Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP038996 Enterococcus faecium strain SRR24 chromosome, complete genome 1 crisprs cas14j,RT,DEDDh,cas2,DinG,cas3,csa3 0 0 13 0
NZ_CP038997 Enterococcus faecium strain SRR24 plasmid pSRR24 2 crisprs RT,c2c10_CAS-V-U3,cas14j 0 5 2 0

Results visualization

1. NZ_CP038997
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP038997_1 9573-9665 TypeV NA
1 spacers
RT,c2c10_CAS-V-U3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP038997_2 9971-10143 TypeV NA
2 spacers
RT,c2c10_CAS-V-U3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP038997_1 1.1|9599|40|NZ_CP038997|CRISPRCasFinder 9599-9638 40 NZ_CP038997 Enterococcus faecium strain SRR24 plasmid pSRR24 9599-9638 0 1.0
NZ_CP038997_1 1.1|9599|40|NZ_CP038997|CRISPRCasFinder 9599-9638 40 NZ_AP022343 Enterococcus faecium strain KUHS13 plasmid pELF2 94074-94113 0 1.0
NZ_CP038997_1 1.1|9599|40|NZ_CP038997|CRISPRCasFinder 9599-9638 40 NZ_CP019994 Enterococcus faecium isolate 2014-VREF-268 plasmid p268-2 88466-88505 0 1.0
NZ_CP038997_1 1.1|9599|40|NZ_CP038997|CRISPRCasFinder 9599-9638 40 NZ_CP019971 Enterococcus faecium isolate 2014-VREF-114 plasmid p114-1 sequence 29579-29618 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP011282 Enterococcus faecium strain E39 plasmid p1, complete sequence 1408-1435 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP011283 Enterococcus faecium strain E39 plasmid p2, complete sequence 1425-1452 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP011284 Enterococcus faecium strain E39 plasmid p4, complete sequence 1419-1446 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP015123 Enterococcus faecium strain E39 plasmid p3, complete sequence 1464-1491 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_KP842560 Enterococcus faecium strain 17i48 ST17 plasmid pRUM-like, complete sequence 15645-15672 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_KP342511 Enterococcus faecium isolate N12-493 plasmid pEfm12493, complete sequence 15951-15978 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 LT603679 Enterococcus faecium isolate Ef_DMG1500501 genome assembly, plasmid: 2 1405-1432 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 LT603680 Enterococcus faecium isolate Ef_DMG1500501 genome assembly, plasmid: 3 1419-1446 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP018831 Enterococcus faecium strain ISMMS_VRE_9 plasmid p2_ISMMS_VRE9, complete sequence 2082-2109 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP018832 Enterococcus faecium strain ISMMS_VRE_9 plasmid p1_ISMMS_VRE9, complete sequence 8494-8521 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP018832 Enterococcus faecium strain ISMMS_VRE_9 plasmid p1_ISMMS_VRE9, complete sequence 245081-245108 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 CP003352 Enterococcus faecium Aus0004 plasmid AUS0004_p1, complete sequence 1419-1446 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP041264 Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R3, complete sequence 1420-1447 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP012367 Enterococcus durans strain KLDS 6.0933 plasmid unnamed 1, complete sequence 4310-4337 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP018073 Enterococcus faecium strain VRE001 plasmid unnamed3, complete sequence 112325-112352 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP027498 Enterococcus faecium strain AUSMDU00004167 plasmid unnamed1, complete sequence 1408-1435 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP027499 Enterococcus faecium strain AUSMDU00004167 plasmid unnamed2, complete sequence 1419-1446 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP027508 Enterococcus faecium strain AUSMDU00004055 plasmid unnamed2, complete sequence 1438-1465 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP027510 Enterococcus faecium strain AUSMDU00004055 plasmid unnamed4, complete sequence 1419-1446 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP027502 Enterococcus faecium strain AUSMDU00004142 plasmid unnamed1, complete sequence 1424-1451 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP027503 Enterococcus faecium strain AUSMDU00004142 plasmid unnamed2, complete sequence 1439-1466 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP027505 Enterococcus faecium strain AUSMDU00004142 plasmid unnamed4, complete sequence 1419-1446 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135288 Enterococcus faecium isolate E7199 plasmid 2 1408-1435 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135289 Enterococcus faecium isolate E7199 plasmid 3 7872-7899 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135290 Enterococcus faecium isolate E7199 plasmid 4 1419-1446 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135333 Enterococcus faecium isolate E7471 plasmid 3 1408-1435 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135334 Enterococcus faecium isolate E7471 plasmid 4 18479-18506 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135335 Enterococcus faecium isolate E7471 plasmid 5 1419-1446 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP046075 Enterococcus faecium strain VRE plasmid p3_03A17012, complete sequence 1419-1446 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP046076 Enterococcus faecium strain VRE plasmid p5_03A17012, complete sequence 1408-1435 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP046078 Enterococcus faecium strain VRE plasmid p4_03A17012, complete sequence 11271-11298 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 MT074686 Enterococcus faecium strain E1077 plasmid pE1077-217, complete sequence 1408-1435 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP025755 Enterococcus faecium strain AALTL plasmid pEFA-790c, complete sequence 3761-3788 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP025756 Enterococcus faecium strain AALTL plasmid pEFA-99d7, complete sequence 127889-127916 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP025756 Enterococcus faecium strain AALTL plasmid pEFA-99d7, complete sequence 152602-152629 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP027514 Enterococcus faecium strain AUSMDU00004028 plasmid unnamed2, complete sequence 1439-1466 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP027516 Enterococcus faecium strain AUSMDU00004028 plasmid unnamed4, complete sequence 1419-1446 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP013010 Enterococcus faecium strain UW7606x64/3 TC1 plasmid pWCF-TC1, complete sequence 57302-57329 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135281 Enterococcus faecium isolate E6975 plasmid 4 1419-1446 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135255 Enterococcus faecium isolate E7098 plasmid 2 1408-1435 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135257 Enterococcus faecium isolate E7098 plasmid 4 1419-1446 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135238 Enterococcus faecium isolate E7067 plasmid 4 1419-1446 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135199 Enterococcus faecium isolate E6055 plasmid 3 1419-1446 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135259 Enterococcus faecium isolate E4457 plasmid 2 3092-3119 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP038997 Enterococcus faecium strain SRR24 plasmid pSRR24 10009-10036 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135182 Enterococcus faecium isolate E1774 plasmid 2 1408-1435 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP041254 Enterococcus faecium strain 515 plasmid p169, complete sequence 54283-54310 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NC_021995 Enterococcus faecium Aus0085 plasmid p2, complete sequence 1417-1444 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP038175 Enterococcus faecium strain SDGJQ5 plasmid pSDGJQ5, complete sequence 15855-15882 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP017798 Enterococcus faecium strain E243 plasmid unnamed1, complete sequence 1408-1435 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP017799 Enterococcus faecium strain E243 plasmid unnamed2, complete sequence 1464-1491 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135436 Enterococcus faecium isolate E8691 plasmid 2 1408-1435 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135437 Enterococcus faecium isolate E8691 plasmid 3 1419-1446 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135484 Enterococcus faecium isolate E4456 plasmid 3 1419-1446 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135477 Enterococcus faecium isolate E8423 plasmid 3 1419-1446 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135477 Enterococcus faecium isolate E8423 plasmid 3 10266-10293 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135207 Enterococcus faecium isolate E7171 plasmid 5 1419-1446 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135175 Enterococcus faecium isolate E4402 plasmid 2 1424-1451 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135176 Enterococcus faecium isolate E4402 plasmid 3 1419-1446 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135180 Enterococcus faecium isolate E0595 plasmid 2 1424-1451 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135227 Enterococcus faecium isolate E7025 plasmid 2 1408-1435 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135228 Enterococcus faecium isolate E7025 plasmid 3 1419-1446 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135221 Enterococcus faecium isolate E7040 plasmid 3 1419-1446 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NC_021987 Enterococcus faecium Aus0085 plasmid p1, complete sequence 2973-3000 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NC_021987 Enterococcus faecium Aus0085 plasmid p1, complete sequence 108152-108179 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135326 Enterococcus faecium isolate E7654 plasmid 3 1419-1446 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135359 Enterococcus faecium isolate E7948 plasmid 3 1419-1446 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP044265 Enterococcus faecium strain V1836 plasmid pHVH-V1836-1, complete sequence 1424-1451 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135319 Enterococcus faecium isolate E7663 plasmid 3 1419-1446 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135374 Enterococcus faecium isolate E8172 plasmid 3 1419-1446 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135374 Enterococcus faecium isolate E8172 plasmid 3 54179-54206 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP006031 Enterococcus faecium T110 plasmid pEFT110, complete sequence 2353-2380 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR132068 Enterococcus faecium isolate E0139 plasmid 2 1424-1451 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_AP019395 Enterococcus faecium strain QU 50 plasmid pQL50, complete sequence 1408-1435 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP014530 Enterococcus faecium strain E745 plasmid pl1, complete sequence 201586-201613 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP014534 Enterococcus faecium strain E745 plasmid pl5, complete sequence 20540-20567 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP023425 Enterococcus faecium strain K60-39 plasmid pTT39_p2, complete sequence 1419-1446 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_AP022342 Enterococcus faecium strain KUHS13 plasmid pKO1, complete sequence 1408-1435 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP041273 Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S3, complete sequence 1419-1446 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP040704 Enterococcus faecium strain HOU503 plasmid p1, complete sequence 68283-68310 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP040708 Enterococcus faecium strain HOU503 plasmid p2 27551-27578 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP040873 Enterococcus faecium strain DB-1 plasmid punnamed1 40953-40980 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP040876 Enterococcus faecium strain DB-1 plasmid punnamed2 3803-3830 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP017793 Enterococcus faecium strain E240 plasmid unnamed1, complete sequence 1408-1435 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP017794 Enterococcus faecium strain E240 plasmid unnamed2, complete sequence 1437-1464 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP017795 Enterococcus faecium strain E240 plasmid unnamed3, complete sequence 1419-1446 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP035650 Enterococcus faecium strain UAMSEF_08 plasmid unnamed2, complete sequence 1419-1446 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP023790 Enterococcus faecium strain Efaecium_ER04462.3A plasmid pER04462.3A.1, complete sequence 1408-1435 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP023790 Enterococcus faecium strain Efaecium_ER04462.3A plasmid pER04462.3A.1, complete sequence 24658-24685 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP023800 Enterococcus faecium strain Efaecium_ER04526.5A plasmid pER04526.5A.1, complete sequence 1408-1435 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP023800 Enterococcus faecium strain Efaecium_ER04526.5A plasmid pER04526.5A.1, complete sequence 24658-24685 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP035137 Enterococcus faecium strain SRCM103341 plasmid unnamed1, complete sequence 179853-179880 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR134096 Enterococcus faecium isolate E1334 plasmid 2 1424-1451 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP035644 Enterococcus faecium strain UAMSEF_01 plasmid unnamed2, complete sequence 1419-1446 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP040850 Enterococcus faecium strain F17E0263 plasmid p_unnamned1, complete sequence 106664-106691 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135192 Enterococcus faecium isolate E4438 plasmid 2 1408-1435 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135193 Enterococcus faecium isolate E4438 plasmid 3 1419-1446 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP019971 Enterococcus faecium isolate 2014-VREF-114 plasmid p114-1 sequence 29989-30016 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP019971 Enterococcus faecium isolate 2014-VREF-114 plasmid p114-1 sequence 112917-112944 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP037956 Enterococcus hirae strain CQP3-9 plasmid pCQP3-9_1, complete sequence 36136-36163 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135308 Enterococcus faecium isolate E7240 plasmid 2 1408-1435 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135309 Enterococcus faecium isolate E7240 plasmid 3 34936-34963 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135310 Enterococcus faecium isolate E7240 plasmid 4 1419-1446 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP040237 Enterococcus faecium strain VB3025 plasmid unnamed1, complete sequence 1424-1451 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP023809 Enterococcus faecium strain Efaecium_ER04526.3A plasmid pER04562.3A.1, complete sequence 1408-1435 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP023809 Enterococcus faecium strain Efaecium_ER04526.3A plasmid pER04562.3A.1, complete sequence 24658-24685 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP023812 Enterococcus faecium strain Efaecium_ER04526.3A plasmid pER04562.3A.5, complete sequence 1419-1446 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP033208 Enterococcus faecium strain RBWH1 plasmid pRBWH1.2, complete sequence 1420-1447 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP023805 Enterococcus faecium strain Efaecium_ER04619.3A isolate isolate plasmid pER04619.3A.1, complete sequence 1408-1435 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP023805 Enterococcus faecium strain Efaecium_ER04619.3A isolate isolate plasmid pER04619.3A.1, complete sequence 24658-24685 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP035221 Enterococcus faecium strain SRCM103470 plasmid unnamed1 87122-87149 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_AP019410 Enterococcus faecium strain SMVRE20 plasmid pSMVRE20S, complete sequence 1419-1446 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_AP019409 Enterococcus faecium strain SMVRE20 plasmid pSMVRE20L, complete sequence 1408-1435 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NC_020208 Enterococcus faecium ATCC 8459 = NRRL B-2354 plasmid pNB2354_1, complete sequence 62608-62635 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP034948 Enterococcus faecium strain NM213 plasmid unnamed5, complete sequence 6040-6067 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP016165 Enterococcus faecium strain ISMMS_VRE_11 plasmid ISMMS_VRE11_p2, complete sequence 43811-43838 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP016166 Enterococcus faecium strain ISMMS_VRE_11 plasmid ISMMS_VRE11_p3, complete sequence 46974-47001 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP018825 Enterococcus faecium strain ISMMS_VRE_12 plasmid p2_ISMMS_VRE12, complete sequence 2082-2109 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP018827 Enterococcus faecium strain ISMMS_VRE_12 plasmid p1_ISMMS_VRE12, complete sequence 8494-8521 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP018827 Enterococcus faecium strain ISMMS_VRE_12 plasmid p1_ISMMS_VRE12, complete sequence 245081-245108 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 LR135186 Enterococcus faecium isolate E4413 genome assembly, plasmid: 2 1424-1451 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP012432 Enterococcus faecium strain ISMMS_VRE_1 plasmid ISMMS_VRE_p1, complete sequence 32412-32439 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP023795 Enterococcus faecium strain Efaecium_ER04484.3A plasmid pER04484.3A.1, complete sequence 1408-1435 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP023795 Enterococcus faecium strain Efaecium_ER04484.3A plasmid pER04484.3A.1, complete sequence 24658-24685 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP023796 Enterococcus faecium strain Efaecium_ER04484.3A plasmid pER04484.3A.2, complete sequence 1419-1446 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_MG674581 Enterococcus faecium strain HL1 plasmid pHLSA, complete sequence 1408-1435 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP023781 Enterococcus faecium strain Efaecium_ER03933.3A isolate isolate plasmid pER93933.3A.1, complete sequence 1408-1435 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP023781 Enterococcus faecium strain Efaecium_ER03933.3A isolate isolate plasmid pER93933.3A.1, complete sequence 24658-24685 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LT598666 Enterococcus faecium isolate Ef_aus00233 plasmid 4 1419-1446 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_KX810025 Enterococcus faecium strain Efm008 plasmid pJEG040, complete sequence 34377-34404 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_KX574671 Enterococcus faecium strain V24 plasmid pHvH-V24, complete sequence 25051-25078 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_KY554216 Enterococcus faecium strain Efa-125 plasmid pEfa-125gr, complete sequence 26058-26085 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_KY595962 Enterococcus faecium strain VREfm1 plasmid pPEC286, complete sequence 32862-32889 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_KY595966 Enterococcus faecium strain VREfm81 plasmid pBUD102, complete sequence 25872-25899 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP040906 Enterococcus faecium strain FB-1 plasmid punnamed, complete sequence 50796-50823 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NC_021170 Enterococcus faecium plasmid pF856, complete sequence 27874-27901 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP027401 Enterococcus faecium strain FDAARGOS_323 plasmid unnamed, complete sequence 108488-108515 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP012385 Enterococcus durans strain KLDS 6.0930 plasmid unnamed 1, complete sequence 94148-94175 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP013995 Enterococcus faecium strain 6E6 plasmid unnamed1, complete sequence 294494-294521 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP014450 Enterococcus faecium strain ATCC 700221 plasmid unnamed1, complete sequence 118979-119006 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP014452 Enterococcus faecium strain ATCC 700221 plasmid unnamed3, complete sequence 13084-13111 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP018070 Enterococcus faecium strain VRE001 plasmid unnamed1, complete sequence 17449-17476 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135246 Enterococcus faecium isolate E6988 plasmid 4 10157-10184 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135280 Enterococcus faecium isolate E6975 plasmid 3 53016-53043 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135237 Enterococcus faecium isolate E7067 plasmid 3 8989-9016 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135200 Enterococcus faecium isolate E6055 plasmid 4 3463-3490 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135261 Enterococcus faecium isolate E4457 plasmid 4 41003-41030 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP041256 Enterococcus faecium strain 515 plasmid p26, complete sequence 128268-128295 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP041258 Enterococcus faecium strain 515 plasmid p27, complete sequence 79119-79146 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NC_005000 Enterococcus faecium U37 plasmid pRUM, complete sequence 20137-20164 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135222 Enterococcus faecium isolate E7040 plasmid 4 52010-52037 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135347 Enterococcus faecium isolate E8202 plasmid 4 4631-4658 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP050649 Enterococcus faecium strain BIOPOP-3 ALE plasmid pBIOPOP-3_ALE 90457-90484 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP050651 Enterococcus faecium strain BIOPOP-3 WT plasmid pBIOPOP-3_WT 101481-101508 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP044266 Enterococcus faecium strain V1836 plasmid pHVH-V1836-2, complete sequence 30716-30743 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR134108 Enterococcus faecium isolate E6043 plasmid 4 45508-45535 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP015517 Enterococcus hirae strain R17 plasmid, complete sequence 12217-12244 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP011829 Enterococcus faecium strain UW8175 plasmid unnamed1, complete sequence 59418-59445 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LN999988 Enterococcus faecium isolate EFE11651 plasmid II, complete sequence 96733-96760 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LN999989 Enterococcus faecium isolate EFE11651 plasmid III, complete sequence 4944-4971 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP033042 Enterococcus faecium strain Enterococcus faecium JE1 plasmid unnamed, complete sequence 51692-51719 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP025687 Enterococcus faecium strain CBA7134 plasmid pCBA710401, complete sequence 101707-101734 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_AP022343 Enterococcus faecium strain KUHS13 plasmid pELF2 93676-93703 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NC_014959 Enterococcus faecium plasmid pS177, complete sequence 35770-35797 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP040877 Enterococcus faecium strain HB-1 plasmid punnamed, complete sequence 55599-55626 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP032307 Enterococcus faecium strain HY07 plasmid unnamed2, complete sequence 64389-64416 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP019993 Enterococcus faecium isolate 2014-VREF-268 plasmid p268-1, complete sequence 13628-13655 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP019994 Enterococcus faecium isolate 2014-VREF-268 plasmid p268-2 88068-88095 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP035661 Enterococcus faecium strain UAMSEF_09 plasmid unnamed1, complete sequence 217121-217148 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP035667 Enterococcus faecium strain UAMSEF_20 plasmid unnamed1, complete sequence 216990-217017 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NC_017962 Enterococcus faecium DO plasmid 2, complete sequence 53462-53489 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP042840 Enterococcus sp. DA9 plasmid unnamed4 38943-38970 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP033207 Enterococcus faecium strain RBWH1 plasmid pRBWH1.1, complete sequence 91102-91129 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP018129 Enterococcus faecium strain A_020709_82 plasmid unnamed1, complete sequence 16144-16171 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP042833 Enterococcus faecium strain FA3 plasmid unnamed1 46685-46712 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP012461 Enterococcus faecium strain ISMMS_VRE_7 plasmid ISMMS_VRE7_p1, complete sequence 191169-191196 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP012463 Enterococcus faecium strain ISMMS_VRE_7 plasmid ISMMS_VRE7_p3, complete sequence 48423-48450 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP012464 Enterococcus faecium strain ISMMS_VRE_7 plasmid ISMMS_VRE7_p4, complete sequence 34688-34715 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP012431 Enterococcus faecium strain ISMMS_VRE_1 plasmid ISMMS_VRE_p2, complete sequence 34383-34410 0 1.0
NZ_CP038997_2 2.2|10081|25|NZ_CP038997|PILER-CR 10081-10105 25 NZ_AP022343 Enterococcus faecium strain KUHS13 plasmid pELF2 93610-93634 0 1.0
NZ_CP038997_2 2.2|10081|25|NZ_CP038997|PILER-CR 10081-10105 25 NZ_CP019994 Enterococcus faecium isolate 2014-VREF-268 plasmid p268-2 88002-88026 0 1.0
NZ_CP038997_2 2.2|10081|25|NZ_CP038997|PILER-CR 10081-10105 25 NZ_CP038997 Enterococcus faecium strain SRR24 plasmid pSRR24 10078-10102 0 1.0
NZ_CP038997_2 2.2|10081|25|NZ_CP038997|PILER-CR 10081-10105 25 NZ_CP019971 Enterococcus faecium isolate 2014-VREF-114 plasmid p114-1 sequence 30058-30082 0 1.0
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP038997 Enterococcus faecium strain SRR24 plasmid pSRR24 10009-10048 0 1.0
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP019971 Enterococcus faecium isolate 2014-VREF-114 plasmid p114-1 sequence 29989-30028 0 1.0
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_AP022343 Enterococcus faecium strain KUHS13 plasmid pELF2 93664-93703 0 1.0
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP019994 Enterococcus faecium isolate 2014-VREF-268 plasmid p268-2 88056-88095 0 1.0
NZ_CP038997_2 2.4|10075|40|NZ_CP038997|CRISPRCasFinder 10075-10114 40 NZ_AP022343 Enterococcus faecium strain KUHS13 plasmid pELF2 93598-93637 0 1.0
NZ_CP038997_2 2.4|10075|40|NZ_CP038997|CRISPRCasFinder 10075-10114 40 NZ_CP019994 Enterococcus faecium isolate 2014-VREF-268 plasmid p268-2 87990-88029 0 1.0
NZ_CP038997_2 2.4|10075|40|NZ_CP038997|CRISPRCasFinder 10075-10114 40 NZ_CP038997 Enterococcus faecium strain SRR24 plasmid pSRR24 10075-10114 0 1.0
NZ_CP038997_2 2.4|10075|40|NZ_CP038997|CRISPRCasFinder 10075-10114 40 NZ_CP019971 Enterococcus faecium isolate 2014-VREF-114 plasmid p114-1 sequence 30055-30094 0 1.0
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP013995 Enterococcus faecium strain 6E6 plasmid unnamed1, complete sequence 357261-357288 1 0.964
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP035661 Enterococcus faecium strain UAMSEF_09 plasmid unnamed1, complete sequence 1408-1435 1 0.964
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP035667 Enterococcus faecium strain UAMSEF_20 plasmid unnamed1, complete sequence 1408-1435 1 0.964
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NC_022883 Enterococcus mundtii QU 25 plasmid pQY082, complete sequence 28090-28117 1 0.964
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP040369 Enterococcus faecium strain VB3240 plasmid unnamed1, complete sequence 1408-1435 1 0.964
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP020485 Enterococcus faecium strain CFSAN059070 plasmid unnamed1, complete sequence 97502-97529 1 0.964
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP041262 Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R1, complete sequence 1425-1452 1 0.964
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP027518 Enterococcus faecium strain AUSMDU00004024 plasmid unnamed1, complete sequence 1408-1435 1 0.964
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP027507 Enterococcus faecium strain AUSMDU00004055 plasmid unnamed1, complete sequence 1408-1435 1 0.964
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135298 Enterococcus faecium isolate E7429 plasmid 2 1424-1451 1 0.964
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135340 Enterococcus faecium isolate E7356 plasmid 2 1424-1451 1 0.964
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP027513 Enterococcus faecium strain AUSMDU00004028 plasmid unnamed1, complete sequence 1424-1451 1 0.964
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135244 Enterococcus faecium isolate E6988 plasmid 2 1408-1435 1 0.964
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135279 Enterococcus faecium isolate E6975 plasmid 2 1408-1435 1 0.964
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135783 Enterococcus faecium isolate E4239 plasmid 2 1408-1435 1 0.964
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135294 Enterococcus faecium isolate E7237 plasmid 2 1424-1451 1 0.964
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135236 Enterococcus faecium isolate E7067 plasmid 2 1408-1435 1 0.964
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135198 Enterococcus faecium isolate E6055 plasmid 2 1424-1451 1 0.964
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP019209 Enterococcus faecium strain 2014-VREF-41 plasmid p41-1, complete sequence 72224-72251 1 0.964
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135429 Enterococcus faecium isolate E8927 plasmid 2 1408-1435 1 0.964
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135483 Enterococcus faecium isolate E4456 plasmid 2 1424-1451 1 0.964
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135476 Enterococcus faecium isolate E8423 plasmid 2 1408-1435 1 0.964
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135204 Enterococcus faecium isolate E7171 plasmid 2 1424-1451 1 0.964
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135489 Enterococcus faecium isolate E8414 plasmid 2 1424-1451 1 0.964
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135365 Enterococcus faecium isolate E8195 plasmid 2 1424-1451 1 0.964
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135220 Enterococcus faecium isolate E7040 plasmid 2 1408-1435 1 0.964
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135415 Enterococcus faecium isolate E8328 plasmid 2 1424-1451 1 0.964
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135395 Enterococcus faecium isolate E8290 plasmid 2 1424-1451 1 0.964
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135345 Enterococcus faecium isolate E8202 plasmid 2 1424-1451 1 0.964
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135325 Enterococcus faecium isolate E7654 plasmid 2 1408-1435 1 0.964
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135358 Enterococcus faecium isolate E7948 plasmid 2 1408-1435 1 0.964
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135409 Enterococcus faecium isolate E8284 plasmid 2 1424-1451 1 0.964
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135352 Enterococcus faecium isolate E8014 plasmid 2 1408-1435 1 0.964
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135385 Enterococcus faecium isolate E7933 plasmid 2 1424-1451 1 0.964
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135386 Enterococcus faecium isolate E7933 plasmid 3 1419-1446 1 0.964
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135318 Enterococcus faecium isolate E7663 plasmid 2 1408-1435 1 0.964
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR134106 Enterococcus faecium isolate E6043 plasmid 2 1408-1435 1 0.964
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135373 Enterococcus faecium isolate E8172 plasmid 2 1424-1451 1 0.964
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP045013 Enterococcus faecium strain LAC7.2 plasmid pI, complete sequence 1408-1435 1 0.964
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP040741 Enterococcus faecium strain VRE1 plasmid pVRE1-1, complete sequence 1408-1435 1 0.964
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP023424 Enterococcus faecium strain K60-39 plasmid pTT39_p1, complete sequence 1408-1435 1 0.964
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP044275 Enterococcus faecium strain V2937 plasmid pHVH-V2937-1, complete sequence 1424-1451 1 0.964
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP035655 Enterococcus faecium strain UAMSEF_08 plasmid unnamed1, complete sequence 1408-1435 1 0.964
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP035649 Enterococcus faecium strain UAMSEF_01 plasmid unnamed1, complete sequence 1408-1435 1 0.964
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LR135171 Enterococcus faecium isolate E4227 plasmid 2 1408-1435 1 0.964
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP041271 Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S1, complete sequence 1424-1451 1 0.964
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP018066 Enterococcus faecium strain E1 plasmid pE1_230, complete sequence 226583-226610 1 0.964
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP016164 Enterococcus faecium strain ISMMS_VRE_11 plasmid ISMMS_VRE11_p1, complete sequence 178249-178276 1 0.964
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP025426 Enterococcus faecium strain SC4 plasmid p1, complete sequence 220272-220299 1 0.964
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP040905 Enterococcus faecium strain N56454 plasmid unnamed, complete sequence 151345-151372 1 0.964
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP019989 Enterococcus faecium isolate 2014-VREF-63 plasmid p63-1, complete sequence 248174-248201 1 0.964
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NC_017963 Enterococcus faecium DO plasmid 3, complete sequence 32137-32164 1 0.964
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_LT598664 Enterococcus faecium isolate Ef_aus00233 plasmid 2 167303-167330 1 0.964
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP019974 Enterococcus faecium isolate 2014-VREF-114 plasmid p114-4 sequence 50019-50046 1 0.964
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 NZ_CP040851 Enterococcus faecium strain F17E0263 plasmid p_unnamned2, complete sequence 8772-8799 2 0.929
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP011282 Enterococcus faecium strain E39 plasmid p1, complete sequence 1408-1447 5 0.875
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 LT603679 Enterococcus faecium isolate Ef_DMG1500501 genome assembly, plasmid: 2 1405-1444 5 0.875
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP018832 Enterococcus faecium strain ISMMS_VRE_9 plasmid p1_ISMMS_VRE9, complete sequence 245081-245120 5 0.875
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP018073 Enterococcus faecium strain VRE001 plasmid unnamed3, complete sequence 112325-112364 5 0.875
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP027498 Enterococcus faecium strain AUSMDU00004167 plasmid unnamed1, complete sequence 1408-1447 5 0.875
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135288 Enterococcus faecium isolate E7199 plasmid 2 1408-1447 5 0.875
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135333 Enterococcus faecium isolate E7471 plasmid 3 1408-1447 5 0.875
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP046076 Enterococcus faecium strain VRE plasmid p5_03A17012, complete sequence 1408-1447 5 0.875
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 MT074686 Enterococcus faecium strain E1077 plasmid pE1077-217, complete sequence 1408-1447 5 0.875
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP025756 Enterococcus faecium strain AALTL plasmid pEFA-99d7, complete sequence 127889-127928 5 0.875
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135255 Enterococcus faecium isolate E7098 plasmid 2 1408-1447 5 0.875
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135259 Enterococcus faecium isolate E4457 plasmid 2 3092-3131 5 0.875
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135182 Enterococcus faecium isolate E1774 plasmid 2 1408-1447 5 0.875
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP017798 Enterococcus faecium strain E243 plasmid unnamed1, complete sequence 1408-1447 5 0.875
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135436 Enterococcus faecium isolate E8691 plasmid 2 1408-1447 5 0.875
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135227 Enterococcus faecium isolate E7025 plasmid 2 1408-1447 5 0.875
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NC_021987 Enterococcus faecium Aus0085 plasmid p1, complete sequence 108152-108191 5 0.875
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_AP019395 Enterococcus faecium strain QU 50 plasmid pQL50, complete sequence 1408-1447 5 0.875
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP014534 Enterococcus faecium strain E745 plasmid pl5, complete sequence 20540-20579 5 0.875
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP040704 Enterococcus faecium strain HOU503 plasmid p1, complete sequence 68283-68322 5 0.875
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP017793 Enterococcus faecium strain E240 plasmid unnamed1, complete sequence 1408-1447 5 0.875
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP023790 Enterococcus faecium strain Efaecium_ER04462.3A plasmid pER04462.3A.1, complete sequence 1408-1447 5 0.875
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP023800 Enterococcus faecium strain Efaecium_ER04526.5A plasmid pER04526.5A.1, complete sequence 1408-1447 5 0.875
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP035137 Enterococcus faecium strain SRCM103341 plasmid unnamed1, complete sequence 179853-179892 5 0.875
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP040850 Enterococcus faecium strain F17E0263 plasmid p_unnamned1, complete sequence 106664-106703 5 0.875
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135192 Enterococcus faecium isolate E4438 plasmid 2 1408-1447 5 0.875
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135308 Enterococcus faecium isolate E7240 plasmid 2 1408-1447 5 0.875
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP023809 Enterococcus faecium strain Efaecium_ER04526.3A plasmid pER04562.3A.1, complete sequence 1408-1447 5 0.875
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP023805 Enterococcus faecium strain Efaecium_ER04619.3A isolate isolate plasmid pER04619.3A.1, complete sequence 1408-1447 5 0.875
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP035221 Enterococcus faecium strain SRCM103470 plasmid unnamed1 87122-87161 5 0.875
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_AP019409 Enterococcus faecium strain SMVRE20 plasmid pSMVRE20L, complete sequence 1408-1447 5 0.875
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NC_020208 Enterococcus faecium ATCC 8459 = NRRL B-2354 plasmid pNB2354_1, complete sequence 62608-62647 5 0.875
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP034948 Enterococcus faecium strain NM213 plasmid unnamed5, complete sequence 6040-6079 5 0.875
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP018827 Enterococcus faecium strain ISMMS_VRE_12 plasmid p1_ISMMS_VRE12, complete sequence 245081-245120 5 0.875
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP023795 Enterococcus faecium strain Efaecium_ER04484.3A plasmid pER04484.3A.1, complete sequence 1408-1447 5 0.875
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_MG674581 Enterococcus faecium strain HL1 plasmid pHLSA, complete sequence 1408-1447 5 0.875
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP023781 Enterococcus faecium strain Efaecium_ER03933.3A isolate isolate plasmid pER93933.3A.1, complete sequence 1408-1447 5 0.875
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135246 Enterococcus faecium isolate E6988 plasmid 4 10145-10184 5 0.875
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135237 Enterococcus faecium isolate E7067 plasmid 3 8977-9016 5 0.875
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP041256 Enterococcus faecium strain 515 plasmid p26, complete sequence 128256-128295 5 0.875
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135222 Enterococcus faecium isolate E7040 plasmid 4 51998-52037 5 0.875
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR134108 Enterococcus faecium isolate E6043 plasmid 4 45496-45535 5 0.875
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP011829 Enterococcus faecium strain UW8175 plasmid unnamed1, complete sequence 59406-59445 5 0.875
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LN999988 Enterococcus faecium isolate EFE11651 plasmid II, complete sequence 96721-96760 5 0.875
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP025687 Enterococcus faecium strain CBA7134 plasmid pCBA710401, complete sequence 101695-101734 5 0.875
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP040877 Enterococcus faecium strain HB-1 plasmid punnamed, complete sequence 55587-55626 5 0.875
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP032307 Enterococcus faecium strain HY07 plasmid unnamed2, complete sequence 64377-64416 5 0.875
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP019993 Enterococcus faecium isolate 2014-VREF-268 plasmid p268-1, complete sequence 13616-13655 5 0.875
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP042840 Enterococcus sp. DA9 plasmid unnamed4 38931-38970 5 0.875
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP033207 Enterococcus faecium strain RBWH1 plasmid pRBWH1.1, complete sequence 91090-91129 5 0.875
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP042833 Enterococcus faecium strain FA3 plasmid unnamed1 46673-46712 5 0.875
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP012461 Enterococcus faecium strain ISMMS_VRE_7 plasmid ISMMS_VRE7_p1, complete sequence 191157-191196 5 0.875
NZ_CP038997_2 2.1|10012|28|NZ_CP038997|PILER-CR 10012-10039 28 MN694520 Marine virus AFVG_250M712, complete genome 10910-10937 6 0.786
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP013995 Enterococcus faecium strain 6E6 plasmid unnamed1, complete sequence 357249-357288 6 0.85
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP035661 Enterococcus faecium strain UAMSEF_09 plasmid unnamed1, complete sequence 1408-1447 6 0.85
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP035667 Enterococcus faecium strain UAMSEF_20 plasmid unnamed1, complete sequence 1408-1447 6 0.85
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP027508 Enterococcus faecium strain AUSMDU00004055 plasmid unnamed2, complete sequence 1438-1477 6 0.85
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP027503 Enterococcus faecium strain AUSMDU00004142 plasmid unnamed2, complete sequence 1439-1478 6 0.85
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP027514 Enterococcus faecium strain AUSMDU00004028 plasmid unnamed2, complete sequence 1439-1478 6 0.85
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP040369 Enterococcus faecium strain VB3240 plasmid unnamed1, complete sequence 1408-1447 6 0.85
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP020485 Enterococcus faecium strain CFSAN059070 plasmid unnamed1, complete sequence 97502-97541 6 0.85
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP041262 Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R1, complete sequence 1425-1464 6 0.85
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP027518 Enterococcus faecium strain AUSMDU00004024 plasmid unnamed1, complete sequence 1408-1447 6 0.85
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP027507 Enterococcus faecium strain AUSMDU00004055 plasmid unnamed1, complete sequence 1408-1447 6 0.85
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135244 Enterococcus faecium isolate E6988 plasmid 2 1408-1447 6 0.85
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135279 Enterococcus faecium isolate E6975 plasmid 2 1408-1447 6 0.85
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135783 Enterococcus faecium isolate E4239 plasmid 2 1408-1447 6 0.85
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135236 Enterococcus faecium isolate E7067 plasmid 2 1408-1447 6 0.85
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP019209 Enterococcus faecium strain 2014-VREF-41 plasmid p41-1, complete sequence 72224-72263 6 0.85
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135429 Enterococcus faecium isolate E8927 plasmid 2 1408-1447 6 0.85
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135476 Enterococcus faecium isolate E8423 plasmid 2 1408-1447 6 0.85
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135220 Enterococcus faecium isolate E7040 plasmid 2 1408-1447 6 0.85
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135325 Enterococcus faecium isolate E7654 plasmid 2 1408-1447 6 0.85
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135358 Enterococcus faecium isolate E7948 plasmid 2 1408-1447 6 0.85
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135352 Enterococcus faecium isolate E8014 plasmid 2 1408-1447 6 0.85
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135318 Enterococcus faecium isolate E7663 plasmid 2 1408-1447 6 0.85
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR134106 Enterococcus faecium isolate E6043 plasmid 2 1408-1447 6 0.85
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP045013 Enterococcus faecium strain LAC7.2 plasmid pI, complete sequence 1408-1447 6 0.85
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP040741 Enterococcus faecium strain VRE1 plasmid pVRE1-1, complete sequence 1408-1447 6 0.85
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP023424 Enterococcus faecium strain K60-39 plasmid pTT39_p1, complete sequence 1408-1447 6 0.85
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP035655 Enterococcus faecium strain UAMSEF_08 plasmid unnamed1, complete sequence 1408-1447 6 0.85
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP035649 Enterococcus faecium strain UAMSEF_01 plasmid unnamed1, complete sequence 1408-1447 6 0.85
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135171 Enterococcus faecium isolate E4227 plasmid 2 1408-1447 6 0.85
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP041271 Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S1, complete sequence 1424-1463 6 0.85
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP025426 Enterococcus faecium strain SC4 plasmid p1, complete sequence 220260-220299 6 0.85
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP040905 Enterococcus faecium strain N56454 plasmid unnamed, complete sequence 151333-151372 6 0.85
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP019989 Enterococcus faecium isolate 2014-VREF-63 plasmid p63-1, complete sequence 248162-248201 6 0.85
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP033208 Enterococcus faecium strain RBWH1 plasmid pRBWH1.2, complete sequence 1420-1459 7 0.825
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NC_022883 Enterococcus mundtii QU 25 plasmid pQY082, complete sequence 28090-28129 7 0.825
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP040851 Enterococcus faecium strain F17E0263 plasmid p_unnamned2, complete sequence 8760-8799 7 0.825
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP019971 Enterococcus faecium isolate 2014-VREF-114 plasmid p114-1 sequence 112917-112956 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP011283 Enterococcus faecium strain E39 plasmid p2, complete sequence 1425-1464 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP011284 Enterococcus faecium strain E39 plasmid p4, complete sequence 1419-1458 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP015123 Enterococcus faecium strain E39 plasmid p3, complete sequence 1464-1503 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_KP842560 Enterococcus faecium strain 17i48 ST17 plasmid pRUM-like, complete sequence 15645-15684 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_KP342511 Enterococcus faecium isolate N12-493 plasmid pEfm12493, complete sequence 15951-15990 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 LT603680 Enterococcus faecium isolate Ef_DMG1500501 genome assembly, plasmid: 3 1419-1458 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP018831 Enterococcus faecium strain ISMMS_VRE_9 plasmid p2_ISMMS_VRE9, complete sequence 2082-2121 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP018832 Enterococcus faecium strain ISMMS_VRE_9 plasmid p1_ISMMS_VRE9, complete sequence 8494-8533 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 CP003352 Enterococcus faecium Aus0004 plasmid AUS0004_p1, complete sequence 1419-1458 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP041264 Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R3, complete sequence 1420-1459 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP012367 Enterococcus durans strain KLDS 6.0933 plasmid unnamed 1, complete sequence 4310-4349 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP027499 Enterococcus faecium strain AUSMDU00004167 plasmid unnamed2, complete sequence 1419-1458 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP027510 Enterococcus faecium strain AUSMDU00004055 plasmid unnamed4, complete sequence 1419-1458 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP027502 Enterococcus faecium strain AUSMDU00004142 plasmid unnamed1, complete sequence 1424-1463 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP027505 Enterococcus faecium strain AUSMDU00004142 plasmid unnamed4, complete sequence 1419-1458 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135289 Enterococcus faecium isolate E7199 plasmid 3 7872-7911 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135290 Enterococcus faecium isolate E7199 plasmid 4 1419-1458 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135334 Enterococcus faecium isolate E7471 plasmid 4 18479-18518 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135335 Enterococcus faecium isolate E7471 plasmid 5 1419-1458 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP046075 Enterococcus faecium strain VRE plasmid p3_03A17012, complete sequence 1419-1458 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP046078 Enterococcus faecium strain VRE plasmid p4_03A17012, complete sequence 11271-11310 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP025755 Enterococcus faecium strain AALTL plasmid pEFA-790c, complete sequence 3761-3800 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP025756 Enterococcus faecium strain AALTL plasmid pEFA-99d7, complete sequence 152602-152641 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP027516 Enterococcus faecium strain AUSMDU00004028 plasmid unnamed4, complete sequence 1419-1458 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP013010 Enterococcus faecium strain UW7606x64/3 TC1 plasmid pWCF-TC1, complete sequence 57302-57341 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135281 Enterococcus faecium isolate E6975 plasmid 4 1419-1458 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135257 Enterococcus faecium isolate E7098 plasmid 4 1419-1458 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135238 Enterococcus faecium isolate E7067 plasmid 4 1419-1458 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135199 Enterococcus faecium isolate E6055 plasmid 3 1419-1458 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP041254 Enterococcus faecium strain 515 plasmid p169, complete sequence 54283-54322 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NC_021995 Enterococcus faecium Aus0085 plasmid p2, complete sequence 1417-1456 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP038175 Enterococcus faecium strain SDGJQ5 plasmid pSDGJQ5, complete sequence 15855-15894 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP017799 Enterococcus faecium strain E243 plasmid unnamed2, complete sequence 1464-1503 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135437 Enterococcus faecium isolate E8691 plasmid 3 1419-1458 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135484 Enterococcus faecium isolate E4456 plasmid 3 1419-1458 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135477 Enterococcus faecium isolate E8423 plasmid 3 1419-1458 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135477 Enterococcus faecium isolate E8423 plasmid 3 10254-10293 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135207 Enterococcus faecium isolate E7171 plasmid 5 1419-1458 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135175 Enterococcus faecium isolate E4402 plasmid 2 1424-1463 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135176 Enterococcus faecium isolate E4402 plasmid 3 1419-1458 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135180 Enterococcus faecium isolate E0595 plasmid 2 1424-1463 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135228 Enterococcus faecium isolate E7025 plasmid 3 1419-1458 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135221 Enterococcus faecium isolate E7040 plasmid 3 1419-1458 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NC_021987 Enterococcus faecium Aus0085 plasmid p1, complete sequence 2973-3012 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135326 Enterococcus faecium isolate E7654 plasmid 3 1419-1458 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135359 Enterococcus faecium isolate E7948 plasmid 3 1419-1458 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP044265 Enterococcus faecium strain V1836 plasmid pHVH-V1836-1, complete sequence 1424-1463 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135319 Enterococcus faecium isolate E7663 plasmid 3 1419-1458 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135374 Enterococcus faecium isolate E8172 plasmid 3 1419-1458 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135374 Enterococcus faecium isolate E8172 plasmid 3 54179-54218 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP006031 Enterococcus faecium T110 plasmid pEFT110, complete sequence 2353-2392 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR132068 Enterococcus faecium isolate E0139 plasmid 2 1424-1463 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP014530 Enterococcus faecium strain E745 plasmid pl1, complete sequence 201586-201625 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP023425 Enterococcus faecium strain K60-39 plasmid pTT39_p2, complete sequence 1419-1458 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_AP022342 Enterococcus faecium strain KUHS13 plasmid pKO1, complete sequence 1408-1447 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP041273 Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S3, complete sequence 1419-1458 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP040708 Enterococcus faecium strain HOU503 plasmid p2 27551-27590 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP040873 Enterococcus faecium strain DB-1 plasmid punnamed1 40953-40992 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP040876 Enterococcus faecium strain DB-1 plasmid punnamed2 3803-3842 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP017794 Enterococcus faecium strain E240 plasmid unnamed2, complete sequence 1437-1476 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP017795 Enterococcus faecium strain E240 plasmid unnamed3, complete sequence 1419-1458 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP035650 Enterococcus faecium strain UAMSEF_08 plasmid unnamed2, complete sequence 1419-1458 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP023790 Enterococcus faecium strain Efaecium_ER04462.3A plasmid pER04462.3A.1, complete sequence 24658-24697 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP023800 Enterococcus faecium strain Efaecium_ER04526.5A plasmid pER04526.5A.1, complete sequence 24658-24697 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR134096 Enterococcus faecium isolate E1334 plasmid 2 1424-1463 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP035644 Enterococcus faecium strain UAMSEF_01 plasmid unnamed2, complete sequence 1419-1458 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135193 Enterococcus faecium isolate E4438 plasmid 3 1419-1458 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP037956 Enterococcus hirae strain CQP3-9 plasmid pCQP3-9_1, complete sequence 36136-36175 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135309 Enterococcus faecium isolate E7240 plasmid 3 34936-34975 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135310 Enterococcus faecium isolate E7240 plasmid 4 1419-1458 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP040237 Enterococcus faecium strain VB3025 plasmid unnamed1, complete sequence 1424-1463 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP023809 Enterococcus faecium strain Efaecium_ER04526.3A plasmid pER04562.3A.1, complete sequence 24658-24697 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP023812 Enterococcus faecium strain Efaecium_ER04526.3A plasmid pER04562.3A.5, complete sequence 1419-1458 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP023805 Enterococcus faecium strain Efaecium_ER04619.3A isolate isolate plasmid pER04619.3A.1, complete sequence 24658-24697 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_AP019410 Enterococcus faecium strain SMVRE20 plasmid pSMVRE20S, complete sequence 1419-1458 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP016165 Enterococcus faecium strain ISMMS_VRE_11 plasmid ISMMS_VRE11_p2, complete sequence 43811-43850 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP016166 Enterococcus faecium strain ISMMS_VRE_11 plasmid ISMMS_VRE11_p3, complete sequence 46974-47013 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP018825 Enterococcus faecium strain ISMMS_VRE_12 plasmid p2_ISMMS_VRE12, complete sequence 2082-2121 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP018827 Enterococcus faecium strain ISMMS_VRE_12 plasmid p1_ISMMS_VRE12, complete sequence 8494-8533 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 LR135186 Enterococcus faecium isolate E4413 genome assembly, plasmid: 2 1424-1463 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP012432 Enterococcus faecium strain ISMMS_VRE_1 plasmid ISMMS_VRE_p1, complete sequence 32412-32451 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP023795 Enterococcus faecium strain Efaecium_ER04484.3A plasmid pER04484.3A.1, complete sequence 24658-24697 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP023796 Enterococcus faecium strain Efaecium_ER04484.3A plasmid pER04484.3A.2, complete sequence 1419-1458 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP023781 Enterococcus faecium strain Efaecium_ER03933.3A isolate isolate plasmid pER93933.3A.1, complete sequence 24658-24697 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LT598666 Enterococcus faecium isolate Ef_aus00233 plasmid 4 1419-1458 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_KX810025 Enterococcus faecium strain Efm008 plasmid pJEG040, complete sequence 34365-34404 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_KX574671 Enterococcus faecium strain V24 plasmid pHvH-V24, complete sequence 25039-25078 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_KY554216 Enterococcus faecium strain Efa-125 plasmid pEfa-125gr, complete sequence 26046-26085 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_KY595962 Enterococcus faecium strain VREfm1 plasmid pPEC286, complete sequence 32850-32889 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_KY595966 Enterococcus faecium strain VREfm81 plasmid pBUD102, complete sequence 25860-25899 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP040906 Enterococcus faecium strain FB-1 plasmid punnamed, complete sequence 50784-50823 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NC_021170 Enterococcus faecium plasmid pF856, complete sequence 27862-27901 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP027401 Enterococcus faecium strain FDAARGOS_323 plasmid unnamed, complete sequence 108476-108515 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP012385 Enterococcus durans strain KLDS 6.0930 plasmid unnamed 1, complete sequence 94136-94175 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP013995 Enterococcus faecium strain 6E6 plasmid unnamed1, complete sequence 294482-294521 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP014450 Enterococcus faecium strain ATCC 700221 plasmid unnamed1, complete sequence 118967-119006 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP014452 Enterococcus faecium strain ATCC 700221 plasmid unnamed3, complete sequence 13072-13111 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP018070 Enterococcus faecium strain VRE001 plasmid unnamed1, complete sequence 17437-17476 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135280 Enterococcus faecium isolate E6975 plasmid 3 53004-53043 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135200 Enterococcus faecium isolate E6055 plasmid 4 3451-3490 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135261 Enterococcus faecium isolate E4457 plasmid 4 40991-41030 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP041258 Enterococcus faecium strain 515 plasmid p27, complete sequence 79107-79146 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NC_005000 Enterococcus faecium U37 plasmid pRUM, complete sequence 20125-20164 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135347 Enterococcus faecium isolate E8202 plasmid 4 4619-4658 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP050649 Enterococcus faecium strain BIOPOP-3 ALE plasmid pBIOPOP-3_ALE 90445-90484 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP050651 Enterococcus faecium strain BIOPOP-3 WT plasmid pBIOPOP-3_WT 101469-101508 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP044266 Enterococcus faecium strain V1836 plasmid pHVH-V1836-2, complete sequence 30704-30743 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP015517 Enterococcus hirae strain R17 plasmid, complete sequence 12205-12244 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LN999989 Enterococcus faecium isolate EFE11651 plasmid III, complete sequence 4932-4971 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP033042 Enterococcus faecium strain Enterococcus faecium JE1 plasmid unnamed, complete sequence 51680-51719 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NC_014959 Enterococcus faecium plasmid pS177, complete sequence 35758-35797 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP035661 Enterococcus faecium strain UAMSEF_09 plasmid unnamed1, complete sequence 217109-217148 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP035667 Enterococcus faecium strain UAMSEF_20 plasmid unnamed1, complete sequence 216978-217017 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NC_017962 Enterococcus faecium DO plasmid 2, complete sequence 53450-53489 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP018129 Enterococcus faecium strain A_020709_82 plasmid unnamed1, complete sequence 16132-16171 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP012463 Enterococcus faecium strain ISMMS_VRE_7 plasmid ISMMS_VRE7_p3, complete sequence 48411-48450 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP012464 Enterococcus faecium strain ISMMS_VRE_7 plasmid ISMMS_VRE7_p4, complete sequence 34676-34715 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP012431 Enterococcus faecium strain ISMMS_VRE_1 plasmid ISMMS_VRE_p2, complete sequence 34371-34410 8 0.8
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135298 Enterococcus faecium isolate E7429 plasmid 2 1424-1463 9 0.775
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135340 Enterococcus faecium isolate E7356 plasmid 2 1424-1463 9 0.775
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP027513 Enterococcus faecium strain AUSMDU00004028 plasmid unnamed1, complete sequence 1424-1463 9 0.775
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135294 Enterococcus faecium isolate E7237 plasmid 2 1424-1463 9 0.775
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135198 Enterococcus faecium isolate E6055 plasmid 2 1424-1463 9 0.775
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135483 Enterococcus faecium isolate E4456 plasmid 2 1424-1463 9 0.775
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135204 Enterococcus faecium isolate E7171 plasmid 2 1424-1463 9 0.775
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135489 Enterococcus faecium isolate E8414 plasmid 2 1424-1463 9 0.775
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135365 Enterococcus faecium isolate E8195 plasmid 2 1424-1463 9 0.775
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135415 Enterococcus faecium isolate E8328 plasmid 2 1424-1463 9 0.775
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135395 Enterococcus faecium isolate E8290 plasmid 2 1424-1463 9 0.775
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135345 Enterococcus faecium isolate E8202 plasmid 2 1424-1463 9 0.775
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135409 Enterococcus faecium isolate E8284 plasmid 2 1424-1463 9 0.775
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135385 Enterococcus faecium isolate E7933 plasmid 2 1424-1463 9 0.775
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135386 Enterococcus faecium isolate E7933 plasmid 3 1419-1458 9 0.775
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LR135373 Enterococcus faecium isolate E8172 plasmid 2 1424-1463 9 0.775
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP044275 Enterococcus faecium strain V2937 plasmid pHVH-V2937-1, complete sequence 1424-1463 9 0.775
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP018066 Enterococcus faecium strain E1 plasmid pE1_230, complete sequence 226583-226622 9 0.775
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_CP016164 Enterococcus faecium strain ISMMS_VRE_11 plasmid ISMMS_VRE11_p1, complete sequence 178249-178288 9 0.775
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NC_017963 Enterococcus faecium DO plasmid 3, complete sequence 32125-32164 9 0.775
NZ_CP038997_2 2.3|10009|40|NZ_CP038997|CRISPRCasFinder 10009-10048 40 NZ_LT598664 Enterococcus faecium isolate Ef_aus00233 plasmid 2 167291-167330 9 0.775

1. spacer 1.1|9599|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP038997 (Enterococcus faecium strain SRR24 plasmid pSRR24) position: , mismatch: 0, identity: 1.0

gtgatagatctcaattcaaccactaaggcaatttgagaaa	CRISPR spacer
gtgatagatctcaattcaaccactaaggcaatttgagaaa	Protospacer
****************************************

2. spacer 1.1|9599|40|NZ_CP038997|CRISPRCasFinder matches to NZ_AP022343 (Enterococcus faecium strain KUHS13 plasmid pELF2) position: , mismatch: 0, identity: 1.0

gtgatagatctcaattcaaccactaaggcaatttgagaaa	CRISPR spacer
gtgatagatctcaattcaaccactaaggcaatttgagaaa	Protospacer
****************************************

3. spacer 1.1|9599|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP019994 (Enterococcus faecium isolate 2014-VREF-268 plasmid p268-2) position: , mismatch: 0, identity: 1.0

gtgatagatctcaattcaaccactaaggcaatttgagaaa	CRISPR spacer
gtgatagatctcaattcaaccactaaggcaatttgagaaa	Protospacer
****************************************

4. spacer 1.1|9599|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP019971 (Enterococcus faecium isolate 2014-VREF-114 plasmid p114-1 sequence) position: , mismatch: 0, identity: 1.0

gtgatagatctcaattcaaccactaaggcaatttgagaaa	CRISPR spacer
gtgatagatctcaattcaaccactaaggcaatttgagaaa	Protospacer
****************************************

5. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP011282 (Enterococcus faecium strain E39 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

6. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP011283 (Enterococcus faecium strain E39 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

7. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP011284 (Enterococcus faecium strain E39 plasmid p4, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

8. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP015123 (Enterococcus faecium strain E39 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

9. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_KP842560 (Enterococcus faecium strain 17i48 ST17 plasmid pRUM-like, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

10. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_KP342511 (Enterococcus faecium isolate N12-493 plasmid pEfm12493, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

11. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to LT603679 (Enterococcus faecium isolate Ef_DMG1500501 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

12. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to LT603680 (Enterococcus faecium isolate Ef_DMG1500501 genome assembly, plasmid: 3) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

13. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP018831 (Enterococcus faecium strain ISMMS_VRE_9 plasmid p2_ISMMS_VRE9, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

14. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP018832 (Enterococcus faecium strain ISMMS_VRE_9 plasmid p1_ISMMS_VRE9, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

15. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP018832 (Enterococcus faecium strain ISMMS_VRE_9 plasmid p1_ISMMS_VRE9, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

16. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to CP003352 (Enterococcus faecium Aus0004 plasmid AUS0004_p1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

17. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP041264 (Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R3, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

18. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP012367 (Enterococcus durans strain KLDS 6.0933 plasmid unnamed 1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

19. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP018073 (Enterococcus faecium strain VRE001 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

20. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP027498 (Enterococcus faecium strain AUSMDU00004167 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

21. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP027499 (Enterococcus faecium strain AUSMDU00004167 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

22. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP027508 (Enterococcus faecium strain AUSMDU00004055 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

23. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP027510 (Enterococcus faecium strain AUSMDU00004055 plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

24. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP027502 (Enterococcus faecium strain AUSMDU00004142 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

25. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP027503 (Enterococcus faecium strain AUSMDU00004142 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

26. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP027505 (Enterococcus faecium strain AUSMDU00004142 plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

27. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135288 (Enterococcus faecium isolate E7199 plasmid 2) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

28. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135289 (Enterococcus faecium isolate E7199 plasmid 3) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

29. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135290 (Enterococcus faecium isolate E7199 plasmid 4) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

30. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135333 (Enterococcus faecium isolate E7471 plasmid 3) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

31. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135334 (Enterococcus faecium isolate E7471 plasmid 4) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

32. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135335 (Enterococcus faecium isolate E7471 plasmid 5) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

33. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP046075 (Enterococcus faecium strain VRE plasmid p3_03A17012, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

34. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP046076 (Enterococcus faecium strain VRE plasmid p5_03A17012, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

35. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP046078 (Enterococcus faecium strain VRE plasmid p4_03A17012, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

36. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to MT074686 (Enterococcus faecium strain E1077 plasmid pE1077-217, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

37. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP025755 (Enterococcus faecium strain AALTL plasmid pEFA-790c, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

38. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP025756 (Enterococcus faecium strain AALTL plasmid pEFA-99d7, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

39. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP025756 (Enterococcus faecium strain AALTL plasmid pEFA-99d7, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

40. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP027514 (Enterococcus faecium strain AUSMDU00004028 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

41. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP027516 (Enterococcus faecium strain AUSMDU00004028 plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

42. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP013010 (Enterococcus faecium strain UW7606x64/3 TC1 plasmid pWCF-TC1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

43. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135281 (Enterococcus faecium isolate E6975 plasmid 4) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

44. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135255 (Enterococcus faecium isolate E7098 plasmid 2) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

45. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135257 (Enterococcus faecium isolate E7098 plasmid 4) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

46. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135238 (Enterococcus faecium isolate E7067 plasmid 4) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

47. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135199 (Enterococcus faecium isolate E6055 plasmid 3) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

48. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135259 (Enterococcus faecium isolate E4457 plasmid 2) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

49. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP038997 (Enterococcus faecium strain SRR24 plasmid pSRR24) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

50. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135182 (Enterococcus faecium isolate E1774 plasmid 2) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

51. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP041254 (Enterococcus faecium strain 515 plasmid p169, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

52. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NC_021995 (Enterococcus faecium Aus0085 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

53. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP038175 (Enterococcus faecium strain SDGJQ5 plasmid pSDGJQ5, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

54. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP017798 (Enterococcus faecium strain E243 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

55. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP017799 (Enterococcus faecium strain E243 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

56. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135436 (Enterococcus faecium isolate E8691 plasmid 2) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

57. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135437 (Enterococcus faecium isolate E8691 plasmid 3) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

58. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135484 (Enterococcus faecium isolate E4456 plasmid 3) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

59. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135477 (Enterococcus faecium isolate E8423 plasmid 3) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

60. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135477 (Enterococcus faecium isolate E8423 plasmid 3) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

61. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135207 (Enterococcus faecium isolate E7171 plasmid 5) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

62. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135175 (Enterococcus faecium isolate E4402 plasmid 2) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

63. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135176 (Enterococcus faecium isolate E4402 plasmid 3) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

64. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135180 (Enterococcus faecium isolate E0595 plasmid 2) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

65. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135227 (Enterococcus faecium isolate E7025 plasmid 2) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

66. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135228 (Enterococcus faecium isolate E7025 plasmid 3) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

67. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135221 (Enterococcus faecium isolate E7040 plasmid 3) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

68. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NC_021987 (Enterococcus faecium Aus0085 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

69. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NC_021987 (Enterococcus faecium Aus0085 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

70. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135326 (Enterococcus faecium isolate E7654 plasmid 3) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

71. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135359 (Enterococcus faecium isolate E7948 plasmid 3) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

72. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP044265 (Enterococcus faecium strain V1836 plasmid pHVH-V1836-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

73. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135319 (Enterococcus faecium isolate E7663 plasmid 3) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

74. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135374 (Enterococcus faecium isolate E8172 plasmid 3) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

75. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135374 (Enterococcus faecium isolate E8172 plasmid 3) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

76. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP006031 (Enterococcus faecium T110 plasmid pEFT110, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

77. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR132068 (Enterococcus faecium isolate E0139 plasmid 2) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

78. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_AP019395 (Enterococcus faecium strain QU 50 plasmid pQL50, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

79. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP014530 (Enterococcus faecium strain E745 plasmid pl1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

80. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP014534 (Enterococcus faecium strain E745 plasmid pl5, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

81. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP023425 (Enterococcus faecium strain K60-39 plasmid pTT39_p2, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

82. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_AP022342 (Enterococcus faecium strain KUHS13 plasmid pKO1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

83. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP041273 (Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S3, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

84. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP040704 (Enterococcus faecium strain HOU503 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

85. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP040708 (Enterococcus faecium strain HOU503 plasmid p2) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

86. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP040873 (Enterococcus faecium strain DB-1 plasmid punnamed1) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

87. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP040876 (Enterococcus faecium strain DB-1 plasmid punnamed2) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

88. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP017793 (Enterococcus faecium strain E240 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

89. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP017794 (Enterococcus faecium strain E240 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

90. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP017795 (Enterococcus faecium strain E240 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

91. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP035650 (Enterococcus faecium strain UAMSEF_08 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

92. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP023790 (Enterococcus faecium strain Efaecium_ER04462.3A plasmid pER04462.3A.1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

93. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP023790 (Enterococcus faecium strain Efaecium_ER04462.3A plasmid pER04462.3A.1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

94. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP023800 (Enterococcus faecium strain Efaecium_ER04526.5A plasmid pER04526.5A.1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

95. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP023800 (Enterococcus faecium strain Efaecium_ER04526.5A plasmid pER04526.5A.1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

96. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP035137 (Enterococcus faecium strain SRCM103341 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

97. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR134096 (Enterococcus faecium isolate E1334 plasmid 2) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

98. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP035644 (Enterococcus faecium strain UAMSEF_01 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

99. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP040850 (Enterococcus faecium strain F17E0263 plasmid p_unnamned1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

100. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135192 (Enterococcus faecium isolate E4438 plasmid 2) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

101. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135193 (Enterococcus faecium isolate E4438 plasmid 3) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

102. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP019971 (Enterococcus faecium isolate 2014-VREF-114 plasmid p114-1 sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

103. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP019971 (Enterococcus faecium isolate 2014-VREF-114 plasmid p114-1 sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

104. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP037956 (Enterococcus hirae strain CQP3-9 plasmid pCQP3-9_1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

105. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135308 (Enterococcus faecium isolate E7240 plasmid 2) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

106. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135309 (Enterococcus faecium isolate E7240 plasmid 3) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

107. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135310 (Enterococcus faecium isolate E7240 plasmid 4) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

108. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP040237 (Enterococcus faecium strain VB3025 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

109. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP023809 (Enterococcus faecium strain Efaecium_ER04526.3A plasmid pER04562.3A.1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

110. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP023809 (Enterococcus faecium strain Efaecium_ER04526.3A plasmid pER04562.3A.1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

111. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP023812 (Enterococcus faecium strain Efaecium_ER04526.3A plasmid pER04562.3A.5, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

112. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP033208 (Enterococcus faecium strain RBWH1 plasmid pRBWH1.2, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

113. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP023805 (Enterococcus faecium strain Efaecium_ER04619.3A isolate isolate plasmid pER04619.3A.1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

114. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP023805 (Enterococcus faecium strain Efaecium_ER04619.3A isolate isolate plasmid pER04619.3A.1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

115. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP035221 (Enterococcus faecium strain SRCM103470 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

116. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_AP019410 (Enterococcus faecium strain SMVRE20 plasmid pSMVRE20S, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

117. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_AP019409 (Enterococcus faecium strain SMVRE20 plasmid pSMVRE20L, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

118. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NC_020208 (Enterococcus faecium ATCC 8459 = NRRL B-2354 plasmid pNB2354_1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

119. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP034948 (Enterococcus faecium strain NM213 plasmid unnamed5, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

120. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP016165 (Enterococcus faecium strain ISMMS_VRE_11 plasmid ISMMS_VRE11_p2, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

121. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP016166 (Enterococcus faecium strain ISMMS_VRE_11 plasmid ISMMS_VRE11_p3, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

122. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP018825 (Enterococcus faecium strain ISMMS_VRE_12 plasmid p2_ISMMS_VRE12, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

123. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP018827 (Enterococcus faecium strain ISMMS_VRE_12 plasmid p1_ISMMS_VRE12, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

124. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP018827 (Enterococcus faecium strain ISMMS_VRE_12 plasmid p1_ISMMS_VRE12, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

125. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to LR135186 (Enterococcus faecium isolate E4413 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

126. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP012432 (Enterococcus faecium strain ISMMS_VRE_1 plasmid ISMMS_VRE_p1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

127. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP023795 (Enterococcus faecium strain Efaecium_ER04484.3A plasmid pER04484.3A.1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

128. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP023795 (Enterococcus faecium strain Efaecium_ER04484.3A plasmid pER04484.3A.1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

129. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP023796 (Enterococcus faecium strain Efaecium_ER04484.3A plasmid pER04484.3A.2, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

130. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_MG674581 (Enterococcus faecium strain HL1 plasmid pHLSA, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

131. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP023781 (Enterococcus faecium strain Efaecium_ER03933.3A isolate isolate plasmid pER93933.3A.1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

132. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP023781 (Enterococcus faecium strain Efaecium_ER03933.3A isolate isolate plasmid pER93933.3A.1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

133. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LT598666 (Enterococcus faecium isolate Ef_aus00233 plasmid 4) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

134. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_KX810025 (Enterococcus faecium strain Efm008 plasmid pJEG040, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

135. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_KX574671 (Enterococcus faecium strain V24 plasmid pHvH-V24, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

136. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_KY554216 (Enterococcus faecium strain Efa-125 plasmid pEfa-125gr, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

137. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_KY595962 (Enterococcus faecium strain VREfm1 plasmid pPEC286, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

138. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_KY595966 (Enterococcus faecium strain VREfm81 plasmid pBUD102, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

139. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP040906 (Enterococcus faecium strain FB-1 plasmid punnamed, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

140. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NC_021170 (Enterococcus faecium plasmid pF856, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

141. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP027401 (Enterococcus faecium strain FDAARGOS_323 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

142. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP012385 (Enterococcus durans strain KLDS 6.0930 plasmid unnamed 1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

143. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP013995 (Enterococcus faecium strain 6E6 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

144. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP014450 (Enterococcus faecium strain ATCC 700221 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

145. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP014452 (Enterococcus faecium strain ATCC 700221 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

146. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP018070 (Enterococcus faecium strain VRE001 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

147. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135246 (Enterococcus faecium isolate E6988 plasmid 4) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

148. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135280 (Enterococcus faecium isolate E6975 plasmid 3) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

149. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135237 (Enterococcus faecium isolate E7067 plasmid 3) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

150. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135200 (Enterococcus faecium isolate E6055 plasmid 4) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

151. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135261 (Enterococcus faecium isolate E4457 plasmid 4) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

152. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP041256 (Enterococcus faecium strain 515 plasmid p26, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

153. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP041258 (Enterococcus faecium strain 515 plasmid p27, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

154. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NC_005000 (Enterococcus faecium U37 plasmid pRUM, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

155. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135222 (Enterococcus faecium isolate E7040 plasmid 4) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

156. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135347 (Enterococcus faecium isolate E8202 plasmid 4) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

157. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP050649 (Enterococcus faecium strain BIOPOP-3 ALE plasmid pBIOPOP-3_ALE) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

158. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP050651 (Enterococcus faecium strain BIOPOP-3 WT plasmid pBIOPOP-3_WT) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

159. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP044266 (Enterococcus faecium strain V1836 plasmid pHVH-V1836-2, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

160. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR134108 (Enterococcus faecium isolate E6043 plasmid 4) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

161. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP015517 (Enterococcus hirae strain R17 plasmid, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

162. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP011829 (Enterococcus faecium strain UW8175 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

163. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LN999988 (Enterococcus faecium isolate EFE11651 plasmid II, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

164. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LN999989 (Enterococcus faecium isolate EFE11651 plasmid III, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

165. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP033042 (Enterococcus faecium strain Enterococcus faecium JE1 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

166. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP025687 (Enterococcus faecium strain CBA7134 plasmid pCBA710401, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

167. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_AP022343 (Enterococcus faecium strain KUHS13 plasmid pELF2) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

168. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NC_014959 (Enterococcus faecium plasmid pS177, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

169. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP040877 (Enterococcus faecium strain HB-1 plasmid punnamed, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

170. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP032307 (Enterococcus faecium strain HY07 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

171. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP019993 (Enterococcus faecium isolate 2014-VREF-268 plasmid p268-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

172. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP019994 (Enterococcus faecium isolate 2014-VREF-268 plasmid p268-2) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

173. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP035661 (Enterococcus faecium strain UAMSEF_09 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

174. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP035667 (Enterococcus faecium strain UAMSEF_20 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

175. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NC_017962 (Enterococcus faecium DO plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

176. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP042840 (Enterococcus sp. DA9 plasmid unnamed4) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

177. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP033207 (Enterococcus faecium strain RBWH1 plasmid pRBWH1.1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

178. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP018129 (Enterococcus faecium strain A_020709_82 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

179. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP042833 (Enterococcus faecium strain FA3 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

180. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP012461 (Enterococcus faecium strain ISMMS_VRE_7 plasmid ISMMS_VRE7_p1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

181. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP012463 (Enterococcus faecium strain ISMMS_VRE_7 plasmid ISMMS_VRE7_p3, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

182. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP012464 (Enterococcus faecium strain ISMMS_VRE_7 plasmid ISMMS_VRE7_p4, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

183. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP012431 (Enterococcus faecium strain ISMMS_VRE_1 plasmid ISMMS_VRE_p2, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcact	Protospacer
****************************

184. spacer 2.2|10081|25|NZ_CP038997|PILER-CR matches to NZ_AP022343 (Enterococcus faecium strain KUHS13 plasmid pELF2) position: , mismatch: 0, identity: 1.0

tcgaatcatttttcttaacatctca	CRISPR spacer
tcgaatcatttttcttaacatctca	Protospacer
*************************

185. spacer 2.2|10081|25|NZ_CP038997|PILER-CR matches to NZ_CP019994 (Enterococcus faecium isolate 2014-VREF-268 plasmid p268-2) position: , mismatch: 0, identity: 1.0

tcgaatcatttttcttaacatctca	CRISPR spacer
tcgaatcatttttcttaacatctca	Protospacer
*************************

186. spacer 2.2|10081|25|NZ_CP038997|PILER-CR matches to NZ_CP038997 (Enterococcus faecium strain SRR24 plasmid pSRR24) position: , mismatch: 0, identity: 1.0

tcgaatcatttttcttaacatctca	CRISPR spacer
tcgaatcatttttcttaacatctca	Protospacer
*************************

187. spacer 2.2|10081|25|NZ_CP038997|PILER-CR matches to NZ_CP019971 (Enterococcus faecium isolate 2014-VREF-114 plasmid p114-1 sequence) position: , mismatch: 0, identity: 1.0

tcgaatcatttttcttaacatctca	CRISPR spacer
tcgaatcatttttcttaacatctca	Protospacer
*************************

188. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP038997 (Enterococcus faecium strain SRR24 plasmid pSRR24) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcactttatttgagaaa	Protospacer
****************************************

189. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP019971 (Enterococcus faecium isolate 2014-VREF-114 plasmid p114-1 sequence) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcactttatttgagaaa	Protospacer
****************************************

190. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_AP022343 (Enterococcus faecium strain KUHS13 plasmid pELF2) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcactttatttgagaaa	Protospacer
****************************************

191. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP019994 (Enterococcus faecium isolate 2014-VREF-268 plasmid p268-2) position: , mismatch: 0, identity: 1.0

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcactttatttgagaaa	Protospacer
****************************************

192. spacer 2.4|10075|40|NZ_CP038997|CRISPRCasFinder matches to NZ_AP022343 (Enterococcus faecium strain KUHS13 plasmid pELF2) position: , mismatch: 0, identity: 1.0

ctctcgaatcatttttcttaacatctcataatttgagaaa	CRISPR spacer
ctctcgaatcatttttcttaacatctcataatttgagaaa	Protospacer
****************************************

193. spacer 2.4|10075|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP019994 (Enterococcus faecium isolate 2014-VREF-268 plasmid p268-2) position: , mismatch: 0, identity: 1.0

ctctcgaatcatttttcttaacatctcataatttgagaaa	CRISPR spacer
ctctcgaatcatttttcttaacatctcataatttgagaaa	Protospacer
****************************************

194. spacer 2.4|10075|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP038997 (Enterococcus faecium strain SRR24 plasmid pSRR24) position: , mismatch: 0, identity: 1.0

ctctcgaatcatttttcttaacatctcataatttgagaaa	CRISPR spacer
ctctcgaatcatttttcttaacatctcataatttgagaaa	Protospacer
****************************************

195. spacer 2.4|10075|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP019971 (Enterococcus faecium isolate 2014-VREF-114 plasmid p114-1 sequence) position: , mismatch: 0, identity: 1.0

ctctcgaatcatttttcttaacatctcataatttgagaaa	CRISPR spacer
ctctcgaatcatttttcttaacatctcataatttgagaaa	Protospacer
****************************************

196. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP013995 (Enterococcus faecium strain 6E6 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.964

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttttgcact	Protospacer
*********************.******

197. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP035661 (Enterococcus faecium strain UAMSEF_09 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.964

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttttgcact	Protospacer
*********************.******

198. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP035667 (Enterococcus faecium strain UAMSEF_20 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.964

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttttgcact	Protospacer
*********************.******

199. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NC_022883 (Enterococcus mundtii QU 25 plasmid pQY082, complete sequence) position: , mismatch: 1, identity: 0.964

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttctgcaca	Protospacer
*************************** 

200. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP040369 (Enterococcus faecium strain VB3240 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.964

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttttgcact	Protospacer
*********************.******

201. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP020485 (Enterococcus faecium strain CFSAN059070 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.964

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttttgcact	Protospacer
*********************.******

202. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP041262 (Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R1, complete sequence) position: , mismatch: 1, identity: 0.964

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttttgcact	Protospacer
*********************.******

203. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP027518 (Enterococcus faecium strain AUSMDU00004024 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.964

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttttgcact	Protospacer
*********************.******

204. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP027507 (Enterococcus faecium strain AUSMDU00004055 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.964

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttttgcact	Protospacer
*********************.******

205. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135298 (Enterococcus faecium isolate E7429 plasmid 2) position: , mismatch: 1, identity: 0.964

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattaattttcgttctgcact	Protospacer
***********.****************

206. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135340 (Enterococcus faecium isolate E7356 plasmid 2) position: , mismatch: 1, identity: 0.964

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattaattttcgttctgcact	Protospacer
***********.****************

207. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP027513 (Enterococcus faecium strain AUSMDU00004028 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.964

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattaattttcgttctgcact	Protospacer
***********.****************

208. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135244 (Enterococcus faecium isolate E6988 plasmid 2) position: , mismatch: 1, identity: 0.964

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttttgcact	Protospacer
*********************.******

209. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135279 (Enterococcus faecium isolate E6975 plasmid 2) position: , mismatch: 1, identity: 0.964

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttttgcact	Protospacer
*********************.******

210. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135783 (Enterococcus faecium isolate E4239 plasmid 2) position: , mismatch: 1, identity: 0.964

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttttgcact	Protospacer
*********************.******

211. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135294 (Enterococcus faecium isolate E7237 plasmid 2) position: , mismatch: 1, identity: 0.964

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattaattttcgttctgcact	Protospacer
***********.****************

212. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135236 (Enterococcus faecium isolate E7067 plasmid 2) position: , mismatch: 1, identity: 0.964

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttttgcact	Protospacer
*********************.******

213. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135198 (Enterococcus faecium isolate E6055 plasmid 2) position: , mismatch: 1, identity: 0.964

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattaattttcgttctgcact	Protospacer
***********.****************

214. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP019209 (Enterococcus faecium strain 2014-VREF-41 plasmid p41-1, complete sequence) position: , mismatch: 1, identity: 0.964

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttttgcact	Protospacer
*********************.******

215. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135429 (Enterococcus faecium isolate E8927 plasmid 2) position: , mismatch: 1, identity: 0.964

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttttgcact	Protospacer
*********************.******

216. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135483 (Enterococcus faecium isolate E4456 plasmid 2) position: , mismatch: 1, identity: 0.964

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattaattttcgttctgcact	Protospacer
***********.****************

217. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135476 (Enterococcus faecium isolate E8423 plasmid 2) position: , mismatch: 1, identity: 0.964

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttttgcact	Protospacer
*********************.******

218. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135204 (Enterococcus faecium isolate E7171 plasmid 2) position: , mismatch: 1, identity: 0.964

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattaattttcgttctgcact	Protospacer
***********.****************

219. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135489 (Enterococcus faecium isolate E8414 plasmid 2) position: , mismatch: 1, identity: 0.964

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattaattttcgttctgcact	Protospacer
***********.****************

220. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135365 (Enterococcus faecium isolate E8195 plasmid 2) position: , mismatch: 1, identity: 0.964

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattaattttcgttctgcact	Protospacer
***********.****************

221. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135220 (Enterococcus faecium isolate E7040 plasmid 2) position: , mismatch: 1, identity: 0.964

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttttgcact	Protospacer
*********************.******

222. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135415 (Enterococcus faecium isolate E8328 plasmid 2) position: , mismatch: 1, identity: 0.964

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattaattttcgttctgcact	Protospacer
***********.****************

223. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135395 (Enterococcus faecium isolate E8290 plasmid 2) position: , mismatch: 1, identity: 0.964

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattaattttcgttctgcact	Protospacer
***********.****************

224. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135345 (Enterococcus faecium isolate E8202 plasmid 2) position: , mismatch: 1, identity: 0.964

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattaattttcgttctgcact	Protospacer
***********.****************

225. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135325 (Enterococcus faecium isolate E7654 plasmid 2) position: , mismatch: 1, identity: 0.964

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttttgcact	Protospacer
*********************.******

226. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135358 (Enterococcus faecium isolate E7948 plasmid 2) position: , mismatch: 1, identity: 0.964

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttttgcact	Protospacer
*********************.******

227. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135409 (Enterococcus faecium isolate E8284 plasmid 2) position: , mismatch: 1, identity: 0.964

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattaattttcgttctgcact	Protospacer
***********.****************

228. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135352 (Enterococcus faecium isolate E8014 plasmid 2) position: , mismatch: 1, identity: 0.964

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttttgcact	Protospacer
*********************.******

229. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135385 (Enterococcus faecium isolate E7933 plasmid 2) position: , mismatch: 1, identity: 0.964

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattaattttcgttctgcact	Protospacer
***********.****************

230. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135386 (Enterococcus faecium isolate E7933 plasmid 3) position: , mismatch: 1, identity: 0.964

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcattctgcact	Protospacer
******************.*********

231. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135318 (Enterococcus faecium isolate E7663 plasmid 2) position: , mismatch: 1, identity: 0.964

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttttgcact	Protospacer
*********************.******

232. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR134106 (Enterococcus faecium isolate E6043 plasmid 2) position: , mismatch: 1, identity: 0.964

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttttgcact	Protospacer
*********************.******

233. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135373 (Enterococcus faecium isolate E8172 plasmid 2) position: , mismatch: 1, identity: 0.964

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattaattttcgttctgcact	Protospacer
***********.****************

234. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP045013 (Enterococcus faecium strain LAC7.2 plasmid pI, complete sequence) position: , mismatch: 1, identity: 0.964

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttttgcact	Protospacer
*********************.******

235. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP040741 (Enterococcus faecium strain VRE1 plasmid pVRE1-1, complete sequence) position: , mismatch: 1, identity: 0.964

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttttgcact	Protospacer
*********************.******

236. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP023424 (Enterococcus faecium strain K60-39 plasmid pTT39_p1, complete sequence) position: , mismatch: 1, identity: 0.964

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttttgcact	Protospacer
*********************.******

237. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP044275 (Enterococcus faecium strain V2937 plasmid pHVH-V2937-1, complete sequence) position: , mismatch: 1, identity: 0.964

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattaattttcgttctgcact	Protospacer
***********.****************

238. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP035655 (Enterococcus faecium strain UAMSEF_08 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.964

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttttgcact	Protospacer
*********************.******

239. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP035649 (Enterococcus faecium strain UAMSEF_01 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.964

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttttgcact	Protospacer
*********************.******

240. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LR135171 (Enterococcus faecium isolate E4227 plasmid 2) position: , mismatch: 1, identity: 0.964

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttttgcact	Protospacer
*********************.******

241. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP041271 (Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S1, complete sequence) position: , mismatch: 1, identity: 0.964

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttttgcact	Protospacer
*********************.******

242. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP018066 (Enterococcus faecium strain E1 plasmid pE1_230, complete sequence) position: , mismatch: 1, identity: 0.964

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattaattttcgttctgcact	Protospacer
***********.****************

243. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP016164 (Enterococcus faecium strain ISMMS_VRE_11 plasmid ISMMS_VRE11_p1, complete sequence) position: , mismatch: 1, identity: 0.964

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattaattttcgttctgcact	Protospacer
***********.****************

244. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP025426 (Enterococcus faecium strain SC4 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.964

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttttgcact	Protospacer
*********************.******

245. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP040905 (Enterococcus faecium strain N56454 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.964

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttttgcact	Protospacer
*********************.******

246. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP019989 (Enterococcus faecium isolate 2014-VREF-63 plasmid p63-1, complete sequence) position: , mismatch: 1, identity: 0.964

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgattttcgttttgcact	Protospacer
*********************.******

247. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NC_017963 (Enterococcus faecium DO plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.964

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattaattttcgttctgcact	Protospacer
***********.****************

248. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_LT598664 (Enterococcus faecium isolate Ef_aus00233 plasmid 2) position: , mismatch: 1, identity: 0.964

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattaattttcgttctgcact	Protospacer
***********.****************

249. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP019974 (Enterococcus faecium isolate 2014-VREF-114 plasmid p114-4 sequence) position: , mismatch: 1, identity: 0.964

tgtgatgaattgattttcg-ttctgcact	CRISPR spacer
tgtgatgaattgattttcgtttctgcac-	Protospacer
******************* ******** 

250. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to NZ_CP040851 (Enterococcus faecium strain F17E0263 plasmid p_unnamned2, complete sequence) position: , mismatch: 2, identity: 0.929

tgtgatgaattgattttcgttctgcact	CRISPR spacer
tgtgatgaattgatttttgttctgcacc	Protospacer
*****************.*********.

251. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP011282 (Enterococcus faecium strain E39 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.875

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggatgataa-	Protospacer
*************************** ***.  *** ** 

252. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to LT603679 (Enterococcus faecium isolate Ef_DMG1500501 genome assembly, plasmid: 2) position: , mismatch: 5, identity: 0.875

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggatgataa-	Protospacer
*************************** ***.  *** ** 

253. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP018832 (Enterococcus faecium strain ISMMS_VRE_9 plasmid p1_ISMMS_VRE9, complete sequence) position: , mismatch: 5, identity: 0.875

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggatgataa-	Protospacer
*************************** ***.  *** ** 

254. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP018073 (Enterococcus faecium strain VRE001 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.875

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggatgataa-	Protospacer
*************************** ***.  *** ** 

255. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP027498 (Enterococcus faecium strain AUSMDU00004167 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.875

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggatgataa-	Protospacer
*************************** ***.  *** ** 

256. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135288 (Enterococcus faecium isolate E7199 plasmid 2) position: , mismatch: 5, identity: 0.875

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggatgataa-	Protospacer
*************************** ***.  *** ** 

257. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135333 (Enterococcus faecium isolate E7471 plasmid 3) position: , mismatch: 5, identity: 0.875

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggatgataa-	Protospacer
*************************** ***.  *** ** 

258. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP046076 (Enterococcus faecium strain VRE plasmid p5_03A17012, complete sequence) position: , mismatch: 5, identity: 0.875

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggatgataa-	Protospacer
*************************** ***.  *** ** 

259. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to MT074686 (Enterococcus faecium strain E1077 plasmid pE1077-217, complete sequence) position: , mismatch: 5, identity: 0.875

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggatgataa-	Protospacer
*************************** ***.  *** ** 

260. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP025756 (Enterococcus faecium strain AALTL plasmid pEFA-99d7, complete sequence) position: , mismatch: 5, identity: 0.875

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggatgataa-	Protospacer
*************************** ***.  *** ** 

261. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135255 (Enterococcus faecium isolate E7098 plasmid 2) position: , mismatch: 5, identity: 0.875

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggatgataa-	Protospacer
*************************** ***.  *** ** 

262. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135259 (Enterococcus faecium isolate E4457 plasmid 2) position: , mismatch: 5, identity: 0.875

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggatgataa-	Protospacer
*************************** ***.  *** ** 

263. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135182 (Enterococcus faecium isolate E1774 plasmid 2) position: , mismatch: 5, identity: 0.875

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggatgataa-	Protospacer
*************************** ***.  *** ** 

264. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP017798 (Enterococcus faecium strain E243 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.875

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggatgataa-	Protospacer
*************************** ***.  *** ** 

265. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135436 (Enterococcus faecium isolate E8691 plasmid 2) position: , mismatch: 5, identity: 0.875

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggatgataa-	Protospacer
*************************** ***.  *** ** 

266. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135227 (Enterococcus faecium isolate E7025 plasmid 2) position: , mismatch: 5, identity: 0.875

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggatgataa-	Protospacer
*************************** ***.  *** ** 

267. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NC_021987 (Enterococcus faecium Aus0085 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.875

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggatgataa-	Protospacer
*************************** ***.  *** ** 

268. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_AP019395 (Enterococcus faecium strain QU 50 plasmid pQL50, complete sequence) position: , mismatch: 5, identity: 0.875

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggatgataa-	Protospacer
*************************** ***.  *** ** 

269. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP014534 (Enterococcus faecium strain E745 plasmid pl5, complete sequence) position: , mismatch: 5, identity: 0.875

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttagacgataa-	Protospacer
*************************** ****  .** ** 

270. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP040704 (Enterococcus faecium strain HOU503 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.875

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggatgataa-	Protospacer
*************************** ***.  *** ** 

271. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP017793 (Enterococcus faecium strain E240 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.875

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggatgataa-	Protospacer
*************************** ***.  *** ** 

272. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP023790 (Enterococcus faecium strain Efaecium_ER04462.3A plasmid pER04462.3A.1, complete sequence) position: , mismatch: 5, identity: 0.875

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggatgataa-	Protospacer
*************************** ***.  *** ** 

273. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP023800 (Enterococcus faecium strain Efaecium_ER04526.5A plasmid pER04526.5A.1, complete sequence) position: , mismatch: 5, identity: 0.875

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggatgataa-	Protospacer
*************************** ***.  *** ** 

274. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP035137 (Enterococcus faecium strain SRCM103341 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.875

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggatgataa-	Protospacer
*************************** ***.  *** ** 

275. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP040850 (Enterococcus faecium strain F17E0263 plasmid p_unnamned1, complete sequence) position: , mismatch: 5, identity: 0.875

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggatgataa-	Protospacer
*************************** ***.  *** ** 

276. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135192 (Enterococcus faecium isolate E4438 plasmid 2) position: , mismatch: 5, identity: 0.875

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggatgataa-	Protospacer
*************************** ***.  *** ** 

277. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135308 (Enterococcus faecium isolate E7240 plasmid 2) position: , mismatch: 5, identity: 0.875

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggatgataa-	Protospacer
*************************** ***.  *** ** 

278. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP023809 (Enterococcus faecium strain Efaecium_ER04526.3A plasmid pER04562.3A.1, complete sequence) position: , mismatch: 5, identity: 0.875

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggatgataa-	Protospacer
*************************** ***.  *** ** 

279. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP023805 (Enterococcus faecium strain Efaecium_ER04619.3A isolate isolate plasmid pER04619.3A.1, complete sequence) position: , mismatch: 5, identity: 0.875

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggatgataa-	Protospacer
*************************** ***.  *** ** 

280. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP035221 (Enterococcus faecium strain SRCM103470 plasmid unnamed1) position: , mismatch: 5, identity: 0.875

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggatgataa-	Protospacer
*************************** ***.  *** ** 

281. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_AP019409 (Enterococcus faecium strain SMVRE20 plasmid pSMVRE20L, complete sequence) position: , mismatch: 5, identity: 0.875

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggatgataa-	Protospacer
*************************** ***.  *** ** 

282. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NC_020208 (Enterococcus faecium ATCC 8459 = NRRL B-2354 plasmid pNB2354_1, complete sequence) position: , mismatch: 5, identity: 0.875

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggatgataa-	Protospacer
*************************** ***.  *** ** 

283. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP034948 (Enterococcus faecium strain NM213 plasmid unnamed5, complete sequence) position: , mismatch: 5, identity: 0.875

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggatgataa-	Protospacer
*************************** ***.  *** ** 

284. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP018827 (Enterococcus faecium strain ISMMS_VRE_12 plasmid p1_ISMMS_VRE12, complete sequence) position: , mismatch: 5, identity: 0.875

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggatgataa-	Protospacer
*************************** ***.  *** ** 

285. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP023795 (Enterococcus faecium strain Efaecium_ER04484.3A plasmid pER04484.3A.1, complete sequence) position: , mismatch: 5, identity: 0.875

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggatgataa-	Protospacer
*************************** ***.  *** ** 

286. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_MG674581 (Enterococcus faecium strain HL1 plasmid pHLSA, complete sequence) position: , mismatch: 5, identity: 0.875

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggatgataa-	Protospacer
*************************** ***.  *** ** 

287. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP023781 (Enterococcus faecium strain Efaecium_ER03933.3A isolate isolate plasmid pER93933.3A.1, complete sequence) position: , mismatch: 5, identity: 0.875

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggatgataa-	Protospacer
*************************** ***.  *** ** 

288. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135246 (Enterococcus faecium isolate E6988 plasmid 4) position: , mismatch: 5, identity: 0.875

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttagacgataa-	Protospacer
*************************** ****  .** ** 

289. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135237 (Enterococcus faecium isolate E7067 plasmid 3) position: , mismatch: 5, identity: 0.875

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttagacgataa-	Protospacer
*************************** ****  .** ** 

290. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP041256 (Enterococcus faecium strain 515 plasmid p26, complete sequence) position: , mismatch: 5, identity: 0.875

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggatgataa-	Protospacer
*************************** ***.  *** ** 

291. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135222 (Enterococcus faecium isolate E7040 plasmid 4) position: , mismatch: 5, identity: 0.875

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttagacgataa-	Protospacer
*************************** ****  .** ** 

292. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR134108 (Enterococcus faecium isolate E6043 plasmid 4) position: , mismatch: 5, identity: 0.875

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttagacgataa-	Protospacer
*************************** ****  .** ** 

293. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP011829 (Enterococcus faecium strain UW8175 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.875

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggatgataa-	Protospacer
*************************** ***.  *** ** 

294. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LN999988 (Enterococcus faecium isolate EFE11651 plasmid II, complete sequence) position: , mismatch: 5, identity: 0.875

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggatgataa-	Protospacer
*************************** ***.  *** ** 

295. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP025687 (Enterococcus faecium strain CBA7134 plasmid pCBA710401, complete sequence) position: , mismatch: 5, identity: 0.875

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggatgataa-	Protospacer
*************************** ***.  *** ** 

296. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP040877 (Enterococcus faecium strain HB-1 plasmid punnamed, complete sequence) position: , mismatch: 5, identity: 0.875

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggatgataa-	Protospacer
*************************** ***.  *** ** 

297. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP032307 (Enterococcus faecium strain HY07 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.875

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggatgataa-	Protospacer
*************************** ***.  *** ** 

298. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP019993 (Enterococcus faecium isolate 2014-VREF-268 plasmid p268-1, complete sequence) position: , mismatch: 5, identity: 0.875

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggatgataa-	Protospacer
*************************** ***.  *** ** 

299. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP042840 (Enterococcus sp. DA9 plasmid unnamed4) position: , mismatch: 5, identity: 0.875

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggatgataa-	Protospacer
*************************** ***.  *** ** 

300. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP033207 (Enterococcus faecium strain RBWH1 plasmid pRBWH1.1, complete sequence) position: , mismatch: 5, identity: 0.875

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggatgataa-	Protospacer
*************************** ***.  *** ** 

301. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP042833 (Enterococcus faecium strain FA3 plasmid unnamed1) position: , mismatch: 5, identity: 0.875

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggatgataa-	Protospacer
*************************** ***.  *** ** 

302. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP012461 (Enterococcus faecium strain ISMMS_VRE_7 plasmid ISMMS_VRE7_p1, complete sequence) position: , mismatch: 5, identity: 0.875

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggatgataa-	Protospacer
*************************** ***.  *** ** 

303. spacer 2.1|10012|28|NZ_CP038997|PILER-CR matches to MN694520 (Marine virus AFVG_250M712, complete genome) position: , mismatch: 6, identity: 0.786

tgtgatgaattgattttcgttctgcact	CRISPR spacer
ttgattcaattgcttttcgttctgcact	Protospacer
*  . * ***** ***************

304. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP013995 (Enterococcus faecium strain 6E6 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.85

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttttgcacttttggatgataa-	Protospacer
*********************.***** ***.  *** ** 

305. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP035661 (Enterococcus faecium strain UAMSEF_09 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.85

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttttgcacttttggatgataa-	Protospacer
*********************.***** ***.  *** ** 

306. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP035667 (Enterococcus faecium strain UAMSEF_20 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.85

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttttgcacttttggatgataa-	Protospacer
*********************.***** ***.  *** ** 

307. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP027508 (Enterococcus faecium strain AUSMDU00004055 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.85

tgtgatgaattgattttcgttctgcactt-tatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttctggacgataa-	Protospacer
***************************** *.  .** ** 

308. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP027503 (Enterococcus faecium strain AUSMDU00004142 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.85

tgtgatgaattgattttcgttctgcactt-tatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttctggacgataa-	Protospacer
***************************** *.  .** ** 

309. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP027514 (Enterococcus faecium strain AUSMDU00004028 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.85

tgtgatgaattgattttcgttctgcactt-tatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttctggacgataa-	Protospacer
***************************** *.  .** ** 

310. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP040369 (Enterococcus faecium strain VB3240 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.85

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttttgcacttttggatgataa-	Protospacer
*********************.***** ***.  *** ** 

311. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP020485 (Enterococcus faecium strain CFSAN059070 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.85

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttttgcacttttggatgataa-	Protospacer
*********************.***** ***.  *** ** 

312. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP041262 (Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R1, complete sequence) position: , mismatch: 6, identity: 0.85

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttttgcacttttggatgataa-	Protospacer
*********************.***** ***.  *** ** 

313. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP027518 (Enterococcus faecium strain AUSMDU00004024 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.85

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttttgcacttttggatgataa-	Protospacer
*********************.***** ***.  *** ** 

314. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP027507 (Enterococcus faecium strain AUSMDU00004055 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.85

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttttgcacttttggatgataa-	Protospacer
*********************.***** ***.  *** ** 

315. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135244 (Enterococcus faecium isolate E6988 plasmid 2) position: , mismatch: 6, identity: 0.85

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttttgcacttttggatgataa-	Protospacer
*********************.***** ***.  *** ** 

316. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135279 (Enterococcus faecium isolate E6975 plasmid 2) position: , mismatch: 6, identity: 0.85

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttttgcacttttggatgataa-	Protospacer
*********************.***** ***.  *** ** 

317. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135783 (Enterococcus faecium isolate E4239 plasmid 2) position: , mismatch: 6, identity: 0.85

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttttgcacttttggatgataa-	Protospacer
*********************.***** ***.  *** ** 

318. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135236 (Enterococcus faecium isolate E7067 plasmid 2) position: , mismatch: 6, identity: 0.85

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttttgcacttttggatgataa-	Protospacer
*********************.***** ***.  *** ** 

319. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP019209 (Enterococcus faecium strain 2014-VREF-41 plasmid p41-1, complete sequence) position: , mismatch: 6, identity: 0.85

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttttgcacttttggatgataa-	Protospacer
*********************.***** ***.  *** ** 

320. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135429 (Enterococcus faecium isolate E8927 plasmid 2) position: , mismatch: 6, identity: 0.85

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttttgcacttttggatgataa-	Protospacer
*********************.***** ***.  *** ** 

321. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135476 (Enterococcus faecium isolate E8423 plasmid 2) position: , mismatch: 6, identity: 0.85

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttttgcacttttggatgataa-	Protospacer
*********************.***** ***.  *** ** 

322. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135220 (Enterococcus faecium isolate E7040 plasmid 2) position: , mismatch: 6, identity: 0.85

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttttgcacttttggatgataa-	Protospacer
*********************.***** ***.  *** ** 

323. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135325 (Enterococcus faecium isolate E7654 plasmid 2) position: , mismatch: 6, identity: 0.85

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttttgcacttttggatgataa-	Protospacer
*********************.***** ***.  *** ** 

324. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135358 (Enterococcus faecium isolate E7948 plasmid 2) position: , mismatch: 6, identity: 0.85

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttttgcacttttggatgataa-	Protospacer
*********************.***** ***.  *** ** 

325. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135352 (Enterococcus faecium isolate E8014 plasmid 2) position: , mismatch: 6, identity: 0.85

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttttgcacttttggatgataa-	Protospacer
*********************.***** ***.  *** ** 

326. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135318 (Enterococcus faecium isolate E7663 plasmid 2) position: , mismatch: 6, identity: 0.85

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttttgcacttttggatgataa-	Protospacer
*********************.***** ***.  *** ** 

327. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR134106 (Enterococcus faecium isolate E6043 plasmid 2) position: , mismatch: 6, identity: 0.85

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttttgcacttttggatgataa-	Protospacer
*********************.***** ***.  *** ** 

328. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP045013 (Enterococcus faecium strain LAC7.2 plasmid pI, complete sequence) position: , mismatch: 6, identity: 0.85

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttttgcacttttggatgataa-	Protospacer
*********************.***** ***.  *** ** 

329. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP040741 (Enterococcus faecium strain VRE1 plasmid pVRE1-1, complete sequence) position: , mismatch: 6, identity: 0.85

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttttgcacttttggatgataa-	Protospacer
*********************.***** ***.  *** ** 

330. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP023424 (Enterococcus faecium strain K60-39 plasmid pTT39_p1, complete sequence) position: , mismatch: 6, identity: 0.85

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttttgcacttttggatgataa-	Protospacer
*********************.***** ***.  *** ** 

331. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP035655 (Enterococcus faecium strain UAMSEF_08 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.85

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttttgcacttttggatgataa-	Protospacer
*********************.***** ***.  *** ** 

332. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP035649 (Enterococcus faecium strain UAMSEF_01 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.85

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttttgcacttttggatgataa-	Protospacer
*********************.***** ***.  *** ** 

333. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135171 (Enterococcus faecium isolate E4227 plasmid 2) position: , mismatch: 6, identity: 0.85

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttttgcacttttggatgataa-	Protospacer
*********************.***** ***.  *** ** 

334. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP041271 (Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S1, complete sequence) position: , mismatch: 6, identity: 0.85

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttttgcacttttggatgataa-	Protospacer
*********************.***** ***.  *** ** 

335. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP025426 (Enterococcus faecium strain SC4 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.85

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttttgcacttttggatgataa-	Protospacer
*********************.***** ***.  *** ** 

336. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP040905 (Enterococcus faecium strain N56454 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.85

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttttgcacttttggatgataa-	Protospacer
*********************.***** ***.  *** ** 

337. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP019989 (Enterococcus faecium isolate 2014-VREF-63 plasmid p63-1, complete sequence) position: , mismatch: 6, identity: 0.85

tgtgatgaattgattttcgttctgcac-tttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttttgcacttttggatgataa-	Protospacer
*********************.***** ***.  *** ** 

338. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP033208 (Enterococcus faecium strain RBWH1 plasmid pRBWH1.2, complete sequence) position: , mismatch: 7, identity: 0.825

tgtgatgaattgattttcgttctgcactttatttgagaaa---	CRISPR spacer
tgtgatgaattgattttcgttctgcact---tttggacgatga	Protospacer
****************************   ****.. .*   

339. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NC_022883 (Enterococcus mundtii QU 25 plasmid pQY082, complete sequence) position: , mismatch: 7, identity: 0.825

tgtgatgaattgattttcgttctgcactttatttgagaaa---	CRISPR spacer
tgtgatgaattgattttcgttctgcac---atttggacgatag	Protospacer
***************************   *****.. .*   

340. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP040851 (Enterococcus faecium strain F17E0263 plasmid p_unnamned2, complete sequence) position: , mismatch: 7, identity: 0.825

tgtgatgaattgattttcgttctgca-ctttatttgagaaa	CRISPR spacer
tgtgatgaattgatttttgttctgcacctttggacgataa-	Protospacer
*****************.******** ****.  .** ** 

341. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP019971 (Enterococcus faecium isolate 2014-VREF-114 plasmid p114-1 sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

342. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP011283 (Enterococcus faecium strain E39 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

343. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP011284 (Enterococcus faecium strain E39 plasmid p4, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

344. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP015123 (Enterococcus faecium strain E39 plasmid p3, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

345. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_KP842560 (Enterococcus faecium strain 17i48 ST17 plasmid pRUM-like, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

346. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_KP342511 (Enterococcus faecium isolate N12-493 plasmid pEfm12493, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

347. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to LT603680 (Enterococcus faecium isolate Ef_DMG1500501 genome assembly, plasmid: 3) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

348. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP018831 (Enterococcus faecium strain ISMMS_VRE_9 plasmid p2_ISMMS_VRE9, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

349. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP018832 (Enterococcus faecium strain ISMMS_VRE_9 plasmid p1_ISMMS_VRE9, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

350. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to CP003352 (Enterococcus faecium Aus0004 plasmid AUS0004_p1, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

351. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP041264 (Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R3, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

352. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP012367 (Enterococcus durans strain KLDS 6.0933 plasmid unnamed 1, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

353. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP027499 (Enterococcus faecium strain AUSMDU00004167 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

354. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP027510 (Enterococcus faecium strain AUSMDU00004055 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

355. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP027502 (Enterococcus faecium strain AUSMDU00004142 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

356. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP027505 (Enterococcus faecium strain AUSMDU00004142 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

357. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135289 (Enterococcus faecium isolate E7199 plasmid 3) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

358. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135290 (Enterococcus faecium isolate E7199 plasmid 4) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

359. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135334 (Enterococcus faecium isolate E7471 plasmid 4) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

360. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135335 (Enterococcus faecium isolate E7471 plasmid 5) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

361. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP046075 (Enterococcus faecium strain VRE plasmid p3_03A17012, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

362. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP046078 (Enterococcus faecium strain VRE plasmid p4_03A17012, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

363. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP025755 (Enterococcus faecium strain AALTL plasmid pEFA-790c, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

364. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP025756 (Enterococcus faecium strain AALTL plasmid pEFA-99d7, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

365. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP027516 (Enterococcus faecium strain AUSMDU00004028 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

366. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP013010 (Enterococcus faecium strain UW7606x64/3 TC1 plasmid pWCF-TC1, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

367. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135281 (Enterococcus faecium isolate E6975 plasmid 4) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

368. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135257 (Enterococcus faecium isolate E7098 plasmid 4) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

369. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135238 (Enterococcus faecium isolate E7067 plasmid 4) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

370. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135199 (Enterococcus faecium isolate E6055 plasmid 3) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

371. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP041254 (Enterococcus faecium strain 515 plasmid p169, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

372. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NC_021995 (Enterococcus faecium Aus0085 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

373. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP038175 (Enterococcus faecium strain SDGJQ5 plasmid pSDGJQ5, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

374. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP017799 (Enterococcus faecium strain E243 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

375. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135437 (Enterococcus faecium isolate E8691 plasmid 3) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

376. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135484 (Enterococcus faecium isolate E4456 plasmid 3) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

377. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135477 (Enterococcus faecium isolate E8423 plasmid 3) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

378. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135477 (Enterococcus faecium isolate E8423 plasmid 3) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

379. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135207 (Enterococcus faecium isolate E7171 plasmid 5) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

380. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135175 (Enterococcus faecium isolate E4402 plasmid 2) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

381. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135176 (Enterococcus faecium isolate E4402 plasmid 3) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

382. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135180 (Enterococcus faecium isolate E0595 plasmid 2) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

383. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135228 (Enterococcus faecium isolate E7025 plasmid 3) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

384. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135221 (Enterococcus faecium isolate E7040 plasmid 3) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

385. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NC_021987 (Enterococcus faecium Aus0085 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

386. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135326 (Enterococcus faecium isolate E7654 plasmid 3) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

387. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135359 (Enterococcus faecium isolate E7948 plasmid 3) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

388. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP044265 (Enterococcus faecium strain V1836 plasmid pHVH-V1836-1, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

389. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135319 (Enterococcus faecium isolate E7663 plasmid 3) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

390. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135374 (Enterococcus faecium isolate E8172 plasmid 3) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

391. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135374 (Enterococcus faecium isolate E8172 plasmid 3) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

392. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP006031 (Enterococcus faecium T110 plasmid pEFT110, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

393. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR132068 (Enterococcus faecium isolate E0139 plasmid 2) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

394. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP014530 (Enterococcus faecium strain E745 plasmid pl1, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

395. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP023425 (Enterococcus faecium strain K60-39 plasmid pTT39_p2, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

396. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_AP022342 (Enterococcus faecium strain KUHS13 plasmid pKO1, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

397. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP041273 (Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S3, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

398. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP040708 (Enterococcus faecium strain HOU503 plasmid p2) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

399. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP040873 (Enterococcus faecium strain DB-1 plasmid punnamed1) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

400. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP040876 (Enterococcus faecium strain DB-1 plasmid punnamed2) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

401. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP017794 (Enterococcus faecium strain E240 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

402. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP017795 (Enterococcus faecium strain E240 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

403. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP035650 (Enterococcus faecium strain UAMSEF_08 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

404. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP023790 (Enterococcus faecium strain Efaecium_ER04462.3A plasmid pER04462.3A.1, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

405. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP023800 (Enterococcus faecium strain Efaecium_ER04526.5A plasmid pER04526.5A.1, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

406. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR134096 (Enterococcus faecium isolate E1334 plasmid 2) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

407. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP035644 (Enterococcus faecium strain UAMSEF_01 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

408. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135193 (Enterococcus faecium isolate E4438 plasmid 3) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

409. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP037956 (Enterococcus hirae strain CQP3-9 plasmid pCQP3-9_1, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

410. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135309 (Enterococcus faecium isolate E7240 plasmid 3) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

411. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135310 (Enterococcus faecium isolate E7240 plasmid 4) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

412. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP040237 (Enterococcus faecium strain VB3025 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

413. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP023809 (Enterococcus faecium strain Efaecium_ER04526.3A plasmid pER04562.3A.1, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

414. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP023812 (Enterococcus faecium strain Efaecium_ER04526.3A plasmid pER04562.3A.5, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

415. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP023805 (Enterococcus faecium strain Efaecium_ER04619.3A isolate isolate plasmid pER04619.3A.1, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

416. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_AP019410 (Enterococcus faecium strain SMVRE20 plasmid pSMVRE20S, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

417. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP016165 (Enterococcus faecium strain ISMMS_VRE_11 plasmid ISMMS_VRE11_p2, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

418. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP016166 (Enterococcus faecium strain ISMMS_VRE_11 plasmid ISMMS_VRE11_p3, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

419. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP018825 (Enterococcus faecium strain ISMMS_VRE_12 plasmid p2_ISMMS_VRE12, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

420. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP018827 (Enterococcus faecium strain ISMMS_VRE_12 plasmid p1_ISMMS_VRE12, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

421. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to LR135186 (Enterococcus faecium isolate E4413 genome assembly, plasmid: 2) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

422. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP012432 (Enterococcus faecium strain ISMMS_VRE_1 plasmid ISMMS_VRE_p1, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

423. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP023795 (Enterococcus faecium strain Efaecium_ER04484.3A plasmid pER04484.3A.1, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

424. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP023796 (Enterococcus faecium strain Efaecium_ER04484.3A plasmid pER04484.3A.2, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

425. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP023781 (Enterococcus faecium strain Efaecium_ER03933.3A isolate isolate plasmid pER93933.3A.1, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

426. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LT598666 (Enterococcus faecium isolate Ef_aus00233 plasmid 4) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

427. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_KX810025 (Enterococcus faecium strain Efm008 plasmid pJEG040, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

428. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_KX574671 (Enterococcus faecium strain V24 plasmid pHvH-V24, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

429. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_KY554216 (Enterococcus faecium strain Efa-125 plasmid pEfa-125gr, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

430. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_KY595962 (Enterococcus faecium strain VREfm1 plasmid pPEC286, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

431. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_KY595966 (Enterococcus faecium strain VREfm81 plasmid pBUD102, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

432. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP040906 (Enterococcus faecium strain FB-1 plasmid punnamed, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

433. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NC_021170 (Enterococcus faecium plasmid pF856, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

434. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP027401 (Enterococcus faecium strain FDAARGOS_323 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

435. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP012385 (Enterococcus durans strain KLDS 6.0930 plasmid unnamed 1, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

436. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP013995 (Enterococcus faecium strain 6E6 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

437. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP014450 (Enterococcus faecium strain ATCC 700221 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

438. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP014452 (Enterococcus faecium strain ATCC 700221 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

439. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP018070 (Enterococcus faecium strain VRE001 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

440. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135280 (Enterococcus faecium isolate E6975 plasmid 3) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

441. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135200 (Enterococcus faecium isolate E6055 plasmid 4) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

442. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135261 (Enterococcus faecium isolate E4457 plasmid 4) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

443. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP041258 (Enterococcus faecium strain 515 plasmid p27, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

444. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NC_005000 (Enterococcus faecium U37 plasmid pRUM, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

445. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135347 (Enterococcus faecium isolate E8202 plasmid 4) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

446. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP050649 (Enterococcus faecium strain BIOPOP-3 ALE plasmid pBIOPOP-3_ALE) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

447. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP050651 (Enterococcus faecium strain BIOPOP-3 WT plasmid pBIOPOP-3_WT) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

448. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP044266 (Enterococcus faecium strain V1836 plasmid pHVH-V1836-2, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

449. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP015517 (Enterococcus hirae strain R17 plasmid, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

450. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LN999989 (Enterococcus faecium isolate EFE11651 plasmid III, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

451. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP033042 (Enterococcus faecium strain Enterococcus faecium JE1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

452. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NC_014959 (Enterococcus faecium plasmid pS177, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

453. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP035661 (Enterococcus faecium strain UAMSEF_09 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

454. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP035667 (Enterococcus faecium strain UAMSEF_20 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

455. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NC_017962 (Enterococcus faecium DO plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

456. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP018129 (Enterococcus faecium strain A_020709_82 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

457. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP012463 (Enterococcus faecium strain ISMMS_VRE_7 plasmid ISMMS_VRE7_p3, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

458. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP012464 (Enterococcus faecium strain ISMMS_VRE_7 plasmid ISMMS_VRE7_p4, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

459. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP012431 (Enterococcus faecium strain ISMMS_VRE_1 plasmid ISMMS_VRE_p2, complete sequence) position: , mismatch: 8, identity: 0.8

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcgttctgcacttttggacgataa	Protospacer
******************************     .. **

460. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135298 (Enterococcus faecium isolate E7429 plasmid 2) position: , mismatch: 9, identity: 0.775

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattaattttcgttctgcacttttggacgataa	Protospacer
***********.******************     .. **

461. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135340 (Enterococcus faecium isolate E7356 plasmid 2) position: , mismatch: 9, identity: 0.775

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattaattttcgttctgcacttttggacgataa	Protospacer
***********.******************     .. **

462. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP027513 (Enterococcus faecium strain AUSMDU00004028 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.775

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattaattttcgttctgcacttttggacgataa	Protospacer
***********.******************     .. **

463. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135294 (Enterococcus faecium isolate E7237 plasmid 2) position: , mismatch: 9, identity: 0.775

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattaattttcgttctgcacttttggacgataa	Protospacer
***********.******************     .. **

464. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135198 (Enterococcus faecium isolate E6055 plasmid 2) position: , mismatch: 9, identity: 0.775

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattaattttcgttctgcacttttggacgataa	Protospacer
***********.******************     .. **

465. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135483 (Enterococcus faecium isolate E4456 plasmid 2) position: , mismatch: 9, identity: 0.775

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattaattttcgttctgcacttttggacgataa	Protospacer
***********.******************     .. **

466. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135204 (Enterococcus faecium isolate E7171 plasmid 2) position: , mismatch: 9, identity: 0.775

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattaattttcgttctgcacttttggacgataa	Protospacer
***********.******************     .. **

467. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135489 (Enterococcus faecium isolate E8414 plasmid 2) position: , mismatch: 9, identity: 0.775

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattaattttcgttctgcacttttggacgataa	Protospacer
***********.******************     .. **

468. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135365 (Enterococcus faecium isolate E8195 plasmid 2) position: , mismatch: 9, identity: 0.775

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattaattttcgttctgcacttttggacgataa	Protospacer
***********.******************     .. **

469. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135415 (Enterococcus faecium isolate E8328 plasmid 2) position: , mismatch: 9, identity: 0.775

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattaattttcgttctgcacttttggacgataa	Protospacer
***********.******************     .. **

470. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135395 (Enterococcus faecium isolate E8290 plasmid 2) position: , mismatch: 9, identity: 0.775

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattaattttcgttctgcacttttggacgataa	Protospacer
***********.******************     .. **

471. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135345 (Enterococcus faecium isolate E8202 plasmid 2) position: , mismatch: 9, identity: 0.775

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattaattttcgttctgcacttttggacgataa	Protospacer
***********.******************     .. **

472. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135409 (Enterococcus faecium isolate E8284 plasmid 2) position: , mismatch: 9, identity: 0.775

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattaattttcgttctgcacttttggacgataa	Protospacer
***********.******************     .. **

473. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135385 (Enterococcus faecium isolate E7933 plasmid 2) position: , mismatch: 9, identity: 0.775

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattaattttcgttctgcacttttggacgataa	Protospacer
***********.******************     .. **

474. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135386 (Enterococcus faecium isolate E7933 plasmid 3) position: , mismatch: 9, identity: 0.775

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattgattttcattctgcacttttggacgataa	Protospacer
******************.***********     .. **

475. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LR135373 (Enterococcus faecium isolate E8172 plasmid 2) position: , mismatch: 9, identity: 0.775

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattaattttcgttctgcacttttggacgataa	Protospacer
***********.******************     .. **

476. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP044275 (Enterococcus faecium strain V2937 plasmid pHVH-V2937-1, complete sequence) position: , mismatch: 9, identity: 0.775

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattaattttcgttctgcacttttggacgataa	Protospacer
***********.******************     .. **

477. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP018066 (Enterococcus faecium strain E1 plasmid pE1_230, complete sequence) position: , mismatch: 9, identity: 0.775

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattaattttcgttctgcacttttggacgataa	Protospacer
***********.******************     .. **

478. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_CP016164 (Enterococcus faecium strain ISMMS_VRE_11 plasmid ISMMS_VRE11_p1, complete sequence) position: , mismatch: 9, identity: 0.775

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattaattttcgttctgcacttttggacgataa	Protospacer
***********.******************     .. **

479. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NC_017963 (Enterococcus faecium DO plasmid 3, complete sequence) position: , mismatch: 9, identity: 0.775

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattaattttcgttctgcacttttggacgataa	Protospacer
***********.******************     .. **

480. spacer 2.3|10009|40|NZ_CP038997|CRISPRCasFinder matches to NZ_LT598664 (Enterococcus faecium isolate Ef_aus00233 plasmid 2) position: , mismatch: 9, identity: 0.775

tgtgatgaattgattttcgttctgcactttatttgagaaa	CRISPR spacer
tgtgatgaattaattttcgttctgcacttttggacgataa	Protospacer
***********.******************     .. **

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 19379 : 56221 39 Streptococcus_phage(36.36%) transposase,protease NA
DBSCAN-SWA_2 61701 : 106857 49 Streptococcus_phage(38.46%) transposase,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP038996
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP038996_1 2351075-2351184 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 206548 : 260234 48 uncultured_Mediterranean_phage(20.0%) transposase,tRNA NA
DBSCAN-SWA_2 688433 : 696905 9 Streptococcus_phage(66.67%) NA NA
DBSCAN-SWA_3 751428 : 848192 107 Enterococcus_phage(25.53%) protease,capsid,transposase,portal,integrase,terminase,tRNA,holin,head,tail attL 806645:806660|attR 809996:810011
DBSCAN-SWA_4 955236 : 983783 35 Streptococcus_phage(70.0%) transposase NA
DBSCAN-SWA_5 1070083 : 1119061 44 Bacillus_virus(16.67%) protease,transposase,tRNA NA
DBSCAN-SWA_6 1139742 : 1148803 9 Gordonia_phage(16.67%) NA NA
DBSCAN-SWA_7 1416860 : 1467072 58 Synechococcus_phage(23.08%) transposase,protease NA
DBSCAN-SWA_8 1647428 : 1776595 113 Streptococcus_phage(27.78%) protease,transposase,tRNA NA
DBSCAN-SWA_9 1943778 : 1999381 53 Enterococcus_phage(18.18%) transposase,tRNA,holin NA
DBSCAN-SWA_10 2002564 : 2040187 46 Enterococcus_phage(28.57%) protease,capsid,portal,terminase,tRNA,head,tail NA
DBSCAN-SWA_11 2052608 : 2125310 61 Streptococcus_phage(17.65%) transposase,tRNA NA
DBSCAN-SWA_12 2284014 : 2331710 60 Enterococcus_phage(26.47%) protease,capsid,transposase,portal,integrase,bacteriocin,terminase,holin,head,tail attL 2282127:2282186|attR 2319896:2319956
DBSCAN-SWA_13 2663705 : 2680601 18 Streptococcus_phage(92.86%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage