Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_AP021898 Akkermansia muciniphila strain JCM 30893 0 crisprs csa3,DinG,cas3,cas4 0 0 0 0
NZ_AP021899 Akkermansia muciniphila strain JCM 30893 plasmid pJ30893, complete sequence 1 crisprs NA 0 1 1 0

Results visualization

1. NZ_AP021899
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP021899_1 3379-3459 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_AP021899_1 1.1|3403|33|NZ_AP021899|CRISPRCasFinder 3403-3435 33 NZ_AP021899 Akkermansia muciniphila strain JCM 30893 plasmid pJ30893, complete sequence 3403-3435 0 1.0
NZ_AP021899_1 1.1|3403|33|NZ_AP021899|CRISPRCasFinder 3403-3435 33 MN693842 Marine virus AFVG_250M286, complete genome 7956-7988 10 0.697

1. spacer 1.1|3403|33|NZ_AP021899|CRISPRCasFinder matches to NZ_AP021899 (Akkermansia muciniphila strain JCM 30893 plasmid pJ30893, complete sequence) position: , mismatch: 0, identity: 1.0

tataggtaaaaaaactcccttctttttgattct	CRISPR spacer
tataggtaaaaaaactcccttctttttgattct	Protospacer
*********************************

2. spacer 1.1|3403|33|NZ_AP021899|CRISPRCasFinder matches to MN693842 (Marine virus AFVG_250M286, complete genome) position: , mismatch: 10, identity: 0.697

tataggtaaaaaaactcccttctttttgattct	CRISPR spacer
ctctttgaaaaaaatttccttctttttgatttt	Protospacer
. .    *******.*.**************.*

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 26104 : 32742 10 uncultured_Mediterranean_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage