Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP046430 Salmonella enterica strain R19.2839 plasmid pR19.2839_83k, complete sequence 0 crisprs WYL 0 0 1 0
NZ_CP046429 Salmonella enterica strain R19.2839 chromosome, complete genome 2 crisprs PD-DExK,WYL,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2,csa3,RT,DEDDh,cas3,DinG,c2c9_V-U4 0 5 14 0

Results visualization

1. NZ_CP046430
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3928 : 57502 36 Escherichia_phage(21.43%) integrase,transposase,protease,holin NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP046429
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP046429_1 599300-599400 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP046429_2 974490-974910 TypeI-E I-E
6 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP046429_2 2.10|974728|32|NZ_CP046429|CRISPRCasFinder,CRT 974728-974759 32 NZ_KY494864 Pseudomonas aeruginosa strain FFUP_PS_37 plasmid pJB37, complete sequence 453979-454010 5 0.844
NZ_CP046429_2 2.10|974728|32|NZ_CP046429|CRISPRCasFinder,CRT 974728-974759 32 NZ_KU130294 Pseudomonas putida strain 12969 plasmid p12969-DIM, complete sequence 251896-251927 5 0.844
NZ_CP046429_2 2.10|974728|32|NZ_CP046429|CRISPRCasFinder,CRT 974728-974759 32 NZ_CP009975 Pseudomonas putida S12 plasmid pTTS12, complete sequence 6517-6548 5 0.844
NZ_CP046429_2 2.10|974728|32|NZ_CP046429|CRISPRCasFinder,CRT 974728-974759 32 NZ_CP039989 Pseudomonas aeruginosa strain T2436 plasmid pBT2436, complete sequence 238872-238903 5 0.844
NZ_CP046429_2 2.10|974728|32|NZ_CP046429|CRISPRCasFinder,CRT 974728-974759 32 NZ_MN433457 Pseudomonas aeruginosa strain PAB546 plasmid pNK546-KPC, complete sequence 235351-235382 5 0.844
NZ_CP046429_2 2.10|974728|32|NZ_CP046429|CRISPRCasFinder,CRT 974728-974759 32 NZ_CP029096 Pseudomonas aeruginosa strain AR439 plasmid unnamed2, complete sequence 378779-378810 5 0.844
NZ_CP046429_2 2.10|974728|32|NZ_CP046429|CRISPRCasFinder,CRT 974728-974759 32 NZ_CP045003 Pseudomonas aeruginosa strain PAG5 plasmid pPAG5, complete sequence 82539-82570 5 0.844
NZ_CP046429_2 2.10|974728|32|NZ_CP046429|CRISPRCasFinder,CRT 974728-974759 32 NZ_CP045917 Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence 224279-224310 5 0.844
NZ_CP046429_2 2.10|974728|32|NZ_CP046429|CRISPRCasFinder,CRT 974728-974759 32 MF344571 Pseudomonas aeruginosa plasmid pR31014-IMP, complete sequence 221127-221158 5 0.844
NZ_CP046429_2 2.10|974728|32|NZ_CP046429|CRISPRCasFinder,CRT 974728-974759 32 MF344569 Pseudomonas aeruginosa plasmid p12939-PER, complete sequence 284046-284077 5 0.844
NZ_CP046429_2 2.10|974728|32|NZ_CP046429|CRISPRCasFinder,CRT 974728-974759 32 MF344570 Pseudomonas aeruginosa plasmid pA681-IMP, complete sequence 219145-219176 5 0.844
NZ_CP046429_2 2.10|974728|32|NZ_CP046429|CRISPRCasFinder,CRT 974728-974759 32 NZ_CP039294 Pseudomonas aeruginosa strain PABL048 plasmid pPABL048, complete sequence 55495-55526 5 0.844
NZ_CP046429_2 2.10|974728|32|NZ_CP046429|CRISPRCasFinder,CRT 974728-974759 32 CP027478 Pseudomonas koreensis strain P19E3 plasmid p1, complete sequence 376216-376247 5 0.844
NZ_CP046429_2 2.10|974728|32|NZ_CP046429|CRISPRCasFinder,CRT 974728-974759 32 NZ_CP015879 Pseudomonas citronellolis strain SJTE-3 plasmid pRBL16, complete sequence 134871-134902 5 0.844
NZ_CP046429_2 2.10|974728|32|NZ_CP046429|CRISPRCasFinder,CRT 974728-974759 32 NZ_CP016215 Pseudomonas aeruginosa strain PA121617 plasmid pBM413, complete sequence 88841-88872 5 0.844
NZ_CP046429_2 2.4|974727|33|NZ_CP046429|PILER-CR 974727-974759 33 NZ_KY494864 Pseudomonas aeruginosa strain FFUP_PS_37 plasmid pJB37, complete sequence 453978-454010 6 0.818
NZ_CP046429_2 2.4|974727|33|NZ_CP046429|PILER-CR 974727-974759 33 NZ_KU130294 Pseudomonas putida strain 12969 plasmid p12969-DIM, complete sequence 251896-251928 6 0.818
NZ_CP046429_2 2.4|974727|33|NZ_CP046429|PILER-CR 974727-974759 33 NZ_CP009975 Pseudomonas putida S12 plasmid pTTS12, complete sequence 6516-6548 6 0.818
NZ_CP046429_2 2.4|974727|33|NZ_CP046429|PILER-CR 974727-974759 33 NZ_CP039989 Pseudomonas aeruginosa strain T2436 plasmid pBT2436, complete sequence 238872-238904 6 0.818
NZ_CP046429_2 2.4|974727|33|NZ_CP046429|PILER-CR 974727-974759 33 NZ_MN433457 Pseudomonas aeruginosa strain PAB546 plasmid pNK546-KPC, complete sequence 235350-235382 6 0.818
NZ_CP046429_2 2.4|974727|33|NZ_CP046429|PILER-CR 974727-974759 33 NZ_CP029096 Pseudomonas aeruginosa strain AR439 plasmid unnamed2, complete sequence 378778-378810 6 0.818
NZ_CP046429_2 2.4|974727|33|NZ_CP046429|PILER-CR 974727-974759 33 NZ_CP045003 Pseudomonas aeruginosa strain PAG5 plasmid pPAG5, complete sequence 82539-82571 6 0.818
NZ_CP046429_2 2.4|974727|33|NZ_CP046429|PILER-CR 974727-974759 33 NZ_CP045917 Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence 224279-224311 6 0.818
NZ_CP046429_2 2.4|974727|33|NZ_CP046429|PILER-CR 974727-974759 33 MF344571 Pseudomonas aeruginosa plasmid pR31014-IMP, complete sequence 221127-221159 6 0.818
NZ_CP046429_2 2.4|974727|33|NZ_CP046429|PILER-CR 974727-974759 33 MF344569 Pseudomonas aeruginosa plasmid p12939-PER, complete sequence 284046-284078 6 0.818
NZ_CP046429_2 2.4|974727|33|NZ_CP046429|PILER-CR 974727-974759 33 MF344570 Pseudomonas aeruginosa plasmid pA681-IMP, complete sequence 219145-219177 6 0.818
NZ_CP046429_2 2.4|974727|33|NZ_CP046429|PILER-CR 974727-974759 33 NZ_CP039294 Pseudomonas aeruginosa strain PABL048 plasmid pPABL048, complete sequence 55495-55527 6 0.818
NZ_CP046429_2 2.4|974727|33|NZ_CP046429|PILER-CR 974727-974759 33 CP027478 Pseudomonas koreensis strain P19E3 plasmid p1, complete sequence 376216-376248 6 0.818
NZ_CP046429_2 2.4|974727|33|NZ_CP046429|PILER-CR 974727-974759 33 NZ_CP015879 Pseudomonas citronellolis strain SJTE-3 plasmid pRBL16, complete sequence 134871-134903 6 0.818
NZ_CP046429_2 2.4|974727|33|NZ_CP046429|PILER-CR 974727-974759 33 NZ_CP016215 Pseudomonas aeruginosa strain PA121617 plasmid pBM413, complete sequence 88840-88872 6 0.818
NZ_CP046429_2 2.8|974606|32|NZ_CP046429|CRISPRCasFinder,CRT 974606-974637 32 KJ019071 Synechococcus phage ACG-2014g isolate Syn7803US105, complete genome 59609-59640 7 0.781
NZ_CP046429_2 2.8|974606|32|NZ_CP046429|CRISPRCasFinder,CRT 974606-974637 32 MN694480 Marine virus AFVG_250M133, complete genome 20886-20917 7 0.781
NZ_CP046429_2 2.8|974606|32|NZ_CP046429|CRISPRCasFinder,CRT 974606-974637 32 MN694671 Marine virus AFVG_250M145, complete genome 23163-23194 7 0.781
NZ_CP046429_2 2.8|974606|32|NZ_CP046429|CRISPRCasFinder,CRT 974606-974637 32 MN694753 Marine virus AFVG_250M144, complete genome 25459-25490 7 0.781
NZ_CP046429_2 2.8|974606|32|NZ_CP046429|CRISPRCasFinder,CRT 974606-974637 32 MN694231 Marine virus AFVG_250M143, complete genome 21163-21194 7 0.781
NZ_CP046429_2 2.8|974606|32|NZ_CP046429|CRISPRCasFinder,CRT 974606-974637 32 MN693981 Marine virus AFVG_250M146, complete genome 18773-18804 7 0.781
NZ_CP046429_2 2.2|974605|33|NZ_CP046429|PILER-CR 974605-974637 33 NZ_CP046723 Pantoea agglomerans strain ASB05 plasmid pASB05p1, complete sequence 559038-559070 8 0.758
NZ_CP046429_2 2.2|974605|33|NZ_CP046429|PILER-CR 974605-974637 33 NZ_CP034470 Pantoea agglomerans strain CFSAN047153 plasmid pCFSAN047153_1, complete sequence 214653-214685 8 0.758
NZ_CP046429_2 2.2|974605|33|NZ_CP046429|PILER-CR 974605-974637 33 NZ_CP034149 Pantoea agglomerans strain L15 plasmid pPagL15_1, complete sequence 578775-578807 8 0.758
NZ_CP046429_2 2.2|974605|33|NZ_CP046429|PILER-CR 974605-974637 33 NZ_CP034475 Pantoea agglomerans strain CFSAN047154 plasmid pCFSAN047154_1, complete sequence 592092-592124 8 0.758
NZ_CP046429_2 2.2|974605|33|NZ_CP046429|PILER-CR 974605-974637 33 KJ019071 Synechococcus phage ACG-2014g isolate Syn7803US105, complete genome 59609-59641 8 0.758
NZ_CP046429_2 2.8|974606|32|NZ_CP046429|CRISPRCasFinder,CRT 974606-974637 32 NZ_CP046723 Pantoea agglomerans strain ASB05 plasmid pASB05p1, complete sequence 559039-559070 8 0.75
NZ_CP046429_2 2.8|974606|32|NZ_CP046429|CRISPRCasFinder,CRT 974606-974637 32 NZ_CP034470 Pantoea agglomerans strain CFSAN047153 plasmid pCFSAN047153_1, complete sequence 214654-214685 8 0.75
NZ_CP046429_2 2.8|974606|32|NZ_CP046429|CRISPRCasFinder,CRT 974606-974637 32 NZ_CP034149 Pantoea agglomerans strain L15 plasmid pPagL15_1, complete sequence 578776-578807 8 0.75
NZ_CP046429_2 2.8|974606|32|NZ_CP046429|CRISPRCasFinder,CRT 974606-974637 32 NZ_CP034475 Pantoea agglomerans strain CFSAN047154 plasmid pCFSAN047154_1, complete sequence 592092-592123 8 0.75
NZ_CP046429_2 2.8|974606|32|NZ_CP046429|CRISPRCasFinder,CRT 974606-974637 32 MN694115 Marine virus AFVG_250M901, complete genome 49467-49498 8 0.75
NZ_CP046429_2 2.8|974606|32|NZ_CP046429|CRISPRCasFinder,CRT 974606-974637 32 NZ_CP046630 Streptococcus equinus strain CNU G6 plasmid p1_CNU_G6, complete sequence 66427-66458 9 0.719
NZ_CP046429_2 2.8|974606|32|NZ_CP046429|CRISPRCasFinder,CRT 974606-974637 32 NZ_CP046920 Streptococcus sp. CNU G2 plasmid p_CNU_G2, complete sequence 70206-70237 9 0.719
NZ_CP046429_2 2.8|974606|32|NZ_CP046429|CRISPRCasFinder,CRT 974606-974637 32 MN694046 Marine virus AFVG_250M906, complete genome 22321-22352 9 0.719
NZ_CP046429_2 2.8|974606|32|NZ_CP046429|CRISPRCasFinder,CRT 974606-974637 32 MN693836 Marine virus AFVG_250M487, complete genome 10882-10913 9 0.719
NZ_CP046429_2 2.8|974606|32|NZ_CP046429|CRISPRCasFinder,CRT 974606-974637 32 MN693891 Marine virus AFVG_250M480, complete genome 21841-21872 9 0.719
NZ_CP046429_2 2.8|974606|32|NZ_CP046429|CRISPRCasFinder,CRT 974606-974637 32 MK268344 Salmonella phage Munch, complete genome 122526-122557 9 0.719
NZ_CP046429_2 2.8|974606|32|NZ_CP046429|CRISPRCasFinder,CRT 974606-974637 32 MN694071 Marine virus AFVG_250M483, complete genome 16976-17007 9 0.719
NZ_CP046429_2 2.8|974606|32|NZ_CP046429|CRISPRCasFinder,CRT 974606-974637 32 MN694294 Marine virus AFVG_250M486, complete genome 8469-8500 9 0.719
NZ_CP046429_2 2.8|974606|32|NZ_CP046429|CRISPRCasFinder,CRT 974606-974637 32 MN693751 Marine virus AFVG_250M485, complete genome 13096-13127 9 0.719
NZ_CP046429_2 2.8|974606|32|NZ_CP046429|CRISPRCasFinder,CRT 974606-974637 32 MN694002 Marine virus AFVG_250M481, complete genome 18787-18818 9 0.719
NZ_CP046429_2 2.8|974606|32|NZ_CP046429|CRISPRCasFinder,CRT 974606-974637 32 MN694650 Marine virus AFVG_250M482, complete genome 20198-20229 9 0.719
NZ_CP046429_2 2.8|974606|32|NZ_CP046429|CRISPRCasFinder,CRT 974606-974637 32 MN693906 Marine virus AFVG_250M905, complete genome 17506-17537 9 0.719
NZ_CP046429_2 2.8|974606|32|NZ_CP046429|CRISPRCasFinder,CRT 974606-974637 32 MN694711 Marine virus AFVG_250M484, complete genome 24974-25005 9 0.719
NZ_CP046429_2 2.13|974545|32|NZ_CP046429|CRT 974545-974576 32 KR052482 Sinorhizobium phage phiN3, complete genome 197290-197321 9 0.719

1. spacer 2.10|974728|32|NZ_CP046429|CRISPRCasFinder,CRT matches to NZ_KY494864 (Pseudomonas aeruginosa strain FFUP_PS_37 plasmid pJB37, complete sequence) position: , mismatch: 5, identity: 0.844

gcggtaaaaatcacggtcggcatacatcgtgg	CRISPR spacer
gctcgaaaaatcacgctcgggatacatcgtgg	Protospacer
**   ********** **** ***********

2. spacer 2.10|974728|32|NZ_CP046429|CRISPRCasFinder,CRT matches to NZ_KU130294 (Pseudomonas putida strain 12969 plasmid p12969-DIM, complete sequence) position: , mismatch: 5, identity: 0.844

gcggtaaaaatcacggtcggcatacatcgtgg	CRISPR spacer
gctcgaaaaatcacgctcgggatacatcgtgg	Protospacer
**   ********** **** ***********

3. spacer 2.10|974728|32|NZ_CP046429|CRISPRCasFinder,CRT matches to NZ_CP009975 (Pseudomonas putida S12 plasmid pTTS12, complete sequence) position: , mismatch: 5, identity: 0.844

gcggtaaaaatcacggtcggcatacatcgtgg	CRISPR spacer
gctcgaaaaatcacgctcgggatacatcgtgg	Protospacer
**   ********** **** ***********

4. spacer 2.10|974728|32|NZ_CP046429|CRISPRCasFinder,CRT matches to NZ_CP039989 (Pseudomonas aeruginosa strain T2436 plasmid pBT2436, complete sequence) position: , mismatch: 5, identity: 0.844

gcggtaaaaatcacggtcggcatacatcgtgg	CRISPR spacer
gctcgaaaaatcacgctcgggatacatcgtgg	Protospacer
**   ********** **** ***********

5. spacer 2.10|974728|32|NZ_CP046429|CRISPRCasFinder,CRT matches to NZ_MN433457 (Pseudomonas aeruginosa strain PAB546 plasmid pNK546-KPC, complete sequence) position: , mismatch: 5, identity: 0.844

gcggtaaaaatcacggtcggcatacatcgtgg	CRISPR spacer
gctcgaaaaatcacgctcgggatacatcgtgg	Protospacer
**   ********** **** ***********

6. spacer 2.10|974728|32|NZ_CP046429|CRISPRCasFinder,CRT matches to NZ_CP029096 (Pseudomonas aeruginosa strain AR439 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.844

gcggtaaaaatcacggtcggcatacatcgtgg	CRISPR spacer
gctcgaaaaatcacgctcgggatacatcgtgg	Protospacer
**   ********** **** ***********

7. spacer 2.10|974728|32|NZ_CP046429|CRISPRCasFinder,CRT matches to NZ_CP045003 (Pseudomonas aeruginosa strain PAG5 plasmid pPAG5, complete sequence) position: , mismatch: 5, identity: 0.844

gcggtaaaaatcacggtcggcatacatcgtgg	CRISPR spacer
gctcgaaaaatcacgctcgggatacatcgtgg	Protospacer
**   ********** **** ***********

8. spacer 2.10|974728|32|NZ_CP046429|CRISPRCasFinder,CRT matches to NZ_CP045917 (Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence) position: , mismatch: 5, identity: 0.844

gcggtaaaaatcacggtcggcatacatcgtgg	CRISPR spacer
gctcgaaaaatcacgctcgggatacatcgtgg	Protospacer
**   ********** **** ***********

9. spacer 2.10|974728|32|NZ_CP046429|CRISPRCasFinder,CRT matches to MF344571 (Pseudomonas aeruginosa plasmid pR31014-IMP, complete sequence) position: , mismatch: 5, identity: 0.844

gcggtaaaaatcacggtcggcatacatcgtgg	CRISPR spacer
gctcgaaaaatcacgctcgggatacatcgtgg	Protospacer
**   ********** **** ***********

10. spacer 2.10|974728|32|NZ_CP046429|CRISPRCasFinder,CRT matches to MF344569 (Pseudomonas aeruginosa plasmid p12939-PER, complete sequence) position: , mismatch: 5, identity: 0.844

gcggtaaaaatcacggtcggcatacatcgtgg	CRISPR spacer
gctcgaaaaatcacgctcgggatacatcgtgg	Protospacer
**   ********** **** ***********

11. spacer 2.10|974728|32|NZ_CP046429|CRISPRCasFinder,CRT matches to MF344570 (Pseudomonas aeruginosa plasmid pA681-IMP, complete sequence) position: , mismatch: 5, identity: 0.844

gcggtaaaaatcacggtcggcatacatcgtgg	CRISPR spacer
gctcgaaaaatcacgctcgggatacatcgtgg	Protospacer
**   ********** **** ***********

12. spacer 2.10|974728|32|NZ_CP046429|CRISPRCasFinder,CRT matches to NZ_CP039294 (Pseudomonas aeruginosa strain PABL048 plasmid pPABL048, complete sequence) position: , mismatch: 5, identity: 0.844

gcggtaaaaatcacggtcggcatacatcgtgg	CRISPR spacer
gctcgaaaaatcacgctcgggatacatcgtgg	Protospacer
**   ********** **** ***********

13. spacer 2.10|974728|32|NZ_CP046429|CRISPRCasFinder,CRT matches to CP027478 (Pseudomonas koreensis strain P19E3 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.844

gcggtaaaaatcacggtcggcatacatcgtgg	CRISPR spacer
gctcgaaaaatcacgctcgggatacatcgtgg	Protospacer
**   ********** **** ***********

14. spacer 2.10|974728|32|NZ_CP046429|CRISPRCasFinder,CRT matches to NZ_CP015879 (Pseudomonas citronellolis strain SJTE-3 plasmid pRBL16, complete sequence) position: , mismatch: 5, identity: 0.844

gcggtaaaaatcacggtcggcatacatcgtgg	CRISPR spacer
gctcgaaaaatcacgctcgggatacatcgtgg	Protospacer
**   ********** **** ***********

15. spacer 2.10|974728|32|NZ_CP046429|CRISPRCasFinder,CRT matches to NZ_CP016215 (Pseudomonas aeruginosa strain PA121617 plasmid pBM413, complete sequence) position: , mismatch: 5, identity: 0.844

gcggtaaaaatcacggtcggcatacatcgtgg	CRISPR spacer
gctcgaaaaatcacgctcgggatacatcgtgg	Protospacer
**   ********** **** ***********

16. spacer 2.4|974727|33|NZ_CP046429|PILER-CR matches to NZ_KY494864 (Pseudomonas aeruginosa strain FFUP_PS_37 plasmid pJB37, complete sequence) position: , mismatch: 6, identity: 0.818

ggcggtaaaaatcacggtcggcatacatcgtgg	CRISPR spacer
cgctcgaaaaatcacgctcgggatacatcgtgg	Protospacer
 **   ********** **** ***********

17. spacer 2.4|974727|33|NZ_CP046429|PILER-CR matches to NZ_KU130294 (Pseudomonas putida strain 12969 plasmid p12969-DIM, complete sequence) position: , mismatch: 6, identity: 0.818

ggcggtaaaaatcacggtcggcatacatcgtgg	CRISPR spacer
cgctcgaaaaatcacgctcgggatacatcgtgg	Protospacer
 **   ********** **** ***********

18. spacer 2.4|974727|33|NZ_CP046429|PILER-CR matches to NZ_CP009975 (Pseudomonas putida S12 plasmid pTTS12, complete sequence) position: , mismatch: 6, identity: 0.818

ggcggtaaaaatcacggtcggcatacatcgtgg	CRISPR spacer
cgctcgaaaaatcacgctcgggatacatcgtgg	Protospacer
 **   ********** **** ***********

19. spacer 2.4|974727|33|NZ_CP046429|PILER-CR matches to NZ_CP039989 (Pseudomonas aeruginosa strain T2436 plasmid pBT2436, complete sequence) position: , mismatch: 6, identity: 0.818

ggcggtaaaaatcacggtcggcatacatcgtgg	CRISPR spacer
cgctcgaaaaatcacgctcgggatacatcgtgg	Protospacer
 **   ********** **** ***********

20. spacer 2.4|974727|33|NZ_CP046429|PILER-CR matches to NZ_MN433457 (Pseudomonas aeruginosa strain PAB546 plasmid pNK546-KPC, complete sequence) position: , mismatch: 6, identity: 0.818

ggcggtaaaaatcacggtcggcatacatcgtgg	CRISPR spacer
cgctcgaaaaatcacgctcgggatacatcgtgg	Protospacer
 **   ********** **** ***********

21. spacer 2.4|974727|33|NZ_CP046429|PILER-CR matches to NZ_CP029096 (Pseudomonas aeruginosa strain AR439 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.818

ggcggtaaaaatcacggtcggcatacatcgtgg	CRISPR spacer
cgctcgaaaaatcacgctcgggatacatcgtgg	Protospacer
 **   ********** **** ***********

22. spacer 2.4|974727|33|NZ_CP046429|PILER-CR matches to NZ_CP045003 (Pseudomonas aeruginosa strain PAG5 plasmid pPAG5, complete sequence) position: , mismatch: 6, identity: 0.818

ggcggtaaaaatcacggtcggcatacatcgtgg	CRISPR spacer
cgctcgaaaaatcacgctcgggatacatcgtgg	Protospacer
 **   ********** **** ***********

23. spacer 2.4|974727|33|NZ_CP046429|PILER-CR matches to NZ_CP045917 (Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence) position: , mismatch: 6, identity: 0.818

ggcggtaaaaatcacggtcggcatacatcgtgg	CRISPR spacer
cgctcgaaaaatcacgctcgggatacatcgtgg	Protospacer
 **   ********** **** ***********

24. spacer 2.4|974727|33|NZ_CP046429|PILER-CR matches to MF344571 (Pseudomonas aeruginosa plasmid pR31014-IMP, complete sequence) position: , mismatch: 6, identity: 0.818

ggcggtaaaaatcacggtcggcatacatcgtgg	CRISPR spacer
cgctcgaaaaatcacgctcgggatacatcgtgg	Protospacer
 **   ********** **** ***********

25. spacer 2.4|974727|33|NZ_CP046429|PILER-CR matches to MF344569 (Pseudomonas aeruginosa plasmid p12939-PER, complete sequence) position: , mismatch: 6, identity: 0.818

ggcggtaaaaatcacggtcggcatacatcgtgg	CRISPR spacer
cgctcgaaaaatcacgctcgggatacatcgtgg	Protospacer
 **   ********** **** ***********

26. spacer 2.4|974727|33|NZ_CP046429|PILER-CR matches to MF344570 (Pseudomonas aeruginosa plasmid pA681-IMP, complete sequence) position: , mismatch: 6, identity: 0.818

ggcggtaaaaatcacggtcggcatacatcgtgg	CRISPR spacer
cgctcgaaaaatcacgctcgggatacatcgtgg	Protospacer
 **   ********** **** ***********

27. spacer 2.4|974727|33|NZ_CP046429|PILER-CR matches to NZ_CP039294 (Pseudomonas aeruginosa strain PABL048 plasmid pPABL048, complete sequence) position: , mismatch: 6, identity: 0.818

ggcggtaaaaatcacggtcggcatacatcgtgg	CRISPR spacer
cgctcgaaaaatcacgctcgggatacatcgtgg	Protospacer
 **   ********** **** ***********

28. spacer 2.4|974727|33|NZ_CP046429|PILER-CR matches to CP027478 (Pseudomonas koreensis strain P19E3 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.818

ggcggtaaaaatcacggtcggcatacatcgtgg	CRISPR spacer
cgctcgaaaaatcacgctcgggatacatcgtgg	Protospacer
 **   ********** **** ***********

29. spacer 2.4|974727|33|NZ_CP046429|PILER-CR matches to NZ_CP015879 (Pseudomonas citronellolis strain SJTE-3 plasmid pRBL16, complete sequence) position: , mismatch: 6, identity: 0.818

ggcggtaaaaatcacggtcggcatacatcgtgg	CRISPR spacer
cgctcgaaaaatcacgctcgggatacatcgtgg	Protospacer
 **   ********** **** ***********

30. spacer 2.4|974727|33|NZ_CP046429|PILER-CR matches to NZ_CP016215 (Pseudomonas aeruginosa strain PA121617 plasmid pBM413, complete sequence) position: , mismatch: 6, identity: 0.818

ggcggtaaaaatcacggtcggcatacatcgtgg	CRISPR spacer
cgctcgaaaaatcacgctcgggatacatcgtgg	Protospacer
 **   ********** **** ***********

31. spacer 2.8|974606|32|NZ_CP046429|CRISPRCasFinder,CRT matches to KJ019071 (Synechococcus phage ACG-2014g isolate Syn7803US105, complete genome) position: , mismatch: 7, identity: 0.781

taaaactataaccaacattaatcttttttaat	CRISPR spacer
ctaaactataaccaacattaaccattgtaatt	Protospacer
. *******************.* ** * * *

32. spacer 2.8|974606|32|NZ_CP046429|CRISPRCasFinder,CRT matches to MN694480 (Marine virus AFVG_250M133, complete genome) position: , mismatch: 7, identity: 0.781

taaaactataaccaacattaatc----ttttttaat	CRISPR spacer
taaaactacaactaacattaatcgaaattttc----	Protospacer
********.***.**********    ****.    

33. spacer 2.8|974606|32|NZ_CP046429|CRISPRCasFinder,CRT matches to MN694671 (Marine virus AFVG_250M145, complete genome) position: , mismatch: 7, identity: 0.781

taaaactataaccaacattaatc----ttttttaat	CRISPR spacer
taaaactacaactaacattaatcgaaattttc----	Protospacer
********.***.**********    ****.    

34. spacer 2.8|974606|32|NZ_CP046429|CRISPRCasFinder,CRT matches to MN694753 (Marine virus AFVG_250M144, complete genome) position: , mismatch: 7, identity: 0.781

taaaactataaccaacattaatc----ttttttaat	CRISPR spacer
taaaactacaactaacattaatcgaaattttc----	Protospacer
********.***.**********    ****.    

35. spacer 2.8|974606|32|NZ_CP046429|CRISPRCasFinder,CRT matches to MN694231 (Marine virus AFVG_250M143, complete genome) position: , mismatch: 7, identity: 0.781

taaaactataaccaacattaatc----ttttttaat	CRISPR spacer
taaaactacaactaacattaatcgaaattttc----	Protospacer
********.***.**********    ****.    

36. spacer 2.8|974606|32|NZ_CP046429|CRISPRCasFinder,CRT matches to MN693981 (Marine virus AFVG_250M146, complete genome) position: , mismatch: 7, identity: 0.781

taaaactataaccaacattaatc----ttttttaat	CRISPR spacer
taaaactacaactaacattaatcgaaattttc----	Protospacer
********.***.**********    ****.    

37. spacer 2.2|974605|33|NZ_CP046429|PILER-CR matches to NZ_CP046723 (Pantoea agglomerans strain ASB05 plasmid pASB05p1, complete sequence) position: , mismatch: 8, identity: 0.758

---gtaaaactataaccaacattaatcttttttaat	CRISPR spacer
tacgttga---ttaaacaacattaatctttcttaat	Protospacer
   ** .*    *** **************.*****

38. spacer 2.2|974605|33|NZ_CP046429|PILER-CR matches to NZ_CP034470 (Pantoea agglomerans strain CFSAN047153 plasmid pCFSAN047153_1, complete sequence) position: , mismatch: 8, identity: 0.758

---gtaaaactataaccaacattaatcttttttaat	CRISPR spacer
tacgttga---ttaaacaacattaatctttcttaat	Protospacer
   ** .*    *** **************.*****

39. spacer 2.2|974605|33|NZ_CP046429|PILER-CR matches to NZ_CP034149 (Pantoea agglomerans strain L15 plasmid pPagL15_1, complete sequence) position: , mismatch: 8, identity: 0.758

---gtaaaactataaccaacattaatcttttttaat	CRISPR spacer
tacgttga---ttaaacaacattaatctttcttaat	Protospacer
   ** .*    *** **************.*****

40. spacer 2.2|974605|33|NZ_CP046429|PILER-CR matches to NZ_CP034475 (Pantoea agglomerans strain CFSAN047154 plasmid pCFSAN047154_1, complete sequence) position: , mismatch: 8, identity: 0.758

---gtaaaactataaccaacattaatcttttttaat	CRISPR spacer
tacgttga---ttaaacaacattaatctttcttaat	Protospacer
   ** .*    *** **************.*****

41. spacer 2.2|974605|33|NZ_CP046429|PILER-CR matches to KJ019071 (Synechococcus phage ACG-2014g isolate Syn7803US105, complete genome) position: , mismatch: 8, identity: 0.758

gtaaaactataaccaacattaatcttttttaat	CRISPR spacer
cctaaactataaccaacattaaccattgtaatt	Protospacer
 . *******************.* ** * * *

42. spacer 2.8|974606|32|NZ_CP046429|CRISPRCasFinder,CRT matches to NZ_CP046723 (Pantoea agglomerans strain ASB05 plasmid pASB05p1, complete sequence) position: , mismatch: 8, identity: 0.75

taaaacta--taaccaacattaatcttttttaat	CRISPR spacer
--acgttgattaaacaacattaatctttcttaat	Protospacer
  * ..*.  *** **************.*****

43. spacer 2.8|974606|32|NZ_CP046429|CRISPRCasFinder,CRT matches to NZ_CP034470 (Pantoea agglomerans strain CFSAN047153 plasmid pCFSAN047153_1, complete sequence) position: , mismatch: 8, identity: 0.75

taaaacta--taaccaacattaatcttttttaat	CRISPR spacer
--acgttgattaaacaacattaatctttcttaat	Protospacer
  * ..*.  *** **************.*****

44. spacer 2.8|974606|32|NZ_CP046429|CRISPRCasFinder,CRT matches to NZ_CP034149 (Pantoea agglomerans strain L15 plasmid pPagL15_1, complete sequence) position: , mismatch: 8, identity: 0.75

taaaacta--taaccaacattaatcttttttaat	CRISPR spacer
--acgttgattaaacaacattaatctttcttaat	Protospacer
  * ..*.  *** **************.*****

45. spacer 2.8|974606|32|NZ_CP046429|CRISPRCasFinder,CRT matches to NZ_CP034475 (Pantoea agglomerans strain CFSAN047154 plasmid pCFSAN047154_1, complete sequence) position: , mismatch: 8, identity: 0.75

taaaacta--taaccaacattaatcttttttaat	CRISPR spacer
--acgttgattaaacaacattaatctttcttaat	Protospacer
  * ..*.  *** **************.*****

46. spacer 2.8|974606|32|NZ_CP046429|CRISPRCasFinder,CRT matches to MN694115 (Marine virus AFVG_250M901, complete genome) position: , mismatch: 8, identity: 0.75

taaaactataaccaacattaatcttttttaat	CRISPR spacer
ttacggaagaaccaagattaatattttttaat	Protospacer
* * .  * ****** ****** *********

47. spacer 2.8|974606|32|NZ_CP046429|CRISPRCasFinder,CRT matches to NZ_CP046630 (Streptococcus equinus strain CNU G6 plasmid p1_CNU_G6, complete sequence) position: , mismatch: 9, identity: 0.719

taaaactataaccaacattaatcttttttaat	CRISPR spacer
agttattataaacaacattaatcatttttctt	Protospacer
 .  *.***** *********** *****  *

48. spacer 2.8|974606|32|NZ_CP046429|CRISPRCasFinder,CRT matches to NZ_CP046920 (Streptococcus sp. CNU G2 plasmid p_CNU_G2, complete sequence) position: , mismatch: 9, identity: 0.719

taaaactataaccaacattaatcttttttaat	CRISPR spacer
agttattataaacaacattaatcatttttctt	Protospacer
 .  *.***** *********** *****  *

49. spacer 2.8|974606|32|NZ_CP046429|CRISPRCasFinder,CRT matches to MN694046 (Marine virus AFVG_250M906, complete genome) position: , mismatch: 9, identity: 0.719

taaaactataaccaacattaatc-----ttttttaat	CRISPR spacer
taaaactacaactaacattaatcgaaaacttc-----	Protospacer
********.***.**********     .**.     

50. spacer 2.8|974606|32|NZ_CP046429|CRISPRCasFinder,CRT matches to MN693836 (Marine virus AFVG_250M487, complete genome) position: , mismatch: 9, identity: 0.719

taaaactataaccaacattaatc-----ttttttaat	CRISPR spacer
taaaactacaactaacattaatcgaaaacttc-----	Protospacer
********.***.**********     .**.     

51. spacer 2.8|974606|32|NZ_CP046429|CRISPRCasFinder,CRT matches to MN693891 (Marine virus AFVG_250M480, complete genome) position: , mismatch: 9, identity: 0.719

taaaactataaccaacattaatc-----ttttttaat	CRISPR spacer
taaaactacaactaacattaatcgaaaacttc-----	Protospacer
********.***.**********     .**.     

52. spacer 2.8|974606|32|NZ_CP046429|CRISPRCasFinder,CRT matches to MK268344 (Salmonella phage Munch, complete genome) position: , mismatch: 9, identity: 0.719

taaaactataaccaacattaatcttttttaat	CRISPR spacer
taaaactaaaaccatcattaatcaatgctgcc	Protospacer
******** ***** ********  * .*. .

53. spacer 2.8|974606|32|NZ_CP046429|CRISPRCasFinder,CRT matches to MN694071 (Marine virus AFVG_250M483, complete genome) position: , mismatch: 9, identity: 0.719

taaaactataaccaacattaatc-----ttttttaat	CRISPR spacer
taaaactacaactaacattaatcgaaaacttc-----	Protospacer
********.***.**********     .**.     

54. spacer 2.8|974606|32|NZ_CP046429|CRISPRCasFinder,CRT matches to MN694294 (Marine virus AFVG_250M486, complete genome) position: , mismatch: 9, identity: 0.719

taaaactataaccaacattaatc-----ttttttaat	CRISPR spacer
taaaactacaactaacattaatcgaaaacttc-----	Protospacer
********.***.**********     .**.     

55. spacer 2.8|974606|32|NZ_CP046429|CRISPRCasFinder,CRT matches to MN693751 (Marine virus AFVG_250M485, complete genome) position: , mismatch: 9, identity: 0.719

taaaactataaccaacattaatc-----ttttttaat	CRISPR spacer
taaaactacaactaacattaatcgaaaacttc-----	Protospacer
********.***.**********     .**.     

56. spacer 2.8|974606|32|NZ_CP046429|CRISPRCasFinder,CRT matches to MN694002 (Marine virus AFVG_250M481, complete genome) position: , mismatch: 9, identity: 0.719

taaaactataaccaacattaatc-----ttttttaat	CRISPR spacer
taaaactacaactaacattaatcgaaaacttc-----	Protospacer
********.***.**********     .**.     

57. spacer 2.8|974606|32|NZ_CP046429|CRISPRCasFinder,CRT matches to MN694650 (Marine virus AFVG_250M482, complete genome) position: , mismatch: 9, identity: 0.719

taaaactataaccaacattaatc-----ttttttaat	CRISPR spacer
taaaactacaactaacattaatcgaaaacttc-----	Protospacer
********.***.**********     .**.     

58. spacer 2.8|974606|32|NZ_CP046429|CRISPRCasFinder,CRT matches to MN693906 (Marine virus AFVG_250M905, complete genome) position: , mismatch: 9, identity: 0.719

taaaactataaccaacattaatc-----ttttttaat	CRISPR spacer
taaaactacaactaacattaatcgaaaacttc-----	Protospacer
********.***.**********     .**.     

59. spacer 2.8|974606|32|NZ_CP046429|CRISPRCasFinder,CRT matches to MN694711 (Marine virus AFVG_250M484, complete genome) position: , mismatch: 9, identity: 0.719

taaaactataaccaacattaatc-----ttttttaat	CRISPR spacer
taaaactacaactaacattaatcgaaaacttc-----	Protospacer
********.***.**********     .**.     

60. spacer 2.13|974545|32|NZ_CP046429|CRT matches to KR052482 (Sinorhizobium phage phiN3, complete genome) position: , mismatch: 9, identity: 0.719

atccccgcggaggttgcgcaaccggtgtttta	CRISPR spacer
ttttttgcgtaggtttcgcaaccggtgttgtt	Protospacer
 *....*** ***** ************* * 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 12649 : 35846 25 Escherichia_phage(30.0%) transposase,integrase NA
DBSCAN-SWA_2 765654 : 809357 48 Acinetobacter_phage(25.0%) bacteriocin,tRNA,transposase,protease NA
DBSCAN-SWA_3 1074190 : 1140181 53 Salmonella_phage(41.18%) tail,tRNA NA
DBSCAN-SWA_4 1826603 : 1833915 7 Dickeya_phage(16.67%) integrase,protease attL 1827854:1827868|attR 1839033:1839047
DBSCAN-SWA_5 1905053 : 1979153 87 Salmonella_phage(74.14%) holin,transposase,head,protease,tail,terminase,integrase attL 1887119:1887138|attR 1957726:1957745
DBSCAN-SWA_6 2425183 : 2498781 89 Burkholderia_virus(38.1%) transposase,capsid,protease,tail,tRNA,plate,integrase attL 2415513:2415528|attR 2471386:2471401
DBSCAN-SWA_7 2679818 : 2684230 7 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_8 2888084 : 2895318 8 Morganella_phage(33.33%) NA NA
DBSCAN-SWA_9 3001618 : 3012125 10 Enterobacteria_phage(37.5%) NA NA
DBSCAN-SWA_10 3088016 : 3097187 10 Enterobacteria_phage(66.67%) tRNA NA
DBSCAN-SWA_11 3331696 : 3337727 6 Salmonella_virus(50.0%) NA NA
DBSCAN-SWA_12 3996793 : 4006558 11 Enterobacteria_phage(50.0%) integrase attL 3993364:3993377|attR 4004767:4004780
DBSCAN-SWA_13 4145521 : 4220057 80 Salmonella_phage(82.98%) capsid,head,plate,lysis,portal,tail,terminase,integrase attL 4175859:4175874|attR 4198862:4198877
DBSCAN-SWA_14 4669682 : 4707740 49 Salmonella_phage(76.74%) capsid,transposase,head,plate,lysis,portal,tail,terminase,integrase attL 4664646:4664660|attR 4676812:4676826
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage