Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP045868 Klebsiella aerogenes strain Y6 chromosome, complete genome 4 crisprs WYL,cas3,DinG,DEDDh,cas14j,csa3 0 1 5 0

Results visualization

1. NZ_CP045868
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045868_1 907695-907769 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045868_2 1841587-1841705 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045868_3 2156336-2156464 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045868_4 3374013-3374127 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP045868_1 1.1|907720|25|NZ_CP045868|CRISPRCasFinder 907720-907744 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 324018-324042 0 1.0
NZ_CP045868_1 1.1|907720|25|NZ_CP045868|CRISPRCasFinder 907720-907744 25 LR134122 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2 447529-447553 1 0.96
NZ_CP045868_1 1.1|907720|25|NZ_CP045868|CRISPRCasFinder 907720-907744 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 323588-323612 4 0.84
NZ_CP045868_1 1.1|907720|25|NZ_CP045868|CRISPRCasFinder 907720-907744 25 LR134122 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2 447690-447714 5 0.8

1. spacer 1.1|907720|25|NZ_CP045868|CRISPRCasFinder matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 0, identity: 1.0

acaaaaaaacggcaccgcgggtagc	CRISPR spacer
acaaaaaaacggcaccgcgggtagc	Protospacer
*************************

2. spacer 1.1|907720|25|NZ_CP045868|CRISPRCasFinder matches to LR134122 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2) position: , mismatch: 1, identity: 0.96

acaaaaaaacggcaccgcgggtagc	CRISPR spacer
acaaaaaaacggcaccgcgagtagc	Protospacer
*******************.*****

3. spacer 1.1|907720|25|NZ_CP045868|CRISPRCasFinder matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

acaaaaaaacggcaccgcgggtagc	CRISPR spacer
gacaaaaaacggcaccgcgggtaga	Protospacer
.  ********************* 

4. spacer 1.1|907720|25|NZ_CP045868|CRISPRCasFinder matches to LR134122 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2) position: , mismatch: 5, identity: 0.8

acaaaaaaacggcaccgcgggtagc	CRISPR spacer
gacaaaaaacggcaccgcgagtagt	Protospacer
.  ****************.****.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 176355 : 188194 15 Escherichia_phage(30.0%) capsid,integrase,transposase attL 174080:174096|attR 189716:189732
DBSCAN-SWA_2 4205525 : 4214846 10 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_3 4490296 : 4502844 19 Pectobacterium_phage(25.0%) integrase attL 4486522:4486535|attR 4496867:4496880
DBSCAN-SWA_4 4538691 : 4588407 71 Cronobacter_phage(30.43%) terminase,bacteriocin,tRNA,head,lysis,integrase,tail attL 4527396:4527411|attR 4561065:4561080
DBSCAN-SWA_5 4631225 : 4732092 105 Escherichia_phage(11.43%) terminase,plate,tRNA,head,capsid,lysis,integrase,portal,tail attL 4622339:4622353|attR 4663863:4663877
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage