Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP041031 Escherichia coli strain PT109 chromosome, complete genome 11 crisprs RT,csa3,PD-DExK,cas5,cas6e,cas1,cas2,cas3,DEDDh,c2c9_V-U4,DinG 1 26 12 1
NZ_CP041032 Escherichia coli strain PT109 plasmid pLB_CTX-M-15_PT109, complete sequence 0 crisprs RT 0 0 1 0
NZ_CP041033 Escherichia coli strain PT109 plasmid pLB_OXA-181_PT109, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP041031
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041031_1 639258-639397 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041031_2 682393-682510 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041031_3 1055843-1056359 Orphan I-E
8 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041031_4 1078743-1079382 Unclear I-E
10 spacers
cas2,cas1,cas6e,cas5

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041031_5 1580640-1580757 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041031_6 2261811-2261934 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041031_7 2919999-2920090 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041031_8 3215479-3215590 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041031_9 3228840-3228984 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041031_10 3743749-3743902 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041031_11 3931953-3932068 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP041031_8 8.2|3215548|26|NZ_CP041031|PILER-CR 3215548-3215573 26 NZ_CP041031.1 2786483-2786508 0 1.0

1. spacer 8.2|3215548|26|NZ_CP041031|PILER-CR matches to position: 2786483-2786508, mismatch: 0, identity: 1.0

atttacctctttcaggtaaactttat	CRISPR spacer
atttacctctttcaggtaaactttat	Protospacer
**************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP041031_7 7.1|2920025|40|NZ_CP041031|CRISPRCasFinder 2920025-2920064 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 0 1.0
NZ_CP041031_8 8.1|3215501|25|NZ_CP041031|PILER-CR 3215501-3215525 25 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 44572-44596 0 1.0
NZ_CP041031_8 8.2|3215548|26|NZ_CP041031|PILER-CR 3215548-3215573 26 NC_049946 Escherichia virus Lambda_4A7 genome assembly, chromosome: 1 37604-37629 0 1.0
NZ_CP041031_8 8.2|3215548|26|NZ_CP041031|PILER-CR 3215548-3215573 26 LR595861 Escherichia virus Lambda_4C10 genome assembly, chromosome: 1 37887-37912 0 1.0
NZ_CP041031_8 8.2|3215548|26|NZ_CP041031|PILER-CR 3215548-3215573 26 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 44524-44549 1 0.962
NZ_CP041031_6 6.1|2261854|38|NZ_CP041031|CRISPRCasFinder 2261854-2261891 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
NZ_CP041031_8 8.1|3215501|25|NZ_CP041031|PILER-CR 3215501-3215525 25 NC_049946 Escherichia virus Lambda_4A7 genome assembly, chromosome: 1 37652-37676 2 0.92
NZ_CP041031_8 8.1|3215501|25|NZ_CP041031|PILER-CR 3215501-3215525 25 LR595861 Escherichia virus Lambda_4C10 genome assembly, chromosome: 1 37935-37959 2 0.92
NZ_CP041031_4 4.28|1079322|32|NZ_CP041031|CRT 1079322-1079353 32 LC542972 Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence 246937-246968 3 0.906
NZ_CP041031_10 10.1|3743802|48|NZ_CP041031|CRISPRCasFinder 3743802-3743849 48 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 4089-4136 3 0.938
NZ_CP041031_10 10.1|3743802|48|NZ_CP041031|CRISPRCasFinder 3743802-3743849 48 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 4088-4135 3 0.938
NZ_CP041031_10 10.1|3743802|48|NZ_CP041031|CRISPRCasFinder 3743802-3743849 48 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 4088-4135 3 0.938
NZ_CP041031_10 10.1|3743802|48|NZ_CP041031|CRISPRCasFinder 3743802-3743849 48 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 4088-4135 3 0.938
NZ_CP041031_8 8.2|3215548|26|NZ_CP041031|PILER-CR 3215548-3215573 26 NZ_CP015341 Lactobacillus brevis strain 100D8 plasmid unnamed3, complete sequence 35661-35686 4 0.846
NZ_CP041031_1 1.1|639307|42|NZ_CP041031|CRISPRCasFinder 639307-639348 42 NZ_CP010208 Escherichia coli strain M11 plasmid B, complete sequence 30214-30255 7 0.833
NZ_CP041031_3 3.15|1056238|32|NZ_CP041031|CRISPRCasFinder,CRT 1056238-1056269 32 NZ_MG299151 Shigella sonnei strain SH287-2 plasmid pSH287-2, complete sequence 51276-51307 7 0.781
NZ_CP041031_3 3.15|1056238|32|NZ_CP041031|CRISPRCasFinder,CRT 1056238-1056269 32 NZ_KY471628 Shigella sonnei strain SH15sh99 plasmid pSH15sh99, complete sequence 45716-45747 7 0.781
NZ_CP041031_3 3.15|1056238|32|NZ_CP041031|CRISPRCasFinder,CRT 1056238-1056269 32 NZ_MG299131 Shigella sonnei strain SH271-2 plasmid pSH271-2, complete sequence 51276-51307 7 0.781
NZ_CP041031_3 3.15|1056238|32|NZ_CP041031|CRISPRCasFinder,CRT 1056238-1056269 32 NZ_KY471629 Shigella sonnei strain SH15sh105 plasmid pSH15sh104, complete sequence 45716-45747 7 0.781
NZ_CP041031_3 3.15|1056238|32|NZ_CP041031|CRISPRCasFinder,CRT 1056238-1056269 32 NZ_MG299133 Shigella sonnei strain SH272-2 plasmid pSH272-2, complete sequence 51276-51307 7 0.781
NZ_CP041031_3 3.15|1056238|32|NZ_CP041031|CRISPRCasFinder,CRT 1056238-1056269 32 NZ_MG299128 Shigella sonnei strain SH262-2 plasmid pSH262-2, complete sequence 51276-51307 7 0.781
NZ_CP041031_3 3.15|1056238|32|NZ_CP041031|CRISPRCasFinder,CRT 1056238-1056269 32 NZ_MG299147 Shigella sonnei strain SH284-2 plasmid pSH284-2, complete sequence 51276-51307 7 0.781
NZ_CP041031_3 3.15|1056238|32|NZ_CP041031|CRISPRCasFinder,CRT 1056238-1056269 32 NC_018995 Escherichia coli plasmid pHUSEC41-1, complete sequence 29015-29046 7 0.781
NZ_CP041031_3 3.15|1056238|32|NZ_CP041031|CRISPRCasFinder,CRT 1056238-1056269 32 NZ_CP053235 Escherichia coli strain SCU-106 plasmid pSCU-106-1, complete sequence 78292-78323 7 0.781
NZ_CP041031_3 3.15|1056238|32|NZ_CP041031|CRISPRCasFinder,CRT 1056238-1056269 32 NZ_CP005999 Escherichia coli B7A plasmid pEB1, complete sequence 39563-39594 7 0.781
NZ_CP041031_3 3.15|1056238|32|NZ_CP041031|CRISPRCasFinder,CRT 1056238-1056269 32 KU932021 Escherichia coli plasmid pEC3I, complete sequence 51902-51933 7 0.781
NZ_CP041031_3 3.15|1056238|32|NZ_CP041031|CRISPRCasFinder,CRT 1056238-1056269 32 NZ_CP024154 Escherichia coli strain 14EC033 plasmid p14EC033g, complete sequence 18560-18591 7 0.781
NZ_CP041031_3 3.15|1056238|32|NZ_CP041031|CRISPRCasFinder,CRT 1056238-1056269 32 NC_011754 Escherichia coli ED1a plasmid pECOED, complete sequence 49240-49271 7 0.781
NZ_CP041031_3 3.15|1056238|32|NZ_CP041031|CRISPRCasFinder,CRT 1056238-1056269 32 NZ_CP015141 Escherichia coli strain Ecol_732 plasmid pEC732_3, complete sequence 81434-81465 7 0.781
NZ_CP041031_3 3.15|1056238|32|NZ_CP041031|CRISPRCasFinder,CRT 1056238-1056269 32 NZ_LR213460 Shigella sonnei strain AUSMDU00008333 isolate AUSMDU00008333 plasmid 3 28916-28947 7 0.781
NZ_CP041031_3 3.15|1056238|32|NZ_CP041031|CRISPRCasFinder,CRT 1056238-1056269 32 NZ_MH287044 Escherichia coli strain 5.1-R1 plasmid pCERC6, complete sequence 36182-36213 7 0.781
NZ_CP041031_3 3.15|1056238|32|NZ_CP041031|CRISPRCasFinder,CRT 1056238-1056269 32 NZ_MH618673 Escherichia coli strain 838B plasmid p838B-R, complete sequence 32230-32261 7 0.781
NZ_CP041031_4 4.1|1078773|31|NZ_CP041031|CRISPRCasFinder 1078773-1078803 31 NC_007336 Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence 62682-62712 7 0.774
NZ_CP041031_4 4.1|1078773|31|NZ_CP041031|CRISPRCasFinder 1078773-1078803 31 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 1222106-1222136 7 0.774
NZ_CP041031_4 4.1|1078773|31|NZ_CP041031|CRISPRCasFinder 1078773-1078803 31 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 2467672-2467702 7 0.774
NZ_CP041031_4 4.4|1078956|31|NZ_CP041031|CRISPRCasFinder 1078956-1078986 31 NZ_CP034185 Deinococcus sp. S14-83 strain S14-83T plasmid unnamed1, complete sequence 17977-18007 7 0.774
NZ_CP041031_4 4.7|1079139|31|NZ_CP041031|CRISPRCasFinder 1079139-1079169 31 NC_007336 Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence 530641-530671 7 0.774
NZ_CP041031_4 4.28|1079322|32|NZ_CP041031|CRT 1079322-1079353 32 NZ_CP015038 Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence 112768-112799 7 0.781
NZ_CP041031_1 1.1|639307|42|NZ_CP041031|CRISPRCasFinder 639307-639348 42 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 24899-24940 8 0.81
NZ_CP041031_3 3.7|1056237|33|NZ_CP041031|PILER-CR 1056237-1056269 33 NZ_MG299151 Shigella sonnei strain SH287-2 plasmid pSH287-2, complete sequence 51275-51307 8 0.758
NZ_CP041031_3 3.7|1056237|33|NZ_CP041031|PILER-CR 1056237-1056269 33 NZ_KY471628 Shigella sonnei strain SH15sh99 plasmid pSH15sh99, complete sequence 45715-45747 8 0.758
NZ_CP041031_3 3.7|1056237|33|NZ_CP041031|PILER-CR 1056237-1056269 33 NZ_MG299131 Shigella sonnei strain SH271-2 plasmid pSH271-2, complete sequence 51275-51307 8 0.758
NZ_CP041031_3 3.7|1056237|33|NZ_CP041031|PILER-CR 1056237-1056269 33 NZ_KY471629 Shigella sonnei strain SH15sh105 plasmid pSH15sh104, complete sequence 45715-45747 8 0.758
NZ_CP041031_3 3.7|1056237|33|NZ_CP041031|PILER-CR 1056237-1056269 33 NZ_MG299133 Shigella sonnei strain SH272-2 plasmid pSH272-2, complete sequence 51275-51307 8 0.758
NZ_CP041031_3 3.7|1056237|33|NZ_CP041031|PILER-CR 1056237-1056269 33 NZ_MG299128 Shigella sonnei strain SH262-2 plasmid pSH262-2, complete sequence 51275-51307 8 0.758
NZ_CP041031_3 3.7|1056237|33|NZ_CP041031|PILER-CR 1056237-1056269 33 NZ_MG299147 Shigella sonnei strain SH284-2 plasmid pSH284-2, complete sequence 51275-51307 8 0.758
NZ_CP041031_3 3.7|1056237|33|NZ_CP041031|PILER-CR 1056237-1056269 33 NC_018995 Escherichia coli plasmid pHUSEC41-1, complete sequence 29014-29046 8 0.758
NZ_CP041031_3 3.7|1056237|33|NZ_CP041031|PILER-CR 1056237-1056269 33 NZ_CP053235 Escherichia coli strain SCU-106 plasmid pSCU-106-1, complete sequence 78291-78323 8 0.758
NZ_CP041031_3 3.7|1056237|33|NZ_CP041031|PILER-CR 1056237-1056269 33 NZ_CP024154 Escherichia coli strain 14EC033 plasmid p14EC033g, complete sequence 18559-18591 8 0.758
NZ_CP041031_3 3.7|1056237|33|NZ_CP041031|PILER-CR 1056237-1056269 33 NC_011754 Escherichia coli ED1a plasmid pECOED, complete sequence 49239-49271 8 0.758
NZ_CP041031_3 3.7|1056237|33|NZ_CP041031|PILER-CR 1056237-1056269 33 NZ_CP015141 Escherichia coli strain Ecol_732 plasmid pEC732_3, complete sequence 81433-81465 8 0.758
NZ_CP041031_3 3.7|1056237|33|NZ_CP041031|PILER-CR 1056237-1056269 33 NZ_LR213460 Shigella sonnei strain AUSMDU00008333 isolate AUSMDU00008333 plasmid 3 28915-28947 8 0.758
NZ_CP041031_3 3.7|1056237|33|NZ_CP041031|PILER-CR 1056237-1056269 33 NZ_MH287044 Escherichia coli strain 5.1-R1 plasmid pCERC6, complete sequence 36181-36213 8 0.758
NZ_CP041031_3 3.7|1056237|33|NZ_CP041031|PILER-CR 1056237-1056269 33 NZ_MH618673 Escherichia coli strain 838B plasmid p838B-R, complete sequence 32229-32261 8 0.758
NZ_CP041031_3 3.7|1056237|33|NZ_CP041031|PILER-CR 1056237-1056269 33 NZ_CP005999 Escherichia coli B7A plasmid pEB1, complete sequence 39563-39595 8 0.758
NZ_CP041031_3 3.7|1056237|33|NZ_CP041031|PILER-CR 1056237-1056269 33 KU932021 Escherichia coli plasmid pEC3I, complete sequence 51902-51934 8 0.758
NZ_CP041031_3 3.14|1056177|32|NZ_CP041031|CRISPRCasFinder,CRT 1056177-1056208 32 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1417960-1417991 8 0.75
NZ_CP041031_4 4.4|1078956|31|NZ_CP041031|CRISPRCasFinder 1078956-1078986 31 NZ_CP017753 Cupriavidus sp. USMAHM13 plasmid unnamed1, complete sequence 97498-97528 8 0.742
NZ_CP041031_4 4.7|1079139|31|NZ_CP041031|CRISPRCasFinder 1079139-1079169 31 NZ_CP036297 Planctomycetes bacterium Pla86 plasmid pPla86_1, complete sequence 14953-14983 8 0.742
NZ_CP041031_4 4.7|1079139|31|NZ_CP041031|CRISPRCasFinder 1079139-1079169 31 NZ_CP036288 Planctomycetes bacterium Pla133 plasmid pPla133_1, complete sequence 14983-15013 8 0.742
NZ_CP041031_4 4.7|1079139|31|NZ_CP041031|CRISPRCasFinder 1079139-1079169 31 NZ_CP015882 Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence 3454-3484 8 0.742
NZ_CP041031_4 4.7|1079139|31|NZ_CP041031|CRISPRCasFinder 1079139-1079169 31 NZ_CP017750 Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence 148992-149022 8 0.742
NZ_CP041031_4 4.10|1078772|33|NZ_CP041031|PILER-CR 1078772-1078804 33 NC_007336 Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence 62681-62713 8 0.758
NZ_CP041031_4 4.16|1079138|33|NZ_CP041031|PILER-CR 1079138-1079170 33 NC_007336 Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence 530640-530672 8 0.758
NZ_CP041031_4 4.19|1078773|32|NZ_CP041031|CRT 1078773-1078804 32 NC_007336 Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence 62682-62713 8 0.75
NZ_CP041031_4 4.19|1078773|32|NZ_CP041031|CRT 1078773-1078804 32 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 1222106-1222137 8 0.75
NZ_CP041031_4 4.19|1078773|32|NZ_CP041031|CRT 1078773-1078804 32 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 2467671-2467702 8 0.75
NZ_CP041031_4 4.19|1078773|32|NZ_CP041031|CRT 1078773-1078804 32 NC_008759 Polaromonas naphthalenivorans CJ2 plasmid pPNAP03, complete sequence 12670-12701 8 0.75
NZ_CP041031_4 4.22|1078956|32|NZ_CP041031|CRT 1078956-1078987 32 NZ_CP034185 Deinococcus sp. S14-83 strain S14-83T plasmid unnamed1, complete sequence 17977-18008 8 0.75
NZ_CP041031_4 4.22|1078956|32|NZ_CP041031|CRT 1078956-1078987 32 NZ_CP017753 Cupriavidus sp. USMAHM13 plasmid unnamed1, complete sequence 97497-97528 8 0.75
NZ_CP041031_4 4.25|1079139|32|NZ_CP041031|CRT 1079139-1079170 32 NZ_CP017750 Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence 148991-149022 8 0.75
NZ_CP041031_4 4.25|1079139|32|NZ_CP041031|CRT 1079139-1079170 32 NC_007336 Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence 530640-530671 8 0.75
NZ_CP041031_4 4.26|1079200|32|NZ_CP041031|CRT 1079200-1079231 32 NZ_CP006991 Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence 532343-532374 8 0.75
NZ_CP041031_4 4.28|1079322|32|NZ_CP041031|CRT 1079322-1079353 32 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 1428097-1428128 8 0.75
NZ_CP041031_1 1.1|639307|42|NZ_CP041031|CRISPRCasFinder 639307-639348 42 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 24786-24827 9 0.786
NZ_CP041031_4 4.1|1078773|31|NZ_CP041031|CRISPRCasFinder 1078773-1078803 31 NC_011987 Agrobacterium radiobacter K84 plasmid pAtK84c, complete sequence 86182-86212 9 0.71
NZ_CP041031_4 4.2|1078834|31|NZ_CP041031|CRISPRCasFinder 1078834-1078864 31 CP011075 Brevibacillus laterosporus strain B9 plasmid unnamed1, complete sequence 244686-244716 9 0.71
NZ_CP041031_4 4.2|1078834|31|NZ_CP041031|CRISPRCasFinder 1078834-1078864 31 GU075905 Prochlorococcus phage P-HM2, complete genome 78536-78566 9 0.71
NZ_CP041031_4 4.4|1078956|31|NZ_CP041031|CRISPRCasFinder 1078956-1078986 31 NZ_CP017750 Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence 405875-405905 9 0.71
NZ_CP041031_4 4.4|1078956|31|NZ_CP041031|CRISPRCasFinder 1078956-1078986 31 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2248363-2248393 9 0.71
NZ_CP041031_4 4.8|1079200|31|NZ_CP041031|CRISPRCasFinder 1079200-1079230 31 NZ_CP040723 Rhodococcus pyridinivorans strain YF3 plasmid unnamed4, complete sequence 35740-35770 9 0.71
NZ_CP041031_4 4.10|1078772|33|NZ_CP041031|PILER-CR 1078772-1078804 33 NC_011987 Agrobacterium radiobacter K84 plasmid pAtK84c, complete sequence 86181-86213 9 0.727
NZ_CP041031_4 4.13|1078955|33|NZ_CP041031|PILER-CR 1078955-1078987 33 NZ_CP034185 Deinococcus sp. S14-83 strain S14-83T plasmid unnamed1, complete sequence 17976-18008 9 0.727
NZ_CP041031_4 4.22|1078956|32|NZ_CP041031|CRT 1078956-1078987 32 NZ_CP017750 Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence 405875-405906 9 0.719
NZ_CP041031_4 4.25|1079139|32|NZ_CP041031|CRT 1079139-1079170 32 NZ_CP036297 Planctomycetes bacterium Pla86 plasmid pPla86_1, complete sequence 14953-14984 9 0.719
NZ_CP041031_4 4.25|1079139|32|NZ_CP041031|CRT 1079139-1079170 32 NZ_CP036288 Planctomycetes bacterium Pla133 plasmid pPla133_1, complete sequence 14983-15014 9 0.719
NZ_CP041031_4 4.25|1079139|32|NZ_CP041031|CRT 1079139-1079170 32 NZ_CP015882 Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence 3454-3485 9 0.719
NZ_CP041031_4 4.26|1079200|32|NZ_CP041031|CRT 1079200-1079231 32 NZ_CP040723 Rhodococcus pyridinivorans strain YF3 plasmid unnamed4, complete sequence 35740-35771 9 0.719
NZ_CP041031_4 4.28|1079322|32|NZ_CP041031|CRT 1079322-1079353 32 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 141278-141309 9 0.719
NZ_CP041031_3 3.9|1055872|32|NZ_CP041031|CRISPRCasFinder,CRT 1055872-1055903 32 NZ_CP030933 Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence 51062-51093 10 0.688
NZ_CP041031_4 4.11|1078833|33|NZ_CP041031|PILER-CR 1078833-1078865 33 GU075905 Prochlorococcus phage P-HM2, complete genome 78535-78567 10 0.697
NZ_CP041031_4 4.16|1079138|33|NZ_CP041031|PILER-CR 1079138-1079170 33 NZ_CP036297 Planctomycetes bacterium Pla86 plasmid pPla86_1, complete sequence 14952-14984 10 0.697
NZ_CP041031_4 4.16|1079138|33|NZ_CP041031|PILER-CR 1079138-1079170 33 NZ_CP036288 Planctomycetes bacterium Pla133 plasmid pPla133_1, complete sequence 14982-15014 10 0.697
NZ_CP041031_4 4.17|1079199|33|NZ_CP041031|PILER-CR 1079199-1079231 33 NZ_CP040723 Rhodococcus pyridinivorans strain YF3 plasmid unnamed4, complete sequence 35739-35771 10 0.697
NZ_CP041031_4 4.19|1078773|32|NZ_CP041031|CRT 1078773-1078804 32 NC_011987 Agrobacterium radiobacter K84 plasmid pAtK84c, complete sequence 86181-86212 10 0.688
NZ_CP041031_4 4.20|1078834|32|NZ_CP041031|CRT 1078834-1078865 32 CP011075 Brevibacillus laterosporus strain B9 plasmid unnamed1, complete sequence 244686-244717 10 0.688
NZ_CP041031_4 4.20|1078834|32|NZ_CP041031|CRT 1078834-1078865 32 GU075905 Prochlorococcus phage P-HM2, complete genome 78536-78567 10 0.688
NZ_CP041031_4 4.22|1078956|32|NZ_CP041031|CRT 1078956-1078987 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2248362-2248393 10 0.688

1. spacer 7.1|2920025|40|NZ_CP041031|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgctgcgggtcattcttgaaattacccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
****************************************

2. spacer 8.1|3215501|25|NZ_CP041031|PILER-CR matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcctttacctgatttgggtaaac	CRISPR spacer
gtgcctttacctgatttgggtaaac	Protospacer
*************************

3. spacer 8.2|3215548|26|NZ_CP041031|PILER-CR matches to NC_049946 (Escherichia virus Lambda_4A7 genome assembly, chromosome: 1) position: , mismatch: 0, identity: 1.0

atttacctctttcaggtaaactttat	CRISPR spacer
atttacctctttcaggtaaactttat	Protospacer
**************************

4. spacer 8.2|3215548|26|NZ_CP041031|PILER-CR matches to LR595861 (Escherichia virus Lambda_4C10 genome assembly, chromosome: 1) position: , mismatch: 0, identity: 1.0

atttacctctttcaggtaaactttat	CRISPR spacer
atttacctctttcaggtaaactttat	Protospacer
**************************

5. spacer 8.2|3215548|26|NZ_CP041031|PILER-CR matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 1, identity: 0.962

atttacctctttcaggtaaactttat	CRISPR spacer
atttacctctttaaggtaaactttat	Protospacer
************ *************

6. spacer 6.1|2261854|38|NZ_CP041031|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

7. spacer 8.1|3215501|25|NZ_CP041031|PILER-CR matches to NC_049946 (Escherichia virus Lambda_4A7 genome assembly, chromosome: 1) position: , mismatch: 2, identity: 0.92

gtgcctttacctgatttgggtaaac	CRISPR spacer
acgcctttacctgatttgggtaaac	Protospacer
..***********************

8. spacer 8.1|3215501|25|NZ_CP041031|PILER-CR matches to LR595861 (Escherichia virus Lambda_4C10 genome assembly, chromosome: 1) position: , mismatch: 2, identity: 0.92

gtgcctttacctgatttgggtaaac	CRISPR spacer
acgcctttacctgatttgggtaaac	Protospacer
..***********************

9. spacer 4.28|1079322|32|NZ_CP041031|CRT matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 3, identity: 0.906

ggcgcactggatgcgatgatggatatcactta	CRISPR spacer
gacgcactggatgcgatgatggacatcacttg	Protospacer
*.*********************.*******.

10. spacer 10.1|3743802|48|NZ_CP041031|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 3, identity: 0.938

tcagcgtcgcatcaggcatctgcgcataaccgccggatgcggcgtaaa	CRISPR spacer
ccagcgtcgcatcaggcatctgcgcataactgccggatgcggcataaa	Protospacer
.*****************************.************.****

11. spacer 10.1|3743802|48|NZ_CP041031|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 3, identity: 0.938

tcagcgtcgcatcaggcatctgcgcataaccgccggatgcggcgtaaa	CRISPR spacer
ccagcgtcgcatcaggcatctgcgcataactgccggatgcggcataaa	Protospacer
.*****************************.************.****

12. spacer 10.1|3743802|48|NZ_CP041031|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 3, identity: 0.938

tcagcgtcgcatcaggcatctgcgcataaccgccggatgcggcgtaaa	CRISPR spacer
ccagcgtcgcatcaggcatctgcgcataactgccggatgcggcataaa	Protospacer
.*****************************.************.****

13. spacer 10.1|3743802|48|NZ_CP041031|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 3, identity: 0.938

tcagcgtcgcatcaggcatctgcgcataaccgccggatgcggcgtaaa	CRISPR spacer
ccagcgtcgcatcaggcatctgcgcataactgccggatgcggcataaa	Protospacer
.*****************************.************.****

14. spacer 8.2|3215548|26|NZ_CP041031|PILER-CR matches to NZ_CP015341 (Lactobacillus brevis strain 100D8 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.846

atttacctctttcaggtaaactttat	CRISPR spacer
aggtatctcattcaggtaaactttat	Protospacer
*  **.*** ****************

15. spacer 1.1|639307|42|NZ_CP041031|CRISPRCasFinder matches to NZ_CP010208 (Escherichia coli strain M11 plasmid B, complete sequence) position: , mismatch: 7, identity: 0.833

acagcagtcggatgcggcgtaaacaccttatctgacctacgt	CRISPR spacer
acaaatgccggatgcggcgtaaacgccttatctggcctacgc	Protospacer
***.  *.****************.*********.******.

16. spacer 3.15|1056238|32|NZ_CP041031|CRISPRCasFinder,CRT matches to NZ_MG299151 (Shigella sonnei strain SH287-2 plasmid pSH287-2, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

17. spacer 3.15|1056238|32|NZ_CP041031|CRISPRCasFinder,CRT matches to NZ_KY471628 (Shigella sonnei strain SH15sh99 plasmid pSH15sh99, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

18. spacer 3.15|1056238|32|NZ_CP041031|CRISPRCasFinder,CRT matches to NZ_MG299131 (Shigella sonnei strain SH271-2 plasmid pSH271-2, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

19. spacer 3.15|1056238|32|NZ_CP041031|CRISPRCasFinder,CRT matches to NZ_KY471629 (Shigella sonnei strain SH15sh105 plasmid pSH15sh104, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

20. spacer 3.15|1056238|32|NZ_CP041031|CRISPRCasFinder,CRT matches to NZ_MG299133 (Shigella sonnei strain SH272-2 plasmid pSH272-2, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

21. spacer 3.15|1056238|32|NZ_CP041031|CRISPRCasFinder,CRT matches to NZ_MG299128 (Shigella sonnei strain SH262-2 plasmid pSH262-2, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

22. spacer 3.15|1056238|32|NZ_CP041031|CRISPRCasFinder,CRT matches to NZ_MG299147 (Shigella sonnei strain SH284-2 plasmid pSH284-2, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

23. spacer 3.15|1056238|32|NZ_CP041031|CRISPRCasFinder,CRT matches to NC_018995 (Escherichia coli plasmid pHUSEC41-1, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

24. spacer 3.15|1056238|32|NZ_CP041031|CRISPRCasFinder,CRT matches to NZ_CP053235 (Escherichia coli strain SCU-106 plasmid pSCU-106-1, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

25. spacer 3.15|1056238|32|NZ_CP041031|CRISPRCasFinder,CRT matches to NZ_CP005999 (Escherichia coli B7A plasmid pEB1, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

26. spacer 3.15|1056238|32|NZ_CP041031|CRISPRCasFinder,CRT matches to KU932021 (Escherichia coli plasmid pEC3I, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

27. spacer 3.15|1056238|32|NZ_CP041031|CRISPRCasFinder,CRT matches to NZ_CP024154 (Escherichia coli strain 14EC033 plasmid p14EC033g, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

28. spacer 3.15|1056238|32|NZ_CP041031|CRISPRCasFinder,CRT matches to NC_011754 (Escherichia coli ED1a plasmid pECOED, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

29. spacer 3.15|1056238|32|NZ_CP041031|CRISPRCasFinder,CRT matches to NZ_CP015141 (Escherichia coli strain Ecol_732 plasmid pEC732_3, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

30. spacer 3.15|1056238|32|NZ_CP041031|CRISPRCasFinder,CRT matches to NZ_LR213460 (Shigella sonnei strain AUSMDU00008333 isolate AUSMDU00008333 plasmid 3) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

31. spacer 3.15|1056238|32|NZ_CP041031|CRISPRCasFinder,CRT matches to NZ_MH287044 (Escherichia coli strain 5.1-R1 plasmid pCERC6, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

32. spacer 3.15|1056238|32|NZ_CP041031|CRISPRCasFinder,CRT matches to NZ_MH618673 (Escherichia coli strain 838B plasmid p838B-R, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

33. spacer 4.1|1078773|31|NZ_CP041031|CRISPRCasFinder matches to NC_007336 (Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.774

ttgcccgcgcaattccgggagcatccgcaat	CRISPR spacer
tccctatcgcaatgccggcagcatccgcaat	Protospacer
*. *.  ****** **** ************

34. spacer 4.1|1078773|31|NZ_CP041031|CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.774

ttgcccgcgcaattccgggagcatccgcaat	CRISPR spacer
ttgcgcgcgcaattccgtgagcagcgccatc	Protospacer
**** ************ ***** *  ** .

35. spacer 4.1|1078773|31|NZ_CP041031|CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774

ttgcccgcgcaattccgggagcatccgcaat	CRISPR spacer
ttgcgcgcgcaattccgtgagcagcgccatc	Protospacer
**** ************ ***** *  ** .

36. spacer 4.4|1078956|31|NZ_CP041031|CRISPRCasFinder matches to NZ_CP034185 (Deinococcus sp. S14-83 strain S14-83T plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774

cccgtcaccgacgcgcagtggcgctaccgtg	CRISPR spacer
agcgtcaccgacgcgcagggccgctaccaac	Protospacer
  **************** * *******.  

37. spacer 4.7|1079139|31|NZ_CP041031|CRISPRCasFinder matches to NC_007336 (Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.774

ccgaacggctggcgaagcaggtggctggcgt	CRISPR spacer
ccgaacaggtggcgaagcaggtgatgggcca	Protospacer
******.* **************.. ***  

38. spacer 4.28|1079322|32|NZ_CP041031|CRT matches to NZ_CP015038 (Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence) position: , mismatch: 7, identity: 0.781

ggcgcactggatgcgatgatggat-atcactta	CRISPR spacer
ggcgcactggctgcgatgaaggacgatcaacc-	Protospacer
********** ******** ***. **** .. 

39. spacer 1.1|639307|42|NZ_CP041031|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 8, identity: 0.81

acagcagtcggatgcggcgtaaacaccttatctgacctacgt	CRISPR spacer
attgatgtcggatgcggcgtaaacgccttatccgacctacaa	Protospacer
*. *  ******************.*******.*******. 

40. spacer 3.7|1056237|33|NZ_CP041031|PILER-CR matches to NZ_MG299151 (Shigella sonnei strain SH287-2 plasmid pSH287-2, complete sequence) position: , mismatch: 8, identity: 0.758

gaaatatccagggctgggctggaggcagacggc--	CRISPR spacer
acgttatccagggctgagctgcaggcag--ggcca	Protospacer
. . ************.**** ******  ***  

41. spacer 3.7|1056237|33|NZ_CP041031|PILER-CR matches to NZ_KY471628 (Shigella sonnei strain SH15sh99 plasmid pSH15sh99, complete sequence) position: , mismatch: 8, identity: 0.758

gaaatatccagggctgggctggaggcagacggc--	CRISPR spacer
acgttatccagggctgagctgcaggcag--ggcca	Protospacer
. . ************.**** ******  ***  

42. spacer 3.7|1056237|33|NZ_CP041031|PILER-CR matches to NZ_MG299131 (Shigella sonnei strain SH271-2 plasmid pSH271-2, complete sequence) position: , mismatch: 8, identity: 0.758

gaaatatccagggctgggctggaggcagacggc--	CRISPR spacer
acgttatccagggctgagctgcaggcag--ggcca	Protospacer
. . ************.**** ******  ***  

43. spacer 3.7|1056237|33|NZ_CP041031|PILER-CR matches to NZ_KY471629 (Shigella sonnei strain SH15sh105 plasmid pSH15sh104, complete sequence) position: , mismatch: 8, identity: 0.758

gaaatatccagggctgggctggaggcagacggc--	CRISPR spacer
acgttatccagggctgagctgcaggcag--ggcca	Protospacer
. . ************.**** ******  ***  

44. spacer 3.7|1056237|33|NZ_CP041031|PILER-CR matches to NZ_MG299133 (Shigella sonnei strain SH272-2 plasmid pSH272-2, complete sequence) position: , mismatch: 8, identity: 0.758

gaaatatccagggctgggctggaggcagacggc--	CRISPR spacer
acgttatccagggctgagctgcaggcag--ggcca	Protospacer
. . ************.**** ******  ***  

45. spacer 3.7|1056237|33|NZ_CP041031|PILER-CR matches to NZ_MG299128 (Shigella sonnei strain SH262-2 plasmid pSH262-2, complete sequence) position: , mismatch: 8, identity: 0.758

gaaatatccagggctgggctggaggcagacggc--	CRISPR spacer
acgttatccagggctgagctgcaggcag--ggcca	Protospacer
. . ************.**** ******  ***  

46. spacer 3.7|1056237|33|NZ_CP041031|PILER-CR matches to NZ_MG299147 (Shigella sonnei strain SH284-2 plasmid pSH284-2, complete sequence) position: , mismatch: 8, identity: 0.758

gaaatatccagggctgggctggaggcagacggc--	CRISPR spacer
acgttatccagggctgagctgcaggcag--ggcca	Protospacer
. . ************.**** ******  ***  

47. spacer 3.7|1056237|33|NZ_CP041031|PILER-CR matches to NC_018995 (Escherichia coli plasmid pHUSEC41-1, complete sequence) position: , mismatch: 8, identity: 0.758

gaaatatccagggctgggctggaggcagacggc--	CRISPR spacer
acgttatccagggctgagctgcaggcag--ggcca	Protospacer
. . ************.**** ******  ***  

48. spacer 3.7|1056237|33|NZ_CP041031|PILER-CR matches to NZ_CP053235 (Escherichia coli strain SCU-106 plasmid pSCU-106-1, complete sequence) position: , mismatch: 8, identity: 0.758

gaaatatccagggctgggctggaggcagacggc--	CRISPR spacer
acgttatccagggctgagctgcaggcag--ggcca	Protospacer
. . ************.**** ******  ***  

49. spacer 3.7|1056237|33|NZ_CP041031|PILER-CR matches to NZ_CP024154 (Escherichia coli strain 14EC033 plasmid p14EC033g, complete sequence) position: , mismatch: 8, identity: 0.758

gaaatatccagggctgggctggaggcagacggc--	CRISPR spacer
acgttatccagggctgagctgcaggcag--ggcca	Protospacer
. . ************.**** ******  ***  

50. spacer 3.7|1056237|33|NZ_CP041031|PILER-CR matches to NC_011754 (Escherichia coli ED1a plasmid pECOED, complete sequence) position: , mismatch: 8, identity: 0.758

gaaatatccagggctgggctggaggcagacggc--	CRISPR spacer
acgttatccagggctgagctgcaggcag--ggcca	Protospacer
. . ************.**** ******  ***  

51. spacer 3.7|1056237|33|NZ_CP041031|PILER-CR matches to NZ_CP015141 (Escherichia coli strain Ecol_732 plasmid pEC732_3, complete sequence) position: , mismatch: 8, identity: 0.758

gaaatatccagggctgggctggaggcagacggc--	CRISPR spacer
acgttatccagggctgagctgcaggcag--ggcca	Protospacer
. . ************.**** ******  ***  

52. spacer 3.7|1056237|33|NZ_CP041031|PILER-CR matches to NZ_LR213460 (Shigella sonnei strain AUSMDU00008333 isolate AUSMDU00008333 plasmid 3) position: , mismatch: 8, identity: 0.758

gaaatatccagggctgggctggaggcagacggc--	CRISPR spacer
acgttatccagggctgagctgcaggcag--ggcca	Protospacer
. . ************.**** ******  ***  

53. spacer 3.7|1056237|33|NZ_CP041031|PILER-CR matches to NZ_MH287044 (Escherichia coli strain 5.1-R1 plasmid pCERC6, complete sequence) position: , mismatch: 8, identity: 0.758

gaaatatccagggctgggctggaggcagacggc--	CRISPR spacer
acgttatccagggctgagctgcaggcag--ggcca	Protospacer
. . ************.**** ******  ***  

54. spacer 3.7|1056237|33|NZ_CP041031|PILER-CR matches to NZ_MH618673 (Escherichia coli strain 838B plasmid p838B-R, complete sequence) position: , mismatch: 8, identity: 0.758

gaaatatccagggctgggctggaggcagacggc--	CRISPR spacer
acgttatccagggctgagctgcaggcag--ggcca	Protospacer
. . ************.**** ******  ***  

55. spacer 3.7|1056237|33|NZ_CP041031|PILER-CR matches to NZ_CP005999 (Escherichia coli B7A plasmid pEB1, complete sequence) position: , mismatch: 8, identity: 0.758

gaaatatccagggctgggctggaggcagacggc--	CRISPR spacer
acgttatccagggctgagctgcaggcag--ggcca	Protospacer
. . ************.**** ******  ***  

56. spacer 3.7|1056237|33|NZ_CP041031|PILER-CR matches to KU932021 (Escherichia coli plasmid pEC3I, complete sequence) position: , mismatch: 8, identity: 0.758

gaaatatccagggctgggctggaggcagacggc--	CRISPR spacer
acgttatccagggctgagctgcaggcag--ggcca	Protospacer
. . ************.**** ******  ***  

57. spacer 3.14|1056177|32|NZ_CP041031|CRISPRCasFinder,CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tcaacgcgctcagacgttgcgtgagtgaacca	CRISPR spacer
acaacgcggtcggacgttgcgtgattaccccg	Protospacer
 ******* **.************ *.  **.

58. spacer 4.4|1078956|31|NZ_CP041031|CRISPRCasFinder matches to NZ_CP017753 (Cupriavidus sp. USMAHM13 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

cccgtcaccgacgcgcagtggcgctaccgtg	CRISPR spacer
gacgtcaccgacgcgcagtcgcgcttcttca	Protospacer
  ***************** ***** *. ..

59. spacer 4.7|1079139|31|NZ_CP041031|CRISPRCasFinder matches to NZ_CP036297 (Planctomycetes bacterium Pla86 plasmid pPla86_1, complete sequence) position: , mismatch: 8, identity: 0.742

ccgaacggctggcgaagcaggtggctggcgt	CRISPR spacer
agcggcagctggcgatgcaggtggcttgcgt	Protospacer
   ..*.******** ********** ****

60. spacer 4.7|1079139|31|NZ_CP041031|CRISPRCasFinder matches to NZ_CP036288 (Planctomycetes bacterium Pla133 plasmid pPla133_1, complete sequence) position: , mismatch: 8, identity: 0.742

ccgaacggctggcgaagcaggtggctggcgt	CRISPR spacer
agcggcagctggcgatgcaggtggcttgcgt	Protospacer
   ..*.******** ********** ****

61. spacer 4.7|1079139|31|NZ_CP041031|CRISPRCasFinder matches to NZ_CP015882 (Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence) position: , mismatch: 8, identity: 0.742

ccgaacggctggcgaagcaggtggctggcgt	CRISPR spacer
ttgcgcagctggcgcagcaggtggctgccga	Protospacer
..* .*.******* ************ ** 

62. spacer 4.7|1079139|31|NZ_CP041031|CRISPRCasFinder matches to NZ_CP017750 (Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

ccgaacggctggcgaagcaggtggctggcgt	CRISPR spacer
gggtacggctggcgaaggaggcggctgcgga	Protospacer
  * ************* ***.*****  * 

63. spacer 4.10|1078772|33|NZ_CP041031|PILER-CR matches to NC_007336 (Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.758

gttgcccgcgcaattccgggagcatccgcaatt	CRISPR spacer
gtccctatcgcaatgccggcagcatccgcaatc	Protospacer
**. *.  ****** **** ************.

64. spacer 4.16|1079138|33|NZ_CP041031|PILER-CR matches to NC_007336 (Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.758

gccgaacggctggcgaagcaggtggctggcgta	CRISPR spacer
gccgaacaggtggcgaagcaggtgatgggccag	Protospacer
*******.* **************.. ***  .

65. spacer 4.19|1078773|32|NZ_CP041031|CRT matches to NC_007336 (Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75

ttgcccgcgcaattccgggagcatccgcaatt	CRISPR spacer
tccctatcgcaatgccggcagcatccgcaatc	Protospacer
*. *.  ****** **** ************.

66. spacer 4.19|1078773|32|NZ_CP041031|CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75

ttgcccgcgcaattccgggagcatccgcaatt	CRISPR spacer
ttgcgcgcgcaattccgtgagcagcgccatca	Protospacer
**** ************ ***** *  ** . 

67. spacer 4.19|1078773|32|NZ_CP041031|CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

ttgcccgcgcaattccgggagcatccgcaatt	CRISPR spacer
ttgcgcgcgcaattccgtgagcagcgccatca	Protospacer
**** ************ ***** *  ** . 

68. spacer 4.19|1078773|32|NZ_CP041031|CRT matches to NC_008759 (Polaromonas naphthalenivorans CJ2 plasmid pPNAP03, complete sequence) position: , mismatch: 8, identity: 0.75

ttgcccgcg-----caattccgggagcatccgcaatt	CRISPR spacer
-----cgtgaaactcatttccgggagcatccgcattt	Protospacer
     **.*     ** ***************** **

69. spacer 4.22|1078956|32|NZ_CP041031|CRT matches to NZ_CP034185 (Deinococcus sp. S14-83 strain S14-83T plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

cccgtcaccgacgcgcagtggcgctaccgtga	CRISPR spacer
agcgtcaccgacgcgcagggccgctaccaact	Protospacer
  **************** * *******.   

70. spacer 4.22|1078956|32|NZ_CP041031|CRT matches to NZ_CP017753 (Cupriavidus sp. USMAHM13 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

cccgtcaccgacgcgcagtggcgctaccgtga	CRISPR spacer
gacgtcaccgacgcgcagtcgcgcttcttcaa	Protospacer
  ***************** ***** *. ..*

71. spacer 4.25|1079139|32|NZ_CP041031|CRT matches to NZ_CP017750 (Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

ccgaacggctggcgaagcaggtggctggcgta	CRISPR spacer
gggtacggctggcgaaggaggcggctgcggaa	Protospacer
  * ************* ***.*****  * *

72. spacer 4.25|1079139|32|NZ_CP041031|CRT matches to NC_007336 (Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75

ccgaacggctggcgaagcaggtggctggcgta	CRISPR spacer
ccgaacaggtggcgaagcaggtgatgggccag	Protospacer
******.* **************.. ***  .

73. spacer 4.26|1079200|32|NZ_CP041031|CRT matches to NZ_CP006991 (Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence) position: , mismatch: 8, identity: 0.75

gtttaccgccccgcagaggcgctggcagatcc	CRISPR spacer
catcatcctcccgcagatgcgctggccgatcc	Protospacer
  *.*.* .******** ******** *****

74. spacer 4.28|1079322|32|NZ_CP041031|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.75

ggcgcactggatgcgatgatggata---tcactta	CRISPR spacer
ggcgcactggaagcggtgatggaggggcgcac---	Protospacer
*********** ***.******* .    ***   

75. spacer 1.1|639307|42|NZ_CP041031|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 9, identity: 0.786

acagcagtcggatgcggcgtaaacaccttatctgacctacgt	CRISPR spacer
gttgatgtcggatgcggcgtaaacgccttatccgacctacaa	Protospacer
.. *  ******************.*******.*******. 

76. spacer 4.1|1078773|31|NZ_CP041031|CRISPRCasFinder matches to NC_011987 (Agrobacterium radiobacter K84 plasmid pAtK84c, complete sequence) position: , mismatch: 9, identity: 0.71

ttgcccgcgcaattccgggagcatccgcaat	CRISPR spacer
gctaccgcgcaattcgaggagcatccgctgg	Protospacer
 .  *********** .*********** . 

77. spacer 4.2|1078834|31|NZ_CP041031|CRISPRCasFinder matches to CP011075 (Brevibacillus laterosporus strain B9 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71

acggacaaaatatatattgatttgcgaatta	CRISPR spacer
tgaggcaaaatatagattgatttccgaaaat	Protospacer
  .*.********* ******** ****   

78. spacer 4.2|1078834|31|NZ_CP041031|CRISPRCasFinder matches to GU075905 (Prochlorococcus phage P-HM2, complete genome) position: , mismatch: 9, identity: 0.71

acggacaaaatatatattgatttgcgaatta	CRISPR spacer
acggaaaaattatatattgattttacttctg	Protospacer
***** *** *************     .*.

79. spacer 4.4|1078956|31|NZ_CP041031|CRISPRCasFinder matches to NZ_CP017750 (Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71

cccgtcaccgacgcgcagtggcgctaccgtg	CRISPR spacer
gacgtcactgacgcgcagtcgcgcttcttca	Protospacer
  ******.********** ***** *. ..

80. spacer 4.4|1078956|31|NZ_CP041031|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.71

cccgtcaccgacgcgcagtggcgctaccgtg	CRISPR spacer
gacatcaccgacgcccagtggcgcgacgtcc	Protospacer
  *.********** ********* **  . 

81. spacer 4.8|1079200|31|NZ_CP041031|CRISPRCasFinder matches to NZ_CP040723 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.71

gtttaccgccccgcagaggcgctggcagatc	CRISPR spacer
cgagaccgcctcgccgaggcgctggcagcga	Protospacer
    ******.*** *************   

82. spacer 4.10|1078772|33|NZ_CP041031|PILER-CR matches to NC_011987 (Agrobacterium radiobacter K84 plasmid pAtK84c, complete sequence) position: , mismatch: 9, identity: 0.727

-gttgcccgcgcaattccgggagcatccgcaatt	CRISPR spacer
cgcta-ccgcgcaattcgaggagcatccgctggg	Protospacer
 *.*. *********** .*********** .  

83. spacer 4.13|1078955|33|NZ_CP041031|PILER-CR matches to NZ_CP034185 (Deinococcus sp. S14-83 strain S14-83T plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727

gcccgtcaccgacgcgcagtggcgctaccgtga	CRISPR spacer
cagcgtcaccgacgcgcagggccgctaccaact	Protospacer
   **************** * *******.   

84. spacer 4.22|1078956|32|NZ_CP041031|CRT matches to NZ_CP017750 (Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

cccgtcaccgacgcgcagtggcgctaccgtga	CRISPR spacer
gacgtcactgacgcgcagtcgcgcttcttcaa	Protospacer
  ******.********** ***** *. ..*

85. spacer 4.25|1079139|32|NZ_CP041031|CRT matches to NZ_CP036297 (Planctomycetes bacterium Pla86 plasmid pPla86_1, complete sequence) position: , mismatch: 9, identity: 0.719

ccgaacggctggcgaagcaggtggctggcgta	CRISPR spacer
agcggcagctggcgatgcaggtggcttgcgtg	Protospacer
   ..*.******** ********** ****.

86. spacer 4.25|1079139|32|NZ_CP041031|CRT matches to NZ_CP036288 (Planctomycetes bacterium Pla133 plasmid pPla133_1, complete sequence) position: , mismatch: 9, identity: 0.719

ccgaacggctggcgaagcaggtggctggcgta	CRISPR spacer
agcggcagctggcgatgcaggtggcttgcgtg	Protospacer
   ..*.******** ********** ****.

87. spacer 4.25|1079139|32|NZ_CP041031|CRT matches to NZ_CP015882 (Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence) position: , mismatch: 9, identity: 0.719

ccgaacggctggcgaagcaggtggctggcgta	CRISPR spacer
ttgcgcagctggcgcagcaggtggctgccgag	Protospacer
..* .*.******* ************ ** .

88. spacer 4.26|1079200|32|NZ_CP041031|CRT matches to NZ_CP040723 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719

gtttaccgccccgcagaggcgctggcagatcc	CRISPR spacer
cgagaccgcctcgccgaggcgctggcagcgac	Protospacer
    ******.*** *************   *

89. spacer 4.28|1079322|32|NZ_CP041031|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 9, identity: 0.719

ggcgcactggatgcgatgatggatatcactta	CRISPR spacer
ggcgcactggaaccgatgatggatgcgatgag	Protospacer
***********  ***********.. *.  .

90. spacer 3.9|1055872|32|NZ_CP041031|CRISPRCasFinder,CRT matches to NZ_CP030933 (Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence) position: , mismatch: 10, identity: 0.688

tccacgctgtaacggccatcattaagtttagt	CRISPR spacer
ccgctgctgtgacgcccatcattaagttactc	Protospacer
.*  .*****.*** *************   .

91. spacer 4.11|1078833|33|NZ_CP041031|PILER-CR matches to GU075905 (Prochlorococcus phage P-HM2, complete genome) position: , mismatch: 10, identity: 0.697

gacggacaaaatatatattgatttgcgaattat	CRISPR spacer
gacggaaaaattatatattgattttacttctgg	Protospacer
****** *** *************     .*. 

92. spacer 4.16|1079138|33|NZ_CP041031|PILER-CR matches to NZ_CP036297 (Planctomycetes bacterium Pla86 plasmid pPla86_1, complete sequence) position: , mismatch: 10, identity: 0.697

gccgaacggctggcgaagcaggtggctggcgta	CRISPR spacer
cagcggcagctggcgatgcaggtggcttgcgtg	Protospacer
    ..*.******** ********** ****.

93. spacer 4.16|1079138|33|NZ_CP041031|PILER-CR matches to NZ_CP036288 (Planctomycetes bacterium Pla133 plasmid pPla133_1, complete sequence) position: , mismatch: 10, identity: 0.697

gccgaacggctggcgaagcaggtggctggcgta	CRISPR spacer
cagcggcagctggcgatgcaggtggcttgcgtg	Protospacer
    ..*.******** ********** ****.

94. spacer 4.17|1079199|33|NZ_CP041031|PILER-CR matches to NZ_CP040723 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed4, complete sequence) position: , mismatch: 10, identity: 0.697

ggtttaccgccccgcagaggcgctggcagatcc	CRISPR spacer
ccgagaccgcctcgccgaggcgctggcagcgac	Protospacer
     ******.*** *************   *

95. spacer 4.19|1078773|32|NZ_CP041031|CRT matches to NC_011987 (Agrobacterium radiobacter K84 plasmid pAtK84c, complete sequence) position: , mismatch: 10, identity: 0.688

ttgcccgcgcaattccgggagcatccgcaatt	CRISPR spacer
gctaccgcgcaattcgaggagcatccgctggg	Protospacer
 .  *********** .*********** .  

96. spacer 4.20|1078834|32|NZ_CP041031|CRT matches to CP011075 (Brevibacillus laterosporus strain B9 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

acggacaaaatatatattgatttgcgaattat	CRISPR spacer
tgaggcaaaatatagattgatttccgaaaata	Protospacer
  .*.********* ******** ****    

97. spacer 4.20|1078834|32|NZ_CP041031|CRT matches to GU075905 (Prochlorococcus phage P-HM2, complete genome) position: , mismatch: 10, identity: 0.688

acggacaaaatatatattgatttgcgaattat	CRISPR spacer
acggaaaaattatatattgattttacttctgg	Protospacer
***** *** *************     .*. 

98. spacer 4.22|1078956|32|NZ_CP041031|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 10, identity: 0.688

cccgtcaccgacgcgcagtggcgctaccgtga	CRISPR spacer
gacatcaccgacgcccagtggcgcgacgtccc	Protospacer
  *.********** ********* **  .  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 274438 : 296160 17 Bacillus_phage(28.57%) transposase,integrase attL 262891:262905|attR 286917:286931
DBSCAN-SWA_2 1086746 : 1099929 12 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_3 1710287 : 1719729 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_4 1845890 : 1865388 23 Enterobacteria_phage(53.33%) transposase,lysis,integrase,holin attL 1844352:1844365|attR 1855932:1855945
DBSCAN-SWA_5 2348467 : 2380642 39 Enterobacteria_phage(37.5%) tail,integrase,lysis attL 2343757:2343773|attR 2374273:2374289
DBSCAN-SWA_6 2782647 : 2793425 11 Enterobacteria_phage(40.0%) integrase attL 2780620:2780643|attR 2792128:2792151
DBSCAN-SWA_7 3107801 : 3116571 12 Salmonella_phage(90.0%) integrase attL 3107471:3107484|attR 3116613:3116626
DBSCAN-SWA_8 3197415 : 3206593 13 Enterobacteria_phage(50.0%) tail,lysis NA
DBSCAN-SWA_9 3209791 : 3227356 31 Enterobacteria_phage(44.0%) transposase,integrase attL 3201723:3201737|attR 3234108:3234122
DBSCAN-SWA_10 3712393 : 3734630 20 Shigella_phage(50.0%) tail,integrase attL 3711951:3712010|attR 3730715:3730774
DBSCAN-SWA_11 3972086 : 4078349 104 Enterobacteria_phage(42.19%) tRNA,lysis,capsid,integrase,head,tail,portal,terminase attL 4066563:4066577|attR 4079527:4079541
DBSCAN-SWA_12 4167261 : 4173820 7 uncultured_Caudovirales_phage(16.67%) transposase NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_CP041031.1|WP_001678640.1|2790047_2790266_+|TraR/DksA-family-transcriptional-regulator 2790047_2790266_+ 72 aa aa NA NA NA 2782647-2793425 yes
2. NZ_CP041032
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 10495 : 60650 48 Escherichia_phage(38.89%) integrase,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage