Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP046294 Yersinia intermedia strain FDAARGOS_729 chromosome, complete genome 2 crisprs cas3,WYL,csa3,DinG,DEDDh 0 2 6 0

Results visualization

1. NZ_CP046294
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP046294_1 1668740-1668844 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP046294_2 4819150-4819300 Orphan I-F
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP046294_2 2.4|4819242|29|NZ_CP046294|PILER-CR 4819242-4819270 29 NZ_CP011016 Campylobacter coli strain FB1 plasmid pCC42, complete sequence 18472-18500 7 0.759
NZ_CP046294_2 2.4|4819242|29|NZ_CP046294|PILER-CR 4819242-4819270 29 NZ_CP040242 Campylobacter coli strain S9 plasmid pCcS9_3, complete sequence 17203-17231 7 0.759
NZ_CP046294_2 2.4|4819242|29|NZ_CP046294|PILER-CR 4819242-4819270 29 NZ_CP028188 Campylobacter coli strain CFSAN054106 plasmid pGMI16-001, complete sequence 6447-6475 7 0.759
NZ_CP046294_2 2.2|4819240|30|NZ_CP046294|CRISPRCasFinder 4819240-4819269 30 NZ_CP028188 Campylobacter coli strain CFSAN054106 plasmid pGMI16-001, complete sequence 6447-6476 8 0.733
NZ_CP046294_2 2.2|4819240|30|NZ_CP046294|CRISPRCasFinder 4819240-4819269 30 NZ_CP011016 Campylobacter coli strain FB1 plasmid pCC42, complete sequence 18471-18500 8 0.733
NZ_CP046294_2 2.2|4819240|30|NZ_CP046294|CRISPRCasFinder 4819240-4819269 30 NZ_CP040242 Campylobacter coli strain S9 plasmid pCcS9_3, complete sequence 17202-17231 8 0.733

1. spacer 2.4|4819242|29|NZ_CP046294|PILER-CR matches to NZ_CP011016 (Campylobacter coli strain FB1 plasmid pCC42, complete sequence) position: , mismatch: 7, identity: 0.759

gcagcacgcataatcgctttcattaatgc	CRISPR spacer
gataaattcaaaatcgctttcattaatgc	Protospacer
*  . *. ** ******************

2. spacer 2.4|4819242|29|NZ_CP046294|PILER-CR matches to NZ_CP040242 (Campylobacter coli strain S9 plasmid pCcS9_3, complete sequence) position: , mismatch: 7, identity: 0.759

gcagcacgcataatcgctttcattaatgc	CRISPR spacer
gataaattcaaaatcgctttcattaatgc	Protospacer
*  . *. ** ******************

3. spacer 2.4|4819242|29|NZ_CP046294|PILER-CR matches to NZ_CP028188 (Campylobacter coli strain CFSAN054106 plasmid pGMI16-001, complete sequence) position: , mismatch: 7, identity: 0.759

gcagcacgcataatcgctttcattaatgc	CRISPR spacer
gataaattcaaaatcgctttcattaatgc	Protospacer
*  . *. ** ******************

4. spacer 2.2|4819240|30|NZ_CP046294|CRISPRCasFinder matches to NZ_CP028188 (Campylobacter coli strain CFSAN054106 plasmid pGMI16-001, complete sequence) position: , mismatch: 8, identity: 0.733

tgcagcacgcataatcgctttcattaatgc	CRISPR spacer
ggataaattcaaaatcgctttcattaatgc	Protospacer
 *  . *. ** ******************

5. spacer 2.2|4819240|30|NZ_CP046294|CRISPRCasFinder matches to NZ_CP011016 (Campylobacter coli strain FB1 plasmid pCC42, complete sequence) position: , mismatch: 8, identity: 0.733

tgcagcacgcataatcgctttcattaatgc	CRISPR spacer
ggataaattcaaaatcgctttcattaatgc	Protospacer
 *  . *. ** ******************

6. spacer 2.2|4819240|30|NZ_CP046294|CRISPRCasFinder matches to NZ_CP040242 (Campylobacter coli strain S9 plasmid pCcS9_3, complete sequence) position: , mismatch: 8, identity: 0.733

tgcagcacgcataatcgctttcattaatgc	CRISPR spacer
ggataaattcaaaatcgctttcattaatgc	Protospacer
 *  . *. ** ******************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 968412 : 1003383 43 Enterobacteria_phage(25.71%) portal,protease,tail,holin,terminase NA
DBSCAN-SWA_2 1689210 : 1736213 67 Salmonella_phage(25.45%) holin,terminase,integrase attL 1684633:1684646|attR 1703561:1703574
DBSCAN-SWA_3 1928736 : 2055088 143 Pseudomonas_phage(15.19%) transposase,plate,tRNA,portal,protease,tail,head,holin,terminase,integrase attL 1935716:1935732|attR 2066463:2066479
DBSCAN-SWA_4 3213793 : 3225123 10 BeAn_58058_virus(16.67%) tRNA NA
DBSCAN-SWA_5 3899522 : 3937082 57 Salmonella_phage(31.71%) holin,head,tail NA
DBSCAN-SWA_6 4026502 : 4035423 10 Escherichia_phage(71.43%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage