|32|NZ_CP046277|CRISPRCasFinder,CRT matches to NZ_CP010398 (Acinetobacter baumannii strain 6200 plasmid p6200-114.848kb, complete sequence) position: , mismatch: 11, identity: 0.656

gccgatatggctaaaacggcgcttgagaacag	CRISPR spacer
ctggatatggcacaaacggcgcttgaatttgt	Protospacer
 . ********  *************.  .. 

54. spacer 3.5|4573210|32|NZ_CP046277|CRISPRCasFinder,CRT matches to NZ_CP015484 (Acinetobacter baumannii strain ORAB01 plasmid pORAB01-1, complete sequence) position: , mismatch: 11, identity: 0.656

gccgatatggctaaaacggcgcttgagaacag	CRISPR spacer
ctggatatggcacaaacggcgcttgaatttgt	Protospacer
 . ********  *************.  .. 

55. spacer 3.5|4573210|32|NZ_CP046277|CRISPRCasFinder,CRT matches to NZ_CP018333 (Acinetobacter baumannii strain A1296 isolate A1296 plasmid pA1296_1, complete sequence) position: , mismatch: 11, identity: 0.656

gccgatatggctaaaacggcgcttgagaacag	CRISPR spacer
ctggatatggcacaaacggcgcttgaatttgt	Protospacer
 . ********  *************.  .. 

56. spacer 3.5|4573210|32|NZ_CP046277|CRISPRCasFinder,CRT matches to NZ_CP020585 (Acinetobacter baumannii strain CBA7 plasmid pCBA7_1, complete sequence) position: , mismatch: 11, identity: 0.656

gccgatatggctaaaacggcgcttgagaacag	CRISPR spacer
ctggatatggcacaaacggcgcttgaatttgt	Protospacer
 . ********  *************.  .. 

57. spacer 3.5|4573210|32|NZ_CP046277|CRISPRCasFinder,CRT matches to NC_023031 (Acinetobacter baumannii ZW85-1 plasmid ZW85p2, complete sequence) position: , mismatch: 11, identity: 0.656

gccgatatggctaaaacggcgcttgagaacag	CRISPR spacer
ctggatatggcacaaacggcgcttgaatttgt	Protospacer
 . ********  *************.  .. 

58. spacer 3.5|4573210|32|NZ_CP046277|CRISPRCasFinder,CRT matches to CP031744 (Acinetobacter baumannii WM99c plasmid pWM99c-2, complete sequence) position: , mismatch: 11, identity: 0.656

gccgatatggctaaaacggcgcttgagaacag	CRISPR spacer
ctggatatggcacaaacggcgcttgaatttgt	Protospacer
 . ********  *************.  .. 

59. spacer 3.5|4573210|32|NZ_CP046277|CRISPRCasFinder,CRT matches to NZ_CP050905 (Acinetobacter baumannii strain DT-Ab057 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.656

gccgatatggctaaaacggcgcttgagaacag	CRISPR spacer
ctggatatggcacaaacggcgcttgaatttgt	Protospacer
 . ********  *************.  .. 

60. spacer 3.5|4573210|32|NZ_CP046277|CRISPRCasFinder,CRT matches to NC_020524 (Acinetobacter baumannii MDR-TJ plasmid pABTJ2, complete sequence) position: , mismatch: 11, identity: 0.656

gccgatatggctaaaacggcgcttgagaacag	CRISPR spacer
ctggatatggcacaaacggcgcttgaatttgt	Protospacer
 . ********  *************.  .. 

61. spacer 3.5|4573210|32|NZ_CP046277|CRISPRCasFinder,CRT matches to NZ_CP021327 (Acinetobacter baumannii strain XH386 plasmid pXH386, complete sequence) position: , mismatch: 11, identity: 0.656

gccgatatggctaaaacggcgcttgagaacag	CRISPR spacer
ctggatatggcacaaacggcgcttgaatttgt	Protospacer
 . ********  *************.  .. 

62. spacer 3.5|4573210|32|NZ_CP046277|CRISPRCasFinder,CRT matches to NZ_MK386680 (Acinetobacter baumannii strain ABAY04001 plasmid pABAY04001_1A, complete sequence) position: , mismatch: 11, identity: 0.656

gccgatatggctaaaacggcgcttgagaacag	CRISPR spacer
ctggatatggcacaaacggcgcttgaatttgt	Protospacer
 . ********  *************.  .. 

63. spacer 3.5|4573210|32|NZ_CP046277|CRISPRCasFinder,CRT matches to NZ_CP018257 (Acinetobacter baumannii strain AF-673 plasmid pAF-673, complete sequence) position: , mismatch: 11, identity: 0.656

gccgatatggctaaaacggcgcttgagaacag	CRISPR spacer
ctggatatggcacaaacggcgcttgaatttgt	Protospacer
 . ********  *************.  .. 

64. spacer 3.5|4573210|32|NZ_CP046277|CRISPRCasFinder,CRT matches to NZ_CP010780 (Acinetobacter baumannii strain XH386 plasmid pAB386, complete sequence) position: , mismatch: 11, identity: 0.656

gccgatatggctaaaacggcgcttgagaacag	CRISPR spacer
ctggatatggcacaaacggcgcttgaatttgt	Protospacer
 . ********  *************.  .. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 125523 : 135321 12 Enterobacteria_phage(87.5%) integrase attL 131194:131209|attR 137936:137951
DBSCAN-SWA_2 652822 : 661993 10 Enterobacteria_phage(71.43%) tRNA NA
DBSCAN-SWA_3 729220 : 735517 6 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_4 819095 : 826329 8 Morganella_phage(33.33%) NA NA
DBSCAN-SWA_5 1110963 : 1117707 10 Salmonella_phage(28.57%) NA NA
DBSCAN-SWA_6 1154548 : 1162277 6 Diachasmimorpha_longicaudata_entomopoxvirus(20.0%) tRNA,transposase NA
DBSCAN-SWA_7 1553117 : 1641976 107 Enterobacteria_phage(30.77%) integrase,tail,holin,head,tRNA,terminase,capsid,portal attL 1588640:1588654|attR 1637878:1637892
DBSCAN-SWA_8 3309881 : 3404143 94 Salmonella_phage(54.76%) integrase,protease,tail,holin,head,tRNA,lysis,terminase,capsid,plate,portal attL 3369072:3369118|attR 3399518:3399564
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage