Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP046313 Gemella sanguinis strain FDAARGOS_742 chromosome, complete genome 1 crisprs cas3,csa3,DEDDh,WYL 0 1 3 0

Results visualization

1. NZ_CP046313
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP046313_1 668077-668175 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP046313_1 1.1|668113|27|NZ_CP046313|CRISPRCasFinder 668113-668139 27 NZ_CP031070 Bacillus sp. JAS24-2 plasmid pl278, complete sequence 135272-135298 5 0.815
NZ_CP046313_1 1.1|668113|27|NZ_CP046313|CRISPRCasFinder 668113-668139 27 NZ_CP032091 Pseudoalteromonas donghaensis strain HJ51 plasmid unnamed1, complete sequence 536949-536975 5 0.815
NZ_CP046313_1 1.1|668113|27|NZ_CP046313|CRISPRCasFinder 668113-668139 27 AP014858 Vibrio phage RYC DNA, complete sequence 131083-131109 5 0.815
NZ_CP046313_1 1.1|668113|27|NZ_CP046313|CRISPRCasFinder 668113-668139 27 NZ_CP006665 Edwardsiella anguillarum ET080813 strain 80813 plasmid 1, complete sequence 125236-125262 8 0.704
NZ_CP046313_1 1.1|668113|27|NZ_CP046313|CRISPRCasFinder 668113-668139 27 NZ_CP035669 Edwardsiella piscicida strain MS-18-199 plasmid pEP-MS-18-199, complete sequence 8086-8112 8 0.704

1. spacer 1.1|668113|27|NZ_CP046313|CRISPRCasFinder matches to NZ_CP031070 (Bacillus sp. JAS24-2 plasmid pl278, complete sequence) position: , mismatch: 5, identity: 0.815

gagttttttaaaatatctgaagaggat	CRISPR spacer
ttattttttaaaatatttgaaaaggat	Protospacer
  .*************.****.*****

2. spacer 1.1|668113|27|NZ_CP046313|CRISPRCasFinder matches to NZ_CP032091 (Pseudoalteromonas donghaensis strain HJ51 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815

gagttttttaaaatatctgaagaggat	CRISPR spacer
gagttttttaatgtatctgaagacaaa	Protospacer
*********** .********** .* 

3. spacer 1.1|668113|27|NZ_CP046313|CRISPRCasFinder matches to AP014858 (Vibrio phage RYC DNA, complete sequence) position: , mismatch: 5, identity: 0.815

gagttttttaaaatatctgaagaggat	CRISPR spacer
gagttttacaaaatatctgaagacttt	Protospacer
******* .**************   *

4. spacer 1.1|668113|27|NZ_CP046313|CRISPRCasFinder matches to NZ_CP006665 (Edwardsiella anguillarum ET080813 strain 80813 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.704

gagttttttaaaatatctgaagaggat	CRISPR spacer
tgcaggcctaaaatatctgaagaggat	Protospacer
 .    ..*******************

5. spacer 1.1|668113|27|NZ_CP046313|CRISPRCasFinder matches to NZ_CP035669 (Edwardsiella piscicida strain MS-18-199 plasmid pEP-MS-18-199, complete sequence) position: , mismatch: 8, identity: 0.704

gagttttttaaaatatctgaagaggat	CRISPR spacer
tgcaggcctaaaatatctgaagaggat	Protospacer
 .    ..*******************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 12137 : 23644 8 Prochlorococcus_phage(28.57%) NA NA
DBSCAN-SWA_2 317581 : 327568 11 Streptococcus_phage(70.0%) transposase NA
DBSCAN-SWA_3 1500441 : 1506992 9 Bacillus_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage