Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP046801 Vibrio cincinnatiensis strain 2070-81 chromosome 2, complete sequence 8 crisprs DEDDh,cas2,cas1,cas4,cas7,cas8c,cas5,cas3,RT 0 25 2 0
NZ_CP046802 Vibrio cincinnatiensis strain 2070-81 chromosome 1, complete sequence 2 crisprs DEDDh,csa3,RT,cas3,DinG,cas4,cas1,cas3-cas2,cas8f,cas5f,cas7f,cas6f,csx1 1 10 211 1

Results visualization

1. NZ_CP046801
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP046801_1 368977-369122 Unclear NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP046801_2 387451-388205 TypeI I-C
11 spacers
cas2,cas1,cas4,cas7,cas8c,cas5,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP046801_3 469381-470009 Orphan I-F
10 spacers
RT

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP046801_4 481124-481511 Orphan I-F
6 spacers
RT

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP046801_5 550316-550883 Orphan I-F
9 spacers
RT

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP046801_6 554460-554607 Orphan I-F
2 spacers
RT

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP046801_7 562790-563357 Orphan I-F
9 spacers
RT

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP046801_8 566934-567081 Orphan I-F
2 spacers
RT

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP046801_5 5.1|550344|32|NZ_CP046801|CRISPRCasFinder,CRT 550344-550375 32 NC_021918 Cycloclasticus zancles 78-ME plasmid p7ME01, complete sequence 6343-6374 0 1.0
NZ_CP046801_7 7.1|562818|32|NZ_CP046801|CRISPRCasFinder,CRT 562818-562849 32 NC_021918 Cycloclasticus zancles 78-ME plasmid p7ME01, complete sequence 6343-6374 0 1.0
NZ_CP046801_5 5.1|550344|32|NZ_CP046801|CRISPRCasFinder,CRT 550344-550375 32 NC_017858 Methylophaga frappieri strain JAM7 plasmid, complete sequence 8271-8302 1 0.969
NZ_CP046801_7 7.1|562818|32|NZ_CP046801|CRISPRCasFinder,CRT 562818-562849 32 NC_017858 Methylophaga frappieri strain JAM7 plasmid, complete sequence 8271-8302 1 0.969
NZ_CP046801_6 6.2|554548|32|NZ_CP046801|PILER-CR,CRISPRCasFinder 554548-554579 32 MG592545 Vibrio phage 1.178.O._10N.286.45.E12, partial genome 30064-30095 3 0.906
NZ_CP046801_8 8.2|567022|32|NZ_CP046801|PILER-CR,CRISPRCasFinder 567022-567053 32 MG592545 Vibrio phage 1.178.O._10N.286.45.E12, partial genome 30064-30095 3 0.906
NZ_CP046801_5 5.1|550344|32|NZ_CP046801|CRISPRCasFinder,CRT 550344-550375 32 AM261282 Uncultured bacterium IncP-1 plasmid pKJK5 complete sequence 5727-5758 4 0.875
NZ_CP046801_5 5.1|550344|32|NZ_CP046801|CRISPRCasFinder,CRT 550344-550375 32 NZ_CP028340 Thauera aromatica K172 plasmid pKJK172, complete sequence 4948-4979 4 0.875
NZ_CP046801_5 5.1|550344|32|NZ_CP046801|CRISPRCasFinder,CRT 550344-550375 32 KC964605 Uncultured bacterium plasmid pMLUA1, complete sequence 5726-5757 4 0.875
NZ_CP046801_5 5.1|550344|32|NZ_CP046801|CRISPRCasFinder,CRT 550344-550375 32 KC964606 Uncultured bacterium plasmid pMLUA3, complete sequence 5726-5757 4 0.875
NZ_CP046801_5 5.1|550344|32|NZ_CP046801|CRISPRCasFinder,CRT 550344-550375 32 KC964607 Uncultured bacterium plasmid pMLUA4, complete sequence 5726-5757 4 0.875
NZ_CP046801_5 5.1|550344|32|NZ_CP046801|CRISPRCasFinder,CRT 550344-550375 32 JQ004406 Uncultured bacterium plasmid pHH128, complete sequence 13056-13087 4 0.875
NZ_CP046801_5 5.1|550344|32|NZ_CP046801|CRISPRCasFinder,CRT 550344-550375 32 JQ004407 Uncultured bacterium plasmid pHH3408, complete sequence 13058-13089 4 0.875
NZ_CP046801_5 5.1|550344|32|NZ_CP046801|CRISPRCasFinder,CRT 550344-550375 32 JQ004408 Uncultured bacterium plasmid pHH3414, complete sequence 13058-13089 4 0.875
NZ_CP046801_5 5.1|550344|32|NZ_CP046801|CRISPRCasFinder,CRT 550344-550375 32 JQ004409 Uncultured bacterium plasmid pKS77, complete sequence 12929-12960 4 0.875
NZ_CP046801_5 5.1|550344|32|NZ_CP046801|CRISPRCasFinder,CRT 550344-550375 32 NZ_MN366356 Bacterium plasmid pALTS27, complete sequence 4412-4443 4 0.875
NZ_CP046801_5 5.1|550344|32|NZ_CP046801|CRISPRCasFinder,CRT 550344-550375 32 NZ_MN366360 Bacterium plasmid pALTS32, complete sequence 4412-4443 4 0.875
NZ_CP046801_6 6.2|554548|32|NZ_CP046801|PILER-CR,CRISPRCasFinder 554548-554579 32 MG592600 Vibrio phage 1.236.O._10N.261.52.C4, partial genome 32813-32844 4 0.875
NZ_CP046801_6 6.2|554548|32|NZ_CP046801|PILER-CR,CRISPRCasFinder 554548-554579 32 KX507045 Vibrio phage 2E1, complete genome 18484-18515 4 0.875
NZ_CP046801_7 7.1|562818|32|NZ_CP046801|CRISPRCasFinder,CRT 562818-562849 32 AM261282 Uncultured bacterium IncP-1 plasmid pKJK5 complete sequence 5727-5758 4 0.875
NZ_CP046801_7 7.1|562818|32|NZ_CP046801|CRISPRCasFinder,CRT 562818-562849 32 NZ_CP028340 Thauera aromatica K172 plasmid pKJK172, complete sequence 4948-4979 4 0.875
NZ_CP046801_7 7.1|562818|32|NZ_CP046801|CRISPRCasFinder,CRT 562818-562849 32 KC964605 Uncultured bacterium plasmid pMLUA1, complete sequence 5726-5757 4 0.875
NZ_CP046801_7 7.1|562818|32|NZ_CP046801|CRISPRCasFinder,CRT 562818-562849 32 KC964606 Uncultured bacterium plasmid pMLUA3, complete sequence 5726-5757 4 0.875
NZ_CP046801_7 7.1|562818|32|NZ_CP046801|CRISPRCasFinder,CRT 562818-562849 32 KC964607 Uncultured bacterium plasmid pMLUA4, complete sequence 5726-5757 4 0.875
NZ_CP046801_7 7.1|562818|32|NZ_CP046801|CRISPRCasFinder,CRT 562818-562849 32 JQ004406 Uncultured bacterium plasmid pHH128, complete sequence 13056-13087 4 0.875
NZ_CP046801_7 7.1|562818|32|NZ_CP046801|CRISPRCasFinder,CRT 562818-562849 32 JQ004407 Uncultured bacterium plasmid pHH3408, complete sequence 13058-13089 4 0.875
NZ_CP046801_7 7.1|562818|32|NZ_CP046801|CRISPRCasFinder,CRT 562818-562849 32 JQ004408 Uncultured bacterium plasmid pHH3414, complete sequence 13058-13089 4 0.875
NZ_CP046801_7 7.1|562818|32|NZ_CP046801|CRISPRCasFinder,CRT 562818-562849 32 JQ004409 Uncultured bacterium plasmid pKS77, complete sequence 12929-12960 4 0.875
NZ_CP046801_7 7.1|562818|32|NZ_CP046801|CRISPRCasFinder,CRT 562818-562849 32 NZ_MN366356 Bacterium plasmid pALTS27, complete sequence 4412-4443 4 0.875
NZ_CP046801_7 7.1|562818|32|NZ_CP046801|CRISPRCasFinder,CRT 562818-562849 32 NZ_MN366360 Bacterium plasmid pALTS32, complete sequence 4412-4443 4 0.875
NZ_CP046801_8 8.2|567022|32|NZ_CP046801|PILER-CR,CRISPRCasFinder 567022-567053 32 MG592600 Vibrio phage 1.236.O._10N.261.52.C4, partial genome 32813-32844 4 0.875
NZ_CP046801_8 8.2|567022|32|NZ_CP046801|PILER-CR,CRISPRCasFinder 567022-567053 32 KX507045 Vibrio phage 2E1, complete genome 18484-18515 4 0.875
NZ_CP046801_5 5.1|550344|32|NZ_CP046801|CRISPRCasFinder,CRT 550344-550375 32 JX469827 Uncultured bacterium plasmid pEMT3, complete sequence 4426-4457 5 0.844
NZ_CP046801_5 5.1|550344|32|NZ_CP046801|CRISPRCasFinder,CRT 550344-550375 32 JN106170 Uncultured bacterium plasmid pAKD25, complete sequence 4427-4458 5 0.844
NZ_CP046801_5 5.1|550344|32|NZ_CP046801|CRISPRCasFinder,CRT 550344-550375 32 JN106175 Uncultured bacterium plasmid pAKD34, complete sequence 4426-4457 5 0.844
NZ_CP046801_5 5.1|550344|32|NZ_CP046801|CRISPRCasFinder,CRT 550344-550375 32 JN106167 Uncultured bacterium plasmid pAKD16, complete sequence 4426-4457 5 0.844
NZ_CP046801_5 5.1|550344|32|NZ_CP046801|CRISPRCasFinder,CRT 550344-550375 32 NC_019318 Ralstonia pickettii plasmid p712, complete sequence 58235-58266 5 0.844
NZ_CP046801_6 6.2|554548|32|NZ_CP046801|PILER-CR,CRISPRCasFinder 554548-554579 32 MG592567 Vibrio phage 1.198.A._10N.286.54.F4, partial genome 35521-35552 5 0.844
NZ_CP046801_6 6.2|554548|32|NZ_CP046801|PILER-CR,CRISPRCasFinder 554548-554579 32 MG592568 Vibrio phage 1.198.B._10N.286.54.F4, partial genome 35392-35423 5 0.844
NZ_CP046801_6 6.2|554548|32|NZ_CP046801|PILER-CR,CRISPRCasFinder 554548-554579 32 MG676223 Vibrio phage ValSw3-3, partial genome 28960-28991 5 0.844
NZ_CP046801_6 6.2|554548|32|NZ_CP046801|PILER-CR,CRISPRCasFinder 554548-554579 32 MN855933 Siphoviridae sp. isolate 66, complete genome 4697-4728 5 0.844
NZ_CP046801_7 7.1|562818|32|NZ_CP046801|CRISPRCasFinder,CRT 562818-562849 32 JX469827 Uncultured bacterium plasmid pEMT3, complete sequence 4426-4457 5 0.844
NZ_CP046801_7 7.1|562818|32|NZ_CP046801|CRISPRCasFinder,CRT 562818-562849 32 JN106170 Uncultured bacterium plasmid pAKD25, complete sequence 4427-4458 5 0.844
NZ_CP046801_7 7.1|562818|32|NZ_CP046801|CRISPRCasFinder,CRT 562818-562849 32 JN106175 Uncultured bacterium plasmid pAKD34, complete sequence 4426-4457 5 0.844
NZ_CP046801_7 7.1|562818|32|NZ_CP046801|CRISPRCasFinder,CRT 562818-562849 32 JN106167 Uncultured bacterium plasmid pAKD16, complete sequence 4426-4457 5 0.844
NZ_CP046801_7 7.1|562818|32|NZ_CP046801|CRISPRCasFinder,CRT 562818-562849 32 NC_019318 Ralstonia pickettii plasmid p712, complete sequence 58235-58266 5 0.844
NZ_CP046801_8 8.2|567022|32|NZ_CP046801|PILER-CR,CRISPRCasFinder 567022-567053 32 MG592567 Vibrio phage 1.198.A._10N.286.54.F4, partial genome 35521-35552 5 0.844
NZ_CP046801_8 8.2|567022|32|NZ_CP046801|PILER-CR,CRISPRCasFinder 567022-567053 32 MG592568 Vibrio phage 1.198.B._10N.286.54.F4, partial genome 35392-35423 5 0.844
NZ_CP046801_8 8.2|567022|32|NZ_CP046801|PILER-CR,CRISPRCasFinder 567022-567053 32 MG676223 Vibrio phage ValSw3-3, partial genome 28960-28991 5 0.844
NZ_CP046801_8 8.2|567022|32|NZ_CP046801|PILER-CR,CRISPRCasFinder 567022-567053 32 MN855933 Siphoviridae sp. isolate 66, complete genome 4697-4728 5 0.844
NZ_CP046801_3 3.6|469710|32|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT 469710-469741 32 MT786458 Staphylococcus phage vB_SauH_SAP1, complete genome 57180-57211 6 0.812
NZ_CP046801_3 3.6|469710|32|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT 469710-469741 32 MG557618 Staphylococcus phage HSA30, complete genome 87221-87252 6 0.812
NZ_CP046801_3 3.6|469710|32|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT 469710-469741 32 KY779849 Staphylococcus phage qdsa002, complete genome 132391-132422 6 0.812
NZ_CP046801_3 3.6|469710|32|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT 469710-469741 32 MF001365 Staphylococcus phage SA3, partial genome 104162-104193 6 0.812
NZ_CP046801_3 3.6|469710|32|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT 469710-469741 32 MH159197 Staphylococcus phage VB_SavM_JYL01, complete genome 102387-102418 6 0.812
NZ_CP046801_3 3.6|469710|32|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT 469710-469741 32 MN304941 Staphylococcus phage vB_SauH_IME522, complete genome 50291-50322 6 0.812
NZ_CP046801_3 3.6|469710|32|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT 469710-469741 32 MK250904 Staphylococcus phage VB-SavM-JYL02, complete genome 100959-100990 6 0.812
NZ_CP046801_3 3.6|469710|32|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT 469710-469741 32 KM216423 Staphylococcus phage P108, complete genome 67494-67525 6 0.812
NZ_CP046801_3 3.6|469710|32|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT 469710-469741 32 NC_019448 Staphylococcus phage GH15, complete genome 129039-129070 6 0.812
NZ_CP046801_6 6.2|554548|32|NZ_CP046801|PILER-CR,CRISPRCasFinder 554548-554579 32 MN856087 Bacteriophage sp. isolate 245, complete genome 299-330 6 0.812
NZ_CP046801_8 8.2|567022|32|NZ_CP046801|PILER-CR,CRISPRCasFinder 567022-567053 32 MN856087 Bacteriophage sp. isolate 245, complete genome 299-330 6 0.812
NZ_CP046801_3 3.9|469890|32|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT 469890-469921 32 NZ_CP026025 Klebsiella pneumoniae strain 11420 plasmid p11420-KPC, complete sequence 17969-18000 7 0.781
NZ_CP046801_4 4.2|481212|32|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT 481212-481243 32 NZ_CP045304 Legionella longbeachae strain B1445CHC plasmid pB1445CHC_73K, complete sequence 42919-42950 7 0.781
NZ_CP046801_5 5.5|550584|32|NZ_CP046801|CRISPRCasFinder,CRT,PILER-CR 550584-550615 32 NZ_CP025846 Escherichia coli strain 720632 plasmid p720632_86, complete sequence 51615-51646 7 0.781
NZ_CP046801_5 5.7|550704|32|NZ_CP046801|CRISPRCasFinder,CRT,PILER-CR 550704-550735 32 NC_011246 Borrelia recurrentis A1 plasmid pl124, complete sequence 44871-44902 7 0.781
NZ_CP046801_5 5.7|550704|32|NZ_CP046801|CRISPRCasFinder,CRT,PILER-CR 550704-550735 32 NC_011247 Borrelia duttonii Ly plasmid pl165, complete sequence 83061-83092 7 0.781
NZ_CP046801_6 6.1|554488|32|NZ_CP046801|PILER-CR,CRISPRCasFinder 554488-554519 32 NZ_CP034238 Aliivibrio salmonicida strain VS224 plasmid pRVS1-224, complete sequence 204767-204798 7 0.781
NZ_CP046801_6 6.1|554488|32|NZ_CP046801|PILER-CR,CRISPRCasFinder 554488-554519 32 MN655998 Escherichia phage E26, complete genome 70311-70342 7 0.781
NZ_CP046801_6 6.1|554488|32|NZ_CP046801|PILER-CR,CRISPRCasFinder 554488-554519 32 MK573636 Escherichia phage vB_EcoM_PHB13, partial genome 164214-164245 7 0.781
NZ_CP046801_6 6.1|554488|32|NZ_CP046801|PILER-CR,CRISPRCasFinder 554488-554519 32 MT764208 Escherichia phage JEP8, complete genome 150980-151011 7 0.781
NZ_CP046801_6 6.1|554488|32|NZ_CP046801|PILER-CR,CRISPRCasFinder 554488-554519 32 MT478991 Escherichia phage vB_EcoM_011D4, complete genome 22355-22386 7 0.781
NZ_CP046801_6 6.1|554488|32|NZ_CP046801|PILER-CR,CRISPRCasFinder 554488-554519 32 MK327941 Escherichia phage vB_EcoM_G37-3, complete genome 72321-72352 7 0.781
NZ_CP046801_6 6.1|554488|32|NZ_CP046801|PILER-CR,CRISPRCasFinder 554488-554519 32 NC_009821 Enterobacteria phage Phi1, complete genome 70912-70943 7 0.781
NZ_CP046801_6 6.1|554488|32|NZ_CP046801|PILER-CR,CRISPRCasFinder 554488-554519 32 MF327006 Shigella phage Sf20, complete genome 6964-6995 7 0.781
NZ_CP046801_6 6.1|554488|32|NZ_CP046801|PILER-CR,CRISPRCasFinder 554488-554519 32 NC_025425 Enterobacteria phage GEC-3S complete genome 71357-71388 7 0.781
NZ_CP046801_6 6.1|554488|32|NZ_CP046801|PILER-CR,CRISPRCasFinder 554488-554519 32 MN709127 Escherichia virus Ec_Makalu_002, complete genome 70847-70878 7 0.781
NZ_CP046801_6 6.1|554488|32|NZ_CP046801|PILER-CR,CRISPRCasFinder 554488-554519 32 MK327947 Escherichia phage vB_EcoM_G5211, complete genome 71915-71946 7 0.781
NZ_CP046801_6 6.1|554488|32|NZ_CP046801|PILER-CR,CRISPRCasFinder 554488-554519 32 NC_041936 Escherichia phage ECD7, complete genome 72558-72589 7 0.781
NZ_CP046801_6 6.1|554488|32|NZ_CP046801|PILER-CR,CRISPRCasFinder 554488-554519 32 MK327935 Escherichia phage vB_EcoM_G2494, complete genome 71266-71297 7 0.781
NZ_CP046801_6 6.1|554488|32|NZ_CP046801|PILER-CR,CRISPRCasFinder 554488-554519 32 MK962753 Shigella phage JK32, complete genome 75266-75297 7 0.781
NZ_CP046801_6 6.1|554488|32|NZ_CP046801|PILER-CR,CRISPRCasFinder 554488-554519 32 NC_012740 Enterobacteria phage JSE, complete genome 74064-74095 7 0.781
NZ_CP046801_6 6.1|554488|32|NZ_CP046801|PILER-CR,CRISPRCasFinder 554488-554519 32 MN850574 Escherichia phage kaaroe, complete genome 36775-36806 7 0.781
NZ_CP046801_6 6.1|554488|32|NZ_CP046801|PILER-CR,CRISPRCasFinder 554488-554519 32 MN850615 Escherichia phage kvi, complete genome 7285-7316 7 0.781
NZ_CP046801_6 6.1|554488|32|NZ_CP046801|PILER-CR,CRISPRCasFinder 554488-554519 32 MN894885 Escherichia virus Ec_Makalu_001, complete genome 69726-69757 7 0.781
NZ_CP046801_7 7.5|563058|32|NZ_CP046801|CRISPRCasFinder,CRT,PILER-CR 563058-563089 32 NZ_CP025846 Escherichia coli strain 720632 plasmid p720632_86, complete sequence 51615-51646 7 0.781
NZ_CP046801_7 7.7|563178|32|NZ_CP046801|CRISPRCasFinder,CRT,PILER-CR 563178-563209 32 NC_011246 Borrelia recurrentis A1 plasmid pl124, complete sequence 44871-44902 7 0.781
NZ_CP046801_7 7.7|563178|32|NZ_CP046801|CRISPRCasFinder,CRT,PILER-CR 563178-563209 32 NC_011247 Borrelia duttonii Ly plasmid pl165, complete sequence 83061-83092 7 0.781
NZ_CP046801_8 8.1|566962|32|NZ_CP046801|PILER-CR,CRISPRCasFinder 566962-566993 32 NZ_CP034238 Aliivibrio salmonicida strain VS224 plasmid pRVS1-224, complete sequence 204767-204798 7 0.781
NZ_CP046801_8 8.1|566962|32|NZ_CP046801|PILER-CR,CRISPRCasFinder 566962-566993 32 MN655998 Escherichia phage E26, complete genome 70311-70342 7 0.781
NZ_CP046801_8 8.1|566962|32|NZ_CP046801|PILER-CR,CRISPRCasFinder 566962-566993 32 MK573636 Escherichia phage vB_EcoM_PHB13, partial genome 164214-164245 7 0.781
NZ_CP046801_8 8.1|566962|32|NZ_CP046801|PILER-CR,CRISPRCasFinder 566962-566993 32 MT764208 Escherichia phage JEP8, complete genome 150980-151011 7 0.781
NZ_CP046801_8 8.1|566962|32|NZ_CP046801|PILER-CR,CRISPRCasFinder 566962-566993 32 MT478991 Escherichia phage vB_EcoM_011D4, complete genome 22355-22386 7 0.781
NZ_CP046801_8 8.1|566962|32|NZ_CP046801|PILER-CR,CRISPRCasFinder 566962-566993 32 MK327941 Escherichia phage vB_EcoM_G37-3, complete genome 72321-72352 7 0.781
NZ_CP046801_8 8.1|566962|32|NZ_CP046801|PILER-CR,CRISPRCasFinder 566962-566993 32 NC_009821 Enterobacteria phage Phi1, complete genome 70912-70943 7 0.781
NZ_CP046801_8 8.1|566962|32|NZ_CP046801|PILER-CR,CRISPRCasFinder 566962-566993 32 MF327006 Shigella phage Sf20, complete genome 6964-6995 7 0.781
NZ_CP046801_8 8.1|566962|32|NZ_CP046801|PILER-CR,CRISPRCasFinder 566962-566993 32 NC_025425 Enterobacteria phage GEC-3S complete genome 71357-71388 7 0.781
NZ_CP046801_8 8.1|566962|32|NZ_CP046801|PILER-CR,CRISPRCasFinder 566962-566993 32 MN709127 Escherichia virus Ec_Makalu_002, complete genome 70847-70878 7 0.781
NZ_CP046801_8 8.1|566962|32|NZ_CP046801|PILER-CR,CRISPRCasFinder 566962-566993 32 MK327947 Escherichia phage vB_EcoM_G5211, complete genome 71915-71946 7 0.781
NZ_CP046801_8 8.1|566962|32|NZ_CP046801|PILER-CR,CRISPRCasFinder 566962-566993 32 NC_041936 Escherichia phage ECD7, complete genome 72558-72589 7 0.781
NZ_CP046801_8 8.1|566962|32|NZ_CP046801|PILER-CR,CRISPRCasFinder 566962-566993 32 MK327935 Escherichia phage vB_EcoM_G2494, complete genome 71266-71297 7 0.781
NZ_CP046801_8 8.1|566962|32|NZ_CP046801|PILER-CR,CRISPRCasFinder 566962-566993 32 MK962753 Shigella phage JK32, complete genome 75266-75297 7 0.781
NZ_CP046801_8 8.1|566962|32|NZ_CP046801|PILER-CR,CRISPRCasFinder 566962-566993 32 NC_012740 Enterobacteria phage JSE, complete genome 74064-74095 7 0.781
NZ_CP046801_8 8.1|566962|32|NZ_CP046801|PILER-CR,CRISPRCasFinder 566962-566993 32 MN850574 Escherichia phage kaaroe, complete genome 36775-36806 7 0.781
NZ_CP046801_8 8.1|566962|32|NZ_CP046801|PILER-CR,CRISPRCasFinder 566962-566993 32 MN850615 Escherichia phage kvi, complete genome 7285-7316 7 0.781
NZ_CP046801_8 8.1|566962|32|NZ_CP046801|PILER-CR,CRISPRCasFinder 566962-566993 32 MN894885 Escherichia virus Ec_Makalu_001, complete genome 69726-69757 7 0.781
NZ_CP046801_2 2.5|387746|33|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT 387746-387778 33 MK075005 Staphylococcus phage phiSP119-2, partial genome 22749-22781 8 0.758
NZ_CP046801_3 3.3|469530|32|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT 469530-469561 32 NZ_CP053905 Hymenobacter sp. BRD67 plasmid unnamed1, complete sequence 8552-8583 8 0.75
NZ_CP046801_3 3.3|469530|32|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT 469530-469561 32 MF417892 Uncultured Caudovirales phage clone 2F_2, partial genome 12693-12724 8 0.75
NZ_CP046801_3 3.9|469890|32|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT 469890-469921 32 MT075871 Klebsiella phage vB_KleS-HSE3, complete genome 10267-10298 8 0.75
NZ_CP046801_5 5.3|550464|32|NZ_CP046801|CRISPRCasFinder,CRT,PILER-CR 550464-550495 32 NZ_CP050104 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence 608345-608376 8 0.75
NZ_CP046801_5 5.3|550464|32|NZ_CP046801|CRISPRCasFinder,CRT,PILER-CR 550464-550495 32 NZ_CP025507 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence 308956-308987 8 0.75
NZ_CP046801_5 5.3|550464|32|NZ_CP046801|CRISPRCasFinder,CRT,PILER-CR 550464-550495 32 NZ_CP050109 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence 608345-608376 8 0.75
NZ_CP046801_5 5.7|550704|32|NZ_CP046801|CRISPRCasFinder,CRT,PILER-CR 550704-550735 32 AP014349 Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S38-C79, *** SEQUENCING IN PROGRESS *** 7682-7713 8 0.75
NZ_CP046801_6 6.1|554488|32|NZ_CP046801|PILER-CR,CRISPRCasFinder 554488-554519 32 NZ_CP015507 Bacillus oceanisediminis 2691 plasmid pBO1, complete sequence 243497-243528 8 0.75
NZ_CP046801_7 7.3|562938|32|NZ_CP046801|CRISPRCasFinder,CRT,PILER-CR 562938-562969 32 NZ_CP050104 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence 608345-608376 8 0.75
NZ_CP046801_7 7.3|562938|32|NZ_CP046801|CRISPRCasFinder,CRT,PILER-CR 562938-562969 32 NZ_CP025507 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence 308956-308987 8 0.75
NZ_CP046801_7 7.3|562938|32|NZ_CP046801|CRISPRCasFinder,CRT,PILER-CR 562938-562969 32 NZ_CP050109 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence 608345-608376 8 0.75
NZ_CP046801_7 7.7|563178|32|NZ_CP046801|CRISPRCasFinder,CRT,PILER-CR 563178-563209 32 AP014349 Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S38-C79, *** SEQUENCING IN PROGRESS *** 7682-7713 8 0.75
NZ_CP046801_8 8.1|566962|32|NZ_CP046801|PILER-CR,CRISPRCasFinder 566962-566993 32 NZ_CP015507 Bacillus oceanisediminis 2691 plasmid pBO1, complete sequence 243497-243528 8 0.75
NZ_CP046801_2 2.4|387680|34|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT 387680-387713 34 HQ316603 Cyanophage S-SSM6b genomic sequence 16832-16865 9 0.735
NZ_CP046801_2 2.4|387680|34|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT 387680-387713 34 NC_020875 Cyanophage S-SSM4 genomic sequence 65397-65430 9 0.735
NZ_CP046801_3 3.1|469409|32|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT 469409-469440 32 NZ_CP014886 Lactobacillus backii strain TMW 1.1991 plasmid pL11991-5, complete sequence 31248-31279 9 0.719
NZ_CP046801_3 3.4|469590|32|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT 469590-469621 32 CP019195 Salmonella enterica subsp. enterica serovar Senftenberg str. ATCC 43845 plasmid pATCC43845, complete sequence 15480-15511 9 0.719
NZ_CP046801_3 3.4|469590|32|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT 469590-469621 32 NZ_CP010179 Escherichia coli strain H15 plasmid A, complete genome 66977-67008 9 0.719
NZ_CP046801_3 3.4|469590|32|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT 469590-469621 32 NZ_CP014124 Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed2 25887-25918 9 0.719
NZ_CP046801_3 3.4|469590|32|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT 469590-469621 32 NZ_CP031581 Klebsiella pneumoniae strain N4b plasmid pIncFIA-1502320, complete sequence 29890-29921 9 0.719
NZ_CP046801_3 3.4|469590|32|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT 469590-469621 32 NZ_AP019691 Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-4, complete sequence 77354-77385 9 0.719
NZ_CP046801_3 3.4|469590|32|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT 469590-469621 32 NZ_CP030068 Klebsiella pneumoniae strain IA565 plasmid pDA11912.3, complete sequence 9747-9778 9 0.719
NZ_CP046801_3 3.4|469590|32|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT 469590-469621 32 NZ_CP028551 Klebsiella variicola strain WCHKP19 plasmid p3_020019, complete sequence 11110-11141 9 0.719
NZ_CP046801_3 3.4|469590|32|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT 469590-469621 32 MN256758 Escherichia coli strain 4M8F plasmid p4M8F, complete sequence 381264-381295 9 0.719
NZ_CP046801_3 3.4|469590|32|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT 469590-469621 32 NZ_CP010154 Escherichia coli strain D9 plasmid B, complete genome 42799-42830 9 0.719
NZ_CP046801_3 3.4|469590|32|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT 469590-469621 32 NZ_CP026578 Escherichia coli strain WCHEC005237 plasmid pQnrS1_005237, complete sequence 52467-52498 9 0.719
NZ_CP046801_3 3.4|469590|32|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT 469590-469621 32 NZ_CP047574 Escherichia coli strain 2EC1 plasmid p2EC1-3, complete sequence 31741-31772 9 0.719
NZ_CP046801_3 3.4|469590|32|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT 469590-469621 32 MN256757 Escherichia coli strain 4M18F plasmid p4M18F, complete sequence 392934-392965 9 0.719
NZ_CP046801_3 3.4|469590|32|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT 469590-469621 32 NZ_KY887595 Escherichia coli strain Ec78 plasmid pEc78, complete sequence 155375-155406 9 0.719
NZ_CP046801_3 3.4|469590|32|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT 469590-469621 32 NZ_CP016838 Salmonella enterica subsp. enterica serovar Senftenberg strain 775W (ATCC 43845) plasmid pSSE-ATCC-43845, complete sequence 129871-129902 9 0.719
NZ_CP046801_5 5.4|550524|32|NZ_CP046801|CRISPRCasFinder,CRT,PILER-CR 550524-550555 32 MN698242 Pelagibacter phage HTVC103P, complete genome 25527-25558 9 0.719
NZ_CP046801_5 5.5|550584|32|NZ_CP046801|CRISPRCasFinder,CRT,PILER-CR 550584-550615 32 KP282673 Acidianus bottle-shaped virus 2 strain ABV2, complete genome 6252-6283 9 0.719
NZ_CP046801_5 5.7|550704|32|NZ_CP046801|CRISPRCasFinder,CRT,PILER-CR 550704-550735 32 CP053317 Salmonella enterica subsp. salamae serovar 6,8:a:z52 strain 62-3163 plasmid unnamed, complete sequence 184111-184142 9 0.719
NZ_CP046801_7 7.4|562998|32|NZ_CP046801|CRISPRCasFinder,CRT,PILER-CR 562998-563029 32 MN698242 Pelagibacter phage HTVC103P, complete genome 25527-25558 9 0.719
NZ_CP046801_7 7.5|563058|32|NZ_CP046801|CRISPRCasFinder,CRT,PILER-CR 563058-563089 32 KP282673 Acidianus bottle-shaped virus 2 strain ABV2, complete genome 6252-6283 9 0.719
NZ_CP046801_7 7.7|563178|32|NZ_CP046801|CRISPRCasFinder,CRT,PILER-CR 563178-563209 32 CP053317 Salmonella enterica subsp. salamae serovar 6,8:a:z52 strain 62-3163 plasmid unnamed, complete sequence 184111-184142 9 0.719
NZ_CP046801_2 2.11|388140|34|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT 388140-388173 34 NZ_CP039048 Piscirickettsia salmonis strain Psal-073 plasmid unnamed2, complete sequence 6074-6107 10 0.706
NZ_CP046801_4 4.2|481212|32|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT 481212-481243 32 NC_014023 Bacillus megaterium QM B1551 plasmid pBM700, complete sequence 157278-157309 10 0.688
NZ_CP046801_4 4.2|481212|32|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT 481212-481243 32 AP014323 Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S33-C38, *** SEQUENCING IN PROGRESS *** 35687-35718 10 0.688
NZ_CP046801_5 5.7|550704|32|NZ_CP046801|CRISPRCasFinder,CRT,PILER-CR 550704-550735 32 NZ_CP047125 Lactobacillus hilgardii strain FLUB plasmid unnamed4 2896-2927 10 0.688
NZ_CP046801_5 5.7|550704|32|NZ_CP046801|CRISPRCasFinder,CRT,PILER-CR 550704-550735 32 NZ_CP030282 Escherichia coli strain E308 plasmid pLKSZ01, complete sequence 3164-3195 10 0.688
NZ_CP046801_5 5.7|550704|32|NZ_CP046801|CRISPRCasFinder,CRT,PILER-CR 550704-550735 32 AP013554 Uncultured Mediterranean phage uvMED isolate uvMED-CGR-C28-MedDCM-OCT-S23-C36, *** SEQUENCING IN PROGRESS ***, 7 ordered pieces 11010-11041 10 0.688
NZ_CP046801_5 5.9|550824|32|NZ_CP046801|CRISPRCasFinder,CRT,PILER-CR 550824-550855 32 KY798216 Mycobacterium phage Journey13, complete genome 7958-7989 10 0.688
NZ_CP046801_7 7.7|563178|32|NZ_CP046801|CRISPRCasFinder,CRT,PILER-CR 563178-563209 32 NZ_CP047125 Lactobacillus hilgardii strain FLUB plasmid unnamed4 2896-2927 10 0.688
NZ_CP046801_7 7.7|563178|32|NZ_CP046801|CRISPRCasFinder,CRT,PILER-CR 563178-563209 32 NZ_CP030282 Escherichia coli strain E308 plasmid pLKSZ01, complete sequence 3164-3195 10 0.688
NZ_CP046801_7 7.7|563178|32|NZ_CP046801|CRISPRCasFinder,CRT,PILER-CR 563178-563209 32 AP013554 Uncultured Mediterranean phage uvMED isolate uvMED-CGR-C28-MedDCM-OCT-S23-C36, *** SEQUENCING IN PROGRESS ***, 7 ordered pieces 11010-11041 10 0.688
NZ_CP046801_7 7.9|563298|32|NZ_CP046801|CRISPRCasFinder,CRT,PILER-CR 563298-563329 32 KY798216 Mycobacterium phage Journey13, complete genome 7958-7989 10 0.688
NZ_CP046801_5 5.1|550344|32|NZ_CP046801|CRISPRCasFinder,CRT 550344-550375 32 NC_047756 Caulobacter phage Sansa, complete genome 54924-54955 11 0.656
NZ_CP046801_7 7.1|562818|32|NZ_CP046801|CRISPRCasFinder,CRT 562818-562849 32 NC_047756 Caulobacter phage Sansa, complete genome 54924-54955 11 0.656

1. spacer 5.1|550344|32|NZ_CP046801|CRISPRCasFinder,CRT matches to NC_021918 (Cycloclasticus zancles 78-ME plasmid p7ME01, complete sequence) position: , mismatch: 0, identity: 1.0 

gtataaaccaggctcttgcgggcctgggtaat	CRISPR spacer
gtataaaccaggctcttgcgggcctgggtaat	Protospacer
********************************

2. spacer 7.1|562818|32|NZ_CP046801|CRISPRCasFinder,CRT matches to NC_021918 (Cycloclasticus zancles 78-ME plasmid p7ME01, complete sequence) position: , mismatch: 0, identity: 1.0 

gtataaaccaggctcttgcgggcctgggtaat	CRISPR spacer
gtataaaccaggctcttgcgggcctgggtaat	Protospacer
********************************

3. spacer 5.1|550344|32|NZ_CP046801|CRISPRCasFinder,CRT matches to NC_017858 (Methylophaga frappieri strain JAM7 plasmid, complete sequence) position: , mismatch: 1, identity: 0.969 

gtataaaccaggctcttgcgggcctgggtaat	CRISPR spacer
gtataaaccaggcgcttgcgggcctgggtaat	Protospacer
************* ******************

4. spacer 7.1|562818|32|NZ_CP046801|CRISPRCasFinder,CRT matches to NC_017858 (Methylophaga frappieri strain JAM7 plasmid, complete sequence) position: , mismatch: 1, identity: 0.969 

gtataaaccaggctcttgcgggcctgggtaat	CRISPR spacer
gtataaaccaggcgcttgcgggcctgggtaat	Protospacer
************* ******************

5. spacer 6.2|554548|32|NZ_CP046801|PILER-CR,CRISPRCasFinder matches to MG592545 (Vibrio phage 1.178.O._10N.286.45.E12, partial genome) position: , mismatch: 3, identity: 0.906 

gttagcgcacagaatgcaatcattaacgttgc	CRISPR spacer
actagcgcacagaatgcaatcattaacgtagc	Protospacer
..*************************** **

6. spacer 8.2|567022|32|NZ_CP046801|PILER-CR,CRISPRCasFinder matches to MG592545 (Vibrio phage 1.178.O._10N.286.45.E12, partial genome) position: , mismatch: 3, identity: 0.906 

gttagcgcacagaatgcaatcattaacgttgc	CRISPR spacer
actagcgcacagaatgcaatcattaacgtagc	Protospacer
..*************************** **

7. spacer 5.1|550344|32|NZ_CP046801|CRISPRCasFinder,CRT matches to AM261282 (Uncultured bacterium IncP-1 plasmid pKJK5 complete sequence) position: , mismatch: 4, identity: 0.875 

gtataaaccaggctcttgcgggcctgggtaat	CRISPR spacer
gtatcaaccaggctctagcgggcctgggtagc	Protospacer
**** *********** *************..

8. spacer 5.1|550344|32|NZ_CP046801|CRISPRCasFinder,CRT matches to NZ_CP028340 (Thauera aromatica K172 plasmid pKJK172, complete sequence) position: , mismatch: 4, identity: 0.875 

gtataaaccaggctcttgcgggcctgggtaat	CRISPR spacer
gtatcaaccaggctctagcgggcctgggtagc	Protospacer
**** *********** *************..

9. spacer 5.1|550344|32|NZ_CP046801|CRISPRCasFinder,CRT matches to KC964605 (Uncultured bacterium plasmid pMLUA1, complete sequence) position: , mismatch: 4, identity: 0.875 

gtataaaccaggctcttgcgggcctgggtaat	CRISPR spacer
gtatcaaccaggctctagcgggcctgggtagc	Protospacer
**** *********** *************..

10. spacer 5.1|550344|32|NZ_CP046801|CRISPRCasFinder,CRT matches to KC964606 (Uncultured bacterium plasmid pMLUA3, complete sequence) position: , mismatch: 4, identity: 0.875 

gtataaaccaggctcttgcgggcctgggtaat	CRISPR spacer
gtatcaaccaggctctagcgggcctgggtagc	Protospacer
**** *********** *************..

11. spacer 5.1|550344|32|NZ_CP046801|CRISPRCasFinder,CRT matches to KC964607 (Uncultured bacterium plasmid pMLUA4, complete sequence) position: , mismatch: 4, identity: 0.875 

gtataaaccaggctcttgcgggcctgggtaat	CRISPR spacer
gtatcaaccaggctctagcgggcctgggtagc	Protospacer
**** *********** *************..

12. spacer 5.1|550344|32|NZ_CP046801|CRISPRCasFinder,CRT matches to JQ004406 (Uncultured bacterium plasmid pHH128, complete sequence) position: , mismatch: 4, identity: 0.875 

gtataaaccaggctcttgcgggcctgggtaat	CRISPR spacer
gtatcaaccaggctctagcgggcctgggtagc	Protospacer
**** *********** *************..

13. spacer 5.1|550344|32|NZ_CP046801|CRISPRCasFinder,CRT matches to JQ004407 (Uncultured bacterium plasmid pHH3408, complete sequence) position: , mismatch: 4, identity: 0.875 

gtataaaccaggctcttgcgggcctgggtaat	CRISPR spacer
gtatcaaccaggctctagcgggcctgggtagc	Protospacer
**** *********** *************..

14. spacer 5.1|550344|32|NZ_CP046801|CRISPRCasFinder,CRT matches to JQ004408 (Uncultured bacterium plasmid pHH3414, complete sequence) position: , mismatch: 4, identity: 0.875 

gtataaaccaggctcttgcgggcctgggtaat	CRISPR spacer
gtatcaaccaggctctagcgggcctgggtagc	Protospacer
**** *********** *************..

15. spacer 5.1|550344|32|NZ_CP046801|CRISPRCasFinder,CRT matches to JQ004409 (Uncultured bacterium plasmid pKS77, complete sequence) position: , mismatch: 4, identity: 0.875 

gtataaaccaggctcttgcgggcctgggtaat	CRISPR spacer
gtatcaaccaggctctagcgggcctgggtagc	Protospacer
**** *********** *************..

16. spacer 5.1|550344|32|NZ_CP046801|CRISPRCasFinder,CRT matches to NZ_MN366356 (Bacterium plasmid pALTS27, complete sequence) position: , mismatch: 4, identity: 0.875 

gtataaaccaggctcttgcgggcctgggtaat	CRISPR spacer
gtatcaaccaggctctagcgggcctgggtagc	Protospacer
**** *********** *************..

17. spacer 5.1|550344|32|NZ_CP046801|CRISPRCasFinder,CRT matches to NZ_MN366360 (Bacterium plasmid pALTS32, complete sequence) position: , mismatch: 4, identity: 0.875 

gtataaaccaggctcttgcgggcctgggtaat	CRISPR spacer
gtatcaaccaggctctagcgggcctgggtagc	Protospacer
**** *********** *************..

18. spacer 6.2|554548|32|NZ_CP046801|PILER-CR,CRISPRCasFinder matches to MG592600 (Vibrio phage 1.236.O._10N.261.52.C4, partial genome) position: , mismatch: 4, identity: 0.875 

gttagcgcacagaatgcaatcattaacgttgc	CRISPR spacer
actagcgcacagaatgcaattattaacgtagc	Protospacer
..******************.******** **

19. spacer 6.2|554548|32|NZ_CP046801|PILER-CR,CRISPRCasFinder matches to KX507045 (Vibrio phage 2E1, complete genome) position: , mismatch: 4, identity: 0.875 

gttagcgcacagaatgcaatcattaacgttgc	CRISPR spacer
actagcgcacagaatgcaattattaacgtagc	Protospacer
..******************.******** **

20. spacer 7.1|562818|32|NZ_CP046801|CRISPRCasFinder,CRT matches to AM261282 (Uncultured bacterium IncP-1 plasmid pKJK5 complete sequence) position: , mismatch: 4, identity: 0.875 

gtataaaccaggctcttgcgggcctgggtaat	CRISPR spacer
gtatcaaccaggctctagcgggcctgggtagc	Protospacer
**** *********** *************..

21. spacer 7.1|562818|32|NZ_CP046801|CRISPRCasFinder,CRT matches to NZ_CP028340 (Thauera aromatica K172 plasmid pKJK172, complete sequence) position: , mismatch: 4, identity: 0.875 

gtataaaccaggctcttgcgggcctgggtaat	CRISPR spacer
gtatcaaccaggctctagcgggcctgggtagc	Protospacer
**** *********** *************..

22. spacer 7.1|562818|32|NZ_CP046801|CRISPRCasFinder,CRT matches to KC964605 (Uncultured bacterium plasmid pMLUA1, complete sequence) position: , mismatch: 4, identity: 0.875 

gtataaaccaggctcttgcgggcctgggtaat	CRISPR spacer
gtatcaaccaggctctagcgggcctgggtagc	Protospacer
**** *********** *************..

23. spacer 7.1|562818|32|NZ_CP046801|CRISPRCasFinder,CRT matches to KC964606 (Uncultured bacterium plasmid pMLUA3, complete sequence) position: , mismatch: 4, identity: 0.875 

gtataaaccaggctcttgcgggcctgggtaat	CRISPR spacer
gtatcaaccaggctctagcgggcctgggtagc	Protospacer
**** *********** *************..

24. spacer 7.1|562818|32|NZ_CP046801|CRISPRCasFinder,CRT matches to KC964607 (Uncultured bacterium plasmid pMLUA4, complete sequence) position: , mismatch: 4, identity: 0.875 

gtataaaccaggctcttgcgggcctgggtaat	CRISPR spacer
gtatcaaccaggctctagcgggcctgggtagc	Protospacer
**** *********** *************..

25. spacer 7.1|562818|32|NZ_CP046801|CRISPRCasFinder,CRT matches to JQ004406 (Uncultured bacterium plasmid pHH128, complete sequence) position: , mismatch: 4, identity: 0.875 

gtataaaccaggctcttgcgggcctgggtaat	CRISPR spacer
gtatcaaccaggctctagcgggcctgggtagc	Protospacer
**** *********** *************..

26. spacer 7.1|562818|32|NZ_CP046801|CRISPRCasFinder,CRT matches to JQ004407 (Uncultured bacterium plasmid pHH3408, complete sequence) position: , mismatch: 4, identity: 0.875 

gtataaaccaggctcttgcgggcctgggtaat	CRISPR spacer
gtatcaaccaggctctagcgggcctgggtagc	Protospacer
**** *********** *************..

27. spacer 7.1|562818|32|NZ_CP046801|CRISPRCasFinder,CRT matches to JQ004408 (Uncultured bacterium plasmid pHH3414, complete sequence) position: , mismatch: 4, identity: 0.875 

gtataaaccaggctcttgcgggcctgggtaat	CRISPR spacer
gtatcaaccaggctctagcgggcctgggtagc	Protospacer
**** *********** *************..

28. spacer 7.1|562818|32|NZ_CP046801|CRISPRCasFinder,CRT matches to JQ004409 (Uncultured bacterium plasmid pKS77, complete sequence) position: , mismatch: 4, identity: 0.875 

gtataaaccaggctcttgcgggcctgggtaat	CRISPR spacer
gtatcaaccaggctctagcgggcctgggtagc	Protospacer
**** *********** *************..

29. spacer 7.1|562818|32|NZ_CP046801|CRISPRCasFinder,CRT matches to NZ_MN366356 (Bacterium plasmid pALTS27, complete sequence) position: , mismatch: 4, identity: 0.875 

gtataaaccaggctcttgcgggcctgggtaat	CRISPR spacer
gtatcaaccaggctctagcgggcctgggtagc	Protospacer
**** *********** *************..

30. spacer 7.1|562818|32|NZ_CP046801|CRISPRCasFinder,CRT matches to NZ_MN366360 (Bacterium plasmid pALTS32, complete sequence) position: , mismatch: 4, identity: 0.875 

gtataaaccaggctcttgcgggcctgggtaat	CRISPR spacer
gtatcaaccaggctctagcgggcctgggtagc	Protospacer
**** *********** *************..

31. spacer 8.2|567022|32|NZ_CP046801|PILER-CR,CRISPRCasFinder matches to MG592600 (Vibrio phage 1.236.O._10N.261.52.C4, partial genome) position: , mismatch: 4, identity: 0.875 

gttagcgcacagaatgcaatcattaacgttgc	CRISPR spacer
actagcgcacagaatgcaattattaacgtagc	Protospacer
..******************.******** **

32. spacer 8.2|567022|32|NZ_CP046801|PILER-CR,CRISPRCasFinder matches to KX507045 (Vibrio phage 2E1, complete genome) position: , mismatch: 4, identity: 0.875 

gttagcgcacagaatgcaatcattaacgttgc	CRISPR spacer
actagcgcacagaatgcaattattaacgtagc	Protospacer
..******************.******** **

33. spacer 5.1|550344|32|NZ_CP046801|CRISPRCasFinder,CRT matches to JX469827 (Uncultured bacterium plasmid pEMT3, complete sequence) position: , mismatch: 5, identity: 0.844 

gtataaaccaggctcttgcgggcctgggtaat	CRISPR spacer
gtatcaaccaggctctagcgggcctgggcagc	Protospacer
**** *********** ***********.*..

34. spacer 5.1|550344|32|NZ_CP046801|CRISPRCasFinder,CRT matches to JN106170 (Uncultured bacterium plasmid pAKD25, complete sequence) position: , mismatch: 5, identity: 0.844 

gtataaaccaggctcttgcgggcctgggtaat	CRISPR spacer
gtatcaaccaggctctagcgggcctgggcagc	Protospacer
**** *********** ***********.*..

35. spacer 5.1|550344|32|NZ_CP046801|CRISPRCasFinder,CRT matches to JN106175 (Uncultured bacterium plasmid pAKD34, complete sequence) position: , mismatch: 5, identity: 0.844 

gtataaaccaggctcttgcgggcctgggtaat	CRISPR spacer
gtatcaaccaggctctagcgggcctgggcagc	Protospacer
**** *********** ***********.*..

36. spacer 5.1|550344|32|NZ_CP046801|CRISPRCasFinder,CRT matches to JN106167 (Uncultured bacterium plasmid pAKD16, complete sequence) position: , mismatch: 5, identity: 0.844 

gtataaaccaggctcttgcgggcctgggtaat	CRISPR spacer
gtatcaaccaggctctagcgggcctgggcagc	Protospacer
**** *********** ***********.*..

37. spacer 5.1|550344|32|NZ_CP046801|CRISPRCasFinder,CRT matches to NC_019318 (Ralstonia pickettii plasmid p712, complete sequence) position: , mismatch: 5, identity: 0.844 

gtataaaccaggctcttgcgggcctgggtaat	CRISPR spacer
gtatcaaccaggctctagcgggcctgggcagc	Protospacer
**** *********** ***********.*..

38. spacer 6.2|554548|32|NZ_CP046801|PILER-CR,CRISPRCasFinder matches to MG592567 (Vibrio phage 1.198.A._10N.286.54.F4, partial genome) position: , mismatch: 5, identity: 0.844 

gttagcgcacagaatgcaatcattaacgttgc	CRISPR spacer
accagtgcacagaatgcaatcattaacgtagc	Protospacer
...**.*********************** **

39. spacer 6.2|554548|32|NZ_CP046801|PILER-CR,CRISPRCasFinder matches to MG592568 (Vibrio phage 1.198.B._10N.286.54.F4, partial genome) position: , mismatch: 5, identity: 0.844 

gttagcgcacagaatgcaatcattaacgttgc	CRISPR spacer
accagtgcacagaatgcaatcattaacgtagc	Protospacer
...**.*********************** **

40. spacer 6.2|554548|32|NZ_CP046801|PILER-CR,CRISPRCasFinder matches to MG676223 (Vibrio phage ValSw3-3, partial genome) position: , mismatch: 5, identity: 0.844 

gttagcgcacagaatgcaatcattaacgttgc	CRISPR spacer
acgagcgcacaaaacgcaatcattaacgttgc	Protospacer
.. ********.**.*****************

41. spacer 6.2|554548|32|NZ_CP046801|PILER-CR,CRISPRCasFinder matches to MN855933 (Siphoviridae sp. isolate 66, complete genome) position: , mismatch: 5, identity: 0.844 

gttagcgcacagaatgcaatcattaacgttgc	CRISPR spacer
accagcgcgcagaacgcaatcattaacgttgc	Protospacer
...*****.*****.*****************

42. spacer 7.1|562818|32|NZ_CP046801|CRISPRCasFinder,CRT matches to JX469827 (Uncultured bacterium plasmid pEMT3, complete sequence) position: , mismatch: 5, identity: 0.844 

gtataaaccaggctcttgcgggcctgggtaat	CRISPR spacer
gtatcaaccaggctctagcgggcctgggcagc	Protospacer
**** *********** ***********.*..

43. spacer 7.1|562818|32|NZ_CP046801|CRISPRCasFinder,CRT matches to JN106170 (Uncultured bacterium plasmid pAKD25, complete sequence) position: , mismatch: 5, identity: 0.844 

gtataaaccaggctcttgcgggcctgggtaat	CRISPR spacer
gtatcaaccaggctctagcgggcctgggcagc	Protospacer
**** *********** ***********.*..

44. spacer 7.1|562818|32|NZ_CP046801|CRISPRCasFinder,CRT matches to JN106175 (Uncultured bacterium plasmid pAKD34, complete sequence) position: , mismatch: 5, identity: 0.844 

gtataaaccaggctcttgcgggcctgggtaat	CRISPR spacer
gtatcaaccaggctctagcgggcctgggcagc	Protospacer
**** *********** ***********.*..

45. spacer 7.1|562818|32|NZ_CP046801|CRISPRCasFinder,CRT matches to JN106167 (Uncultured bacterium plasmid pAKD16, complete sequence) position: , mismatch: 5, identity: 0.844 

gtataaaccaggctcttgcgggcctgggtaat	CRISPR spacer
gtatcaaccaggctctagcgggcctgggcagc	Protospacer
**** *********** ***********.*..

46. spacer 7.1|562818|32|NZ_CP046801|CRISPRCasFinder,CRT matches to NC_019318 (Ralstonia pickettii plasmid p712, complete sequence) position: , mismatch: 5, identity: 0.844 

gtataaaccaggctcttgcgggcctgggtaat	CRISPR spacer
gtatcaaccaggctctagcgggcctgggcagc	Protospacer
**** *********** ***********.*..

47. spacer 8.2|567022|32|NZ_CP046801|PILER-CR,CRISPRCasFinder matches to MG592567 (Vibrio phage 1.198.A._10N.286.54.F4, partial genome) position: , mismatch: 5, identity: 0.844 

gttagcgcacagaatgcaatcattaacgttgc	CRISPR spacer
accagtgcacagaatgcaatcattaacgtagc	Protospacer
...**.*********************** **

48. spacer 8.2|567022|32|NZ_CP046801|PILER-CR,CRISPRCasFinder matches to MG592568 (Vibrio phage 1.198.B._10N.286.54.F4, partial genome) position: , mismatch: 5, identity: 0.844 

gttagcgcacagaatgcaatcattaacgttgc	CRISPR spacer
accagtgcacagaatgcaatcattaacgtagc	Protospacer
...**.*********************** **

49. spacer 8.2|567022|32|NZ_CP046801|PILER-CR,CRISPRCasFinder matches to MG676223 (Vibrio phage ValSw3-3, partial genome) position: , mismatch: 5, identity: 0.844 

gttagcgcacagaatgcaatcattaacgttgc	CRISPR spacer
acgagcgcacaaaacgcaatcattaacgttgc	Protospacer
.. ********.**.*****************

50. spacer 8.2|567022|32|NZ_CP046801|PILER-CR,CRISPRCasFinder matches to MN855933 (Siphoviridae sp. isolate 66, complete genome) position: , mismatch: 5, identity: 0.844 

gttagcgcacagaatgcaatcattaacgttgc	CRISPR spacer
accagcgcgcagaacgcaatcattaacgttgc	Protospacer
...*****.*****.*****************

51. spacer 3.6|469710|32|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT matches to MT786458 (Staphylococcus phage vB_SauH_SAP1, complete genome) position: , mismatch: 6, identity: 0.812 

cggtatgaggaggatgtttataagacatatcc-	CRISPR spacer
gggtatgaggaagatgtatataagcta-atcca	Protospacer
 **********.***** ****** .* ****

52. spacer 3.6|469710|32|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT matches to MG557618 (Staphylococcus phage HSA30, complete genome) position: , mismatch: 6, identity: 0.812 

cggtatgaggaggatgtttataagacatatcc-	CRISPR spacer
gggtatgaggaagatgtatataagtta-atcca	Protospacer
 **********.***** ****** .* ****

53. spacer 3.6|469710|32|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT matches to KY779849 (Staphylococcus phage qdsa002, complete genome) position: , mismatch: 6, identity: 0.812 

cggtatgaggaggatgtttataagacatatcc-	CRISPR spacer
gggtatgaggaagatgtatataagtta-atcca	Protospacer
 **********.***** ****** .* ****

54. spacer 3.6|469710|32|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT matches to MF001365 (Staphylococcus phage SA3, partial genome) position: , mismatch: 6, identity: 0.812 

cggtatgaggaggatgtttataagacatatcc-	CRISPR spacer
gggtatgaggaagatgtatataagtta-atcca	Protospacer
 **********.***** ****** .* ****

55. spacer 3.6|469710|32|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT matches to MH159197 (Staphylococcus phage VB_SavM_JYL01, complete genome) position: , mismatch: 6, identity: 0.812 

cggtatgaggaggatgtttataagacatatcc-	CRISPR spacer
gggtatgaggaagatgtatataagtta-atcca	Protospacer
 **********.***** ****** .* ****

56. spacer 3.6|469710|32|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT matches to MN304941 (Staphylococcus phage vB_SauH_IME522, complete genome) position: , mismatch: 6, identity: 0.812 

cggtatgaggaggatgtttataagacatatcc-	CRISPR spacer
gggtatgaggaagatgtatataagtta-atcca	Protospacer
 **********.***** ****** .* ****

57. spacer 3.6|469710|32|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT matches to MK250904 (Staphylococcus phage VB-SavM-JYL02, complete genome) position: , mismatch: 6, identity: 0.812 

cggtatgaggaggatgtttataagacatatcc-	CRISPR spacer
gggtatgaggaagatgtatataagtta-atcca	Protospacer
 **********.***** ****** .* ****

58. spacer 3.6|469710|32|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT matches to KM216423 (Staphylococcus phage P108, complete genome) position: , mismatch: 6, identity: 0.812 

cggtatgaggaggatgtttataagacatatcc-	CRISPR spacer
gggtatgaggaagatgtatataagtta-atcca	Protospacer
 **********.***** ****** .* ****

59. spacer 3.6|469710|32|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT matches to NC_019448 (Staphylococcus phage GH15, complete genome) position: , mismatch: 6, identity: 0.812 

cggtatgaggaggatgtttataagacatatcc-	CRISPR spacer
gggtatgaggaagatgtatataagtta-atcca	Protospacer
 **********.***** ****** .* ****

60. spacer 6.2|554548|32|NZ_CP046801|PILER-CR,CRISPRCasFinder matches to MN856087 (Bacteriophage sp. isolate 245, complete genome) position: , mismatch: 6, identity: 0.812 

gttagcgcacagaatgcaatcattaacgttgc	CRISPR spacer
gtgtcggcgcagaatgcaataattaacgttgc	Protospacer
**    **.*********** ***********

61. spacer 8.2|567022|32|NZ_CP046801|PILER-CR,CRISPRCasFinder matches to MN856087 (Bacteriophage sp. isolate 245, complete genome) position: , mismatch: 6, identity: 0.812 

gttagcgcacagaatgcaatcattaacgttgc	CRISPR spacer
gtgtcggcgcagaatgcaataattaacgttgc	Protospacer
**    **.*********** ***********

62. spacer 3.9|469890|32|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026025 (Klebsiella pneumoniae strain 11420 plasmid p11420-KPC, complete sequence) position: , mismatch: 7, identity: 0.781 

gttcgaagaacaccagcttaaccggtggtagt-	CRISPR spacer
aatcgaacaacaccagcttaagcgg-ggtggcg	Protospacer
. ***** ************* *** ***.*.

63. spacer 4.2|481212|32|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045304 (Legionella longbeachae strain B1445CHC plasmid pB1445CHC_73K, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgctatgtttaaatcatcaaaagagtgagca	CRISPR spacer
gggtattttttaaattatcaaaagagtgagca	Protospacer
  *.  * *******.****************

64. spacer 5.5|550584|32|NZ_CP046801|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025846 (Escherichia coli strain 720632 plasmid p720632_86, complete sequence) position: , mismatch: 7, identity: 0.781 

atgcaagtagagtaattaaatcaattggcgta--	CRISPR spacer
atgcaagttgagttattaaatcagt--acctagt	Protospacer
******** **** *********.*  .* **

65. spacer 5.7|550704|32|NZ_CP046801|CRISPRCasFinder,CRT,PILER-CR matches to NC_011246 (Borrelia recurrentis A1 plasmid pl124, complete sequence) position: , mismatch: 7, identity: 0.781 

ttttaaagatttctttgtttatttgggcgcgt-	CRISPR spacer
tattaaatatttctttgtttcttt-gatgcata	Protospacer
* ***** ************ *** *..**.*

66. spacer 5.7|550704|32|NZ_CP046801|CRISPRCasFinder,CRT,PILER-CR matches to NC_011247 (Borrelia duttonii Ly plasmid pl165, complete sequence) position: , mismatch: 7, identity: 0.781 

ttttaaagatttctttgtttatttgggcgcgt-	CRISPR spacer
tattaaatatttctttgtttgttt-gatgcata	Protospacer
* ***** ************.*** *..**.*

67. spacer 6.1|554488|32|NZ_CP046801|PILER-CR,CRISPRCasFinder matches to NZ_CP034238 (Aliivibrio salmonicida strain VS224 plasmid pRVS1-224, complete sequence) position: , mismatch: 7, identity: 0.781 

aggagatatgacaaatggctcaaac-tacatcg	CRISPR spacer
tggagatattacatatggctcaaacataggtt-	Protospacer
 ******** *** *********** ** .*.

68. spacer 6.1|554488|32|NZ_CP046801|PILER-CR,CRISPRCasFinder matches to MN655998 (Escherichia phage E26, complete genome) position: , mismatch: 7, identity: 0.781 

aggagatatgacaaatggctcaaactacatcg	CRISPR spacer
tgcaaacatgacaaatatctcaaactacattg	Protospacer
 * *.*.*********. ************.*

69. spacer 6.1|554488|32|NZ_CP046801|PILER-CR,CRISPRCasFinder matches to MK573636 (Escherichia phage vB_EcoM_PHB13, partial genome) position: , mismatch: 7, identity: 0.781 

aggagatatgacaaatggctcaaactacatcg	CRISPR spacer
cgcaaacatgacaaatatctcaaactacattg	Protospacer
 * *.*.*********. ************.*

70. spacer 6.1|554488|32|NZ_CP046801|PILER-CR,CRISPRCasFinder matches to MT764208 (Escherichia phage JEP8, complete genome) position: , mismatch: 7, identity: 0.781 

aggagatatgacaaatggctcaaactacatcg	CRISPR spacer
tgcaaacatgacaaatatctcaaactacattg	Protospacer
 * *.*.*********. ************.*

71. spacer 6.1|554488|32|NZ_CP046801|PILER-CR,CRISPRCasFinder matches to MT478991 (Escherichia phage vB_EcoM_011D4, complete genome) position: , mismatch: 7, identity: 0.781 

aggagatatgacaaatggctcaaactacatcg	CRISPR spacer
tgcaaacatgacaaatatctcaaactacattg	Protospacer
 * *.*.*********. ************.*

72. spacer 6.1|554488|32|NZ_CP046801|PILER-CR,CRISPRCasFinder matches to MK327941 (Escherichia phage vB_EcoM_G37-3, complete genome) position: , mismatch: 7, identity: 0.781 

aggagatatgacaaatggctcaaactacatcg	CRISPR spacer
tgcaaacatgacaaatatctcaaactacattg	Protospacer
 * *.*.*********. ************.*

73. spacer 6.1|554488|32|NZ_CP046801|PILER-CR,CRISPRCasFinder matches to NC_009821 (Enterobacteria phage Phi1, complete genome) position: , mismatch: 7, identity: 0.781 

aggagatatgacaaatggctcaaactacatcg	CRISPR spacer
tgcaaacatgacaaatatctcaaactacattg	Protospacer
 * *.*.*********. ************.*

74. spacer 6.1|554488|32|NZ_CP046801|PILER-CR,CRISPRCasFinder matches to MF327006 (Shigella phage Sf20, complete genome) position: , mismatch: 7, identity: 0.781 

aggagatatgacaaatggctcaaactacatcg	CRISPR spacer
tgcaaacatgacaaatatctcaaactacattg	Protospacer
 * *.*.*********. ************.*

75. spacer 6.1|554488|32|NZ_CP046801|PILER-CR,CRISPRCasFinder matches to NC_025425 (Enterobacteria phage GEC-3S complete genome) position: , mismatch: 7, identity: 0.781 

aggagatatgacaaatggctcaaactacatcg	CRISPR spacer
tgcaaacatgacaaatatctcaaactacattg	Protospacer
 * *.*.*********. ************.*

76. spacer 6.1|554488|32|NZ_CP046801|PILER-CR,CRISPRCasFinder matches to MN709127 (Escherichia virus Ec_Makalu_002, complete genome) position: , mismatch: 7, identity: 0.781 

aggagatatgacaaatggctcaaactacatcg	CRISPR spacer
tgcaaacatgacaaatatctcaaactacattg	Protospacer
 * *.*.*********. ************.*

77. spacer 6.1|554488|32|NZ_CP046801|PILER-CR,CRISPRCasFinder matches to MK327947 (Escherichia phage vB_EcoM_G5211, complete genome) position: , mismatch: 7, identity: 0.781 

aggagatatgacaaatggctcaaactacatcg	CRISPR spacer
tgcaaacatgacaaatatctcaaactacattg	Protospacer
 * *.*.*********. ************.*

78. spacer 6.1|554488|32|NZ_CP046801|PILER-CR,CRISPRCasFinder matches to NC_041936 (Escherichia phage ECD7, complete genome) position: , mismatch: 7, identity: 0.781 

aggagatatgacaaatggctcaaactacatcg	CRISPR spacer
tgcaaacatgacaaatatctcaaactacattg	Protospacer
 * *.*.*********. ************.*

79. spacer 6.1|554488|32|NZ_CP046801|PILER-CR,CRISPRCasFinder matches to MK327935 (Escherichia phage vB_EcoM_G2494, complete genome) position: , mismatch: 7, identity: 0.781 

aggagatatgacaaatggctcaaactacatcg	CRISPR spacer
tgcaaacatgacaaatatctcaaactacattg	Protospacer
 * *.*.*********. ************.*

80. spacer 6.1|554488|32|NZ_CP046801|PILER-CR,CRISPRCasFinder matches to MK962753 (Shigella phage JK32, complete genome) position: , mismatch: 7, identity: 0.781 

aggagatatgacaaatggctcaaactacatcg	CRISPR spacer
tgcaaacatgacaaatatctcaaactacattg	Protospacer
 * *.*.*********. ************.*

81. spacer 6.1|554488|32|NZ_CP046801|PILER-CR,CRISPRCasFinder matches to NC_012740 (Enterobacteria phage JSE, complete genome) position: , mismatch: 7, identity: 0.781 

aggagatatgacaaatggctcaaactacatcg	CRISPR spacer
tgcaaacatgacaaatatctcaaactacattg	Protospacer
 * *.*.*********. ************.*

82. spacer 6.1|554488|32|NZ_CP046801|PILER-CR,CRISPRCasFinder matches to MN850574 (Escherichia phage kaaroe, complete genome) position: , mismatch: 7, identity: 0.781 

aggagatatgacaaatggctcaaactacatcg	CRISPR spacer
tgcaaacatgacaaatatctcaaactacattg	Protospacer
 * *.*.*********. ************.*

83. spacer 6.1|554488|32|NZ_CP046801|PILER-CR,CRISPRCasFinder matches to MN850615 (Escherichia phage kvi, complete genome) position: , mismatch: 7, identity: 0.781 

aggagatatgacaaatggctcaaactacatcg	CRISPR spacer
tgcaaacatgacaaatatctcaaactacattg	Protospacer
 * *.*.*********. ************.*

84. spacer 6.1|554488|32|NZ_CP046801|PILER-CR,CRISPRCasFinder matches to MN894885 (Escherichia virus Ec_Makalu_001, complete genome) position: , mismatch: 7, identity: 0.781 

aggagatatgacaaatggctcaaactacatcg	CRISPR spacer
tgcaaacatgacaaatatctcaaactacattg	Protospacer
 * *.*.*********. ************.*

85. spacer 7.5|563058|32|NZ_CP046801|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025846 (Escherichia coli strain 720632 plasmid p720632_86, complete sequence) position: , mismatch: 7, identity: 0.781 

atgcaagtagagtaattaaatcaattggcgta--	CRISPR spacer
atgcaagttgagttattaaatcagt--acctagt	Protospacer
******** **** *********.*  .* **

86. spacer 7.7|563178|32|NZ_CP046801|CRISPRCasFinder,CRT,PILER-CR matches to NC_011246 (Borrelia recurrentis A1 plasmid pl124, complete sequence) position: , mismatch: 7, identity: 0.781 

ttttaaagatttctttgtttatttgggcgcgt-	CRISPR spacer
tattaaatatttctttgtttcttt-gatgcata	Protospacer
* ***** ************ *** *..**.*

87. spacer 7.7|563178|32|NZ_CP046801|CRISPRCasFinder,CRT,PILER-CR matches to NC_011247 (Borrelia duttonii Ly plasmid pl165, complete sequence) position: , mismatch: 7, identity: 0.781 

ttttaaagatttctttgtttatttgggcgcgt-	CRISPR spacer
tattaaatatttctttgtttgttt-gatgcata	Protospacer
* ***** ************.*** *..**.*

88. spacer 8.1|566962|32|NZ_CP046801|PILER-CR,CRISPRCasFinder matches to NZ_CP034238 (Aliivibrio salmonicida strain VS224 plasmid pRVS1-224, complete sequence) position: , mismatch: 7, identity: 0.781 

aggagatatgacaaatggctcaaac-tacatcg	CRISPR spacer
tggagatattacatatggctcaaacataggtt-	Protospacer
 ******** *** *********** ** .*.

89. spacer 8.1|566962|32|NZ_CP046801|PILER-CR,CRISPRCasFinder matches to MN655998 (Escherichia phage E26, complete genome) position: , mismatch: 7, identity: 0.781 

aggagatatgacaaatggctcaaactacatcg	CRISPR spacer
tgcaaacatgacaaatatctcaaactacattg	Protospacer
 * *.*.*********. ************.*

90. spacer 8.1|566962|32|NZ_CP046801|PILER-CR,CRISPRCasFinder matches to MK573636 (Escherichia phage vB_EcoM_PHB13, partial genome) position: , mismatch: 7, identity: 0.781 

aggagatatgacaaatggctcaaactacatcg	CRISPR spacer
cgcaaacatgacaaatatctcaaactacattg	Protospacer
 * *.*.*********. ************.*

91. spacer 8.1|566962|32|NZ_CP046801|PILER-CR,CRISPRCasFinder matches to MT764208 (Escherichia phage JEP8, complete genome) position: , mismatch: 7, identity: 0.781 

aggagatatgacaaatggctcaaactacatcg	CRISPR spacer
tgcaaacatgacaaatatctcaaactacattg	Protospacer
 * *.*.*********. ************.*

92. spacer 8.1|566962|32|NZ_CP046801|PILER-CR,CRISPRCasFinder matches to MT478991 (Escherichia phage vB_EcoM_011D4, complete genome) position: , mismatch: 7, identity: 0.781 

aggagatatgacaaatggctcaaactacatcg	CRISPR spacer
tgcaaacatgacaaatatctcaaactacattg	Protospacer
 * *.*.*********. ************.*

93. spacer 8.1|566962|32|NZ_CP046801|PILER-CR,CRISPRCasFinder matches to MK327941 (Escherichia phage vB_EcoM_G37-3, complete genome) position: , mismatch: 7, identity: 0.781 

aggagatatgacaaatggctcaaactacatcg	CRISPR spacer
tgcaaacatgacaaatatctcaaactacattg	Protospacer
 * *.*.*********. ************.*

94. spacer 8.1|566962|32|NZ_CP046801|PILER-CR,CRISPRCasFinder matches to NC_009821 (Enterobacteria phage Phi1, complete genome) position: , mismatch: 7, identity: 0.781 

aggagatatgacaaatggctcaaactacatcg	CRISPR spacer
tgcaaacatgacaaatatctcaaactacattg	Protospacer
 * *.*.*********. ************.*

95. spacer 8.1|566962|32|NZ_CP046801|PILER-CR,CRISPRCasFinder matches to MF327006 (Shigella phage Sf20, complete genome) position: , mismatch: 7, identity: 0.781 

aggagatatgacaaatggctcaaactacatcg	CRISPR spacer
tgcaaacatgacaaatatctcaaactacattg	Protospacer
 * *.*.*********. ************.*

96. spacer 8.1|566962|32|NZ_CP046801|PILER-CR,CRISPRCasFinder matches to NC_025425 (Enterobacteria phage GEC-3S complete genome) position: , mismatch: 7, identity: 0.781 

aggagatatgacaaatggctcaaactacatcg	CRISPR spacer
tgcaaacatgacaaatatctcaaactacattg	Protospacer
 * *.*.*********. ************.*

97. spacer 8.1|566962|32|NZ_CP046801|PILER-CR,CRISPRCasFinder matches to MN709127 (Escherichia virus Ec_Makalu_002, complete genome) position: , mismatch: 7, identity: 0.781 

aggagatatgacaaatggctcaaactacatcg	CRISPR spacer
tgcaaacatgacaaatatctcaaactacattg	Protospacer
 * *.*.*********. ************.*

98. spacer 8.1|566962|32|NZ_CP046801|PILER-CR,CRISPRCasFinder matches to MK327947 (Escherichia phage vB_EcoM_G5211, complete genome) position: , mismatch: 7, identity: 0.781 

aggagatatgacaaatggctcaaactacatcg	CRISPR spacer
tgcaaacatgacaaatatctcaaactacattg	Protospacer
 * *.*.*********. ************.*

99. spacer 8.1|566962|32|NZ_CP046801|PILER-CR,CRISPRCasFinder matches to NC_041936 (Escherichia phage ECD7, complete genome) position: , mismatch: 7, identity: 0.781 

aggagatatgacaaatggctcaaactacatcg	CRISPR spacer
tgcaaacatgacaaatatctcaaactacattg	Protospacer
 * *.*.*********. ************.*

100. spacer 8.1|566962|32|NZ_CP046801|PILER-CR,CRISPRCasFinder matches to MK327935 (Escherichia phage vB_EcoM_G2494, complete genome) position: , mismatch: 7, identity: 0.781 

aggagatatgacaaatggctcaaactacatcg	CRISPR spacer
tgcaaacatgacaaatatctcaaactacattg	Protospacer
 * *.*.*********. ************.*

101. spacer 8.1|566962|32|NZ_CP046801|PILER-CR,CRISPRCasFinder matches to MK962753 (Shigella phage JK32, complete genome) position: , mismatch: 7, identity: 0.781 

aggagatatgacaaatggctcaaactacatcg	CRISPR spacer
tgcaaacatgacaaatatctcaaactacattg	Protospacer
 * *.*.*********. ************.*

102. spacer 8.1|566962|32|NZ_CP046801|PILER-CR,CRISPRCasFinder matches to NC_012740 (Enterobacteria phage JSE, complete genome) position: , mismatch: 7, identity: 0.781 

aggagatatgacaaatggctcaaactacatcg	CRISPR spacer
tgcaaacatgacaaatatctcaaactacattg	Protospacer
 * *.*.*********. ************.*

103. spacer 8.1|566962|32|NZ_CP046801|PILER-CR,CRISPRCasFinder matches to MN850574 (Escherichia phage kaaroe, complete genome) position: , mismatch: 7, identity: 0.781 

aggagatatgacaaatggctcaaactacatcg	CRISPR spacer
tgcaaacatgacaaatatctcaaactacattg	Protospacer
 * *.*.*********. ************.*

104. spacer 8.1|566962|32|NZ_CP046801|PILER-CR,CRISPRCasFinder matches to MN850615 (Escherichia phage kvi, complete genome) position: , mismatch: 7, identity: 0.781 

aggagatatgacaaatggctcaaactacatcg	CRISPR spacer
tgcaaacatgacaaatatctcaaactacattg	Protospacer
 * *.*.*********. ************.*

105. spacer 8.1|566962|32|NZ_CP046801|PILER-CR,CRISPRCasFinder matches to MN894885 (Escherichia virus Ec_Makalu_001, complete genome) position: , mismatch: 7, identity: 0.781 

aggagatatgacaaatggctcaaactacatcg	CRISPR spacer
tgcaaacatgacaaatatctcaaactacattg	Protospacer
 * *.*.*********. ************.*

106. spacer 2.5|387746|33|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT matches to MK075005 (Staphylococcus phage phiSP119-2, partial genome) position: , mismatch: 8, identity: 0.758 

aggccgttcttcaatccttgcaccagtatcgat	CRISPR spacer
tgtcatttcttcaatacttgcaccagtgtcttt	Protospacer
 * *  ********* ***********.**  *

107. spacer 3.3|469530|32|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053905 (Hymenobacter sp. BRD67 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

tggcgctgtctgagcctgttgcactggctgag	CRISPR spacer
aagcgctggctgagcctgttgcgctcgtccag	Protospacer
 .****** *************.** *.. **

108. spacer 3.3|469530|32|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT matches to MF417892 (Uncultured Caudovirales phage clone 2F_2, partial genome) position: , mismatch: 8, identity: 0.75 

tggcgctgtctgagcctgttgcactggctgag	CRISPR spacer
tcccgctgtgtgagcctgtggcactgtatcaa	Protospacer
*  ****** ********* ******  * *.

109. spacer 3.9|469890|32|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT matches to MT075871 (Klebsiella phage vB_KleS-HSE3, complete genome) position: , mismatch: 8, identity: 0.75 

gttcgaagaacaccagcttaacc-ggtggtagt	CRISPR spacer
tgtcgaagatcaccaggttaaccgggcggccg-	Protospacer
  ******* ****** ****** **.**. *

110. spacer 5.3|550464|32|NZ_CP046801|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050104 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence) position: , mismatch: 8, identity: 0.75 

tctccgctgcaagcacaaatcgc----tcgctttta	CRISPR spacer
tctccgctgcgggcacaaatcgcgacgtcggc----	Protospacer
**********..***********    *** .

111. spacer 5.3|550464|32|NZ_CP046801|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025507 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence) position: , mismatch: 8, identity: 0.75 

tctccgctgcaagcacaaatcgc----tcgctttta	CRISPR spacer
tctccgctgcgggcacaaatcgcgacgtcggc----	Protospacer
**********..***********    *** .

112. spacer 5.3|550464|32|NZ_CP046801|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050109 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence) position: , mismatch: 8, identity: 0.75 

tctccgctgcaagcacaaatcgc----tcgctttta	CRISPR spacer
tctccgctgcgggcacaaatcgcgacgtcggc----	Protospacer
**********..***********    *** .

113. spacer 5.7|550704|32|NZ_CP046801|CRISPRCasFinder,CRT,PILER-CR matches to AP014349 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S38-C79, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.75 

ttttaaagatttctttgtttatttgggcgcgt	CRISPR spacer
gttcttcgatttctttgtctttttgggcgctt	Protospacer
 **.   ***********.* ********* *

114. spacer 6.1|554488|32|NZ_CP046801|PILER-CR,CRISPRCasFinder matches to NZ_CP015507 (Bacillus oceanisediminis 2691 plasmid pBO1, complete sequence) position: , mismatch: 8, identity: 0.75 

aggagatatgacaaatggctcaaactacatcg	CRISPR spacer
ctgagatagaacaaatggctcaaactataatt	Protospacer
  ****** .*****************.* .

115. spacer 7.3|562938|32|NZ_CP046801|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050104 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence) position: , mismatch: 8, identity: 0.75 

tctccgctgcaagcacaaatcgc----tcgctttta	CRISPR spacer
tctccgctgcgggcacaaatcgcgacgtcggc----	Protospacer
**********..***********    *** .

116. spacer 7.3|562938|32|NZ_CP046801|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025507 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence) position: , mismatch: 8, identity: 0.75 

tctccgctgcaagcacaaatcgc----tcgctttta	CRISPR spacer
tctccgctgcgggcacaaatcgcgacgtcggc----	Protospacer
**********..***********    *** .

117. spacer 7.3|562938|32|NZ_CP046801|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050109 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence) position: , mismatch: 8, identity: 0.75 

tctccgctgcaagcacaaatcgc----tcgctttta	CRISPR spacer
tctccgctgcgggcacaaatcgcgacgtcggc----	Protospacer
**********..***********    *** .

118. spacer 7.7|563178|32|NZ_CP046801|CRISPRCasFinder,CRT,PILER-CR matches to AP014349 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S38-C79, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.75 

ttttaaagatttctttgtttatttgggcgcgt	CRISPR spacer
gttcttcgatttctttgtctttttgggcgctt	Protospacer
 **.   ***********.* ********* *

119. spacer 8.1|566962|32|NZ_CP046801|PILER-CR,CRISPRCasFinder matches to NZ_CP015507 (Bacillus oceanisediminis 2691 plasmid pBO1, complete sequence) position: , mismatch: 8, identity: 0.75 

aggagatatgacaaatggctcaaactacatcg	CRISPR spacer
ctgagatagaacaaatggctcaaactataatt	Protospacer
  ****** .*****************.* .

120. spacer 2.4|387680|34|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT matches to HQ316603 (Cyanophage S-SSM6b genomic sequence) position: , mismatch: 9, identity: 0.735 

tctcagtaactaactcaacagtaaagtttttacc	CRISPR spacer
cactgctagttaaatcaacagtaaagtttttacc	Protospacer
. ... **..*** ********************

121. spacer 2.4|387680|34|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT matches to NC_020875 (Cyanophage S-SSM4 genomic sequence) position: , mismatch: 9, identity: 0.735 

tctcagtaactaactcaacagtaaagtttttacc	CRISPR spacer
cactgctagttaaatcaacagtaaagtttttacc	Protospacer
. ... **..*** ********************

122. spacer 3.1|469409|32|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014886 (Lactobacillus backii strain TMW 1.1991 plasmid pL11991-5, complete sequence) position: , mismatch: 9, identity: 0.719 

aaccgggttttattatcagttgagttccacaa	CRISPR spacer
gaatctgttttcttatcagatgagttccatga	Protospacer
.* .  ***** ******* *********..*

123. spacer 3.4|469590|32|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT matches to CP019195 (Salmonella enterica subsp. enterica serovar Senftenberg str. ATCC 43845 plasmid pATCC43845, complete sequence) position: , mismatch: 9, identity: 0.719 

tttggacacatagagagctttgtgctcgtctt	CRISPR spacer
aaagtgaacatagagtgctttgtgctcatctg	Protospacer
   * . ******** ***********.***

124. spacer 3.4|469590|32|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010179 (Escherichia coli strain H15 plasmid A, complete genome) position: , mismatch: 9, identity: 0.719 

tttggacacatagagagctttgtgctcgtctt	CRISPR spacer
aaagtgaacatagagtgctttgtgctcatctg	Protospacer
   * . ******** ***********.***

125. spacer 3.4|469590|32|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014124 (Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed2) position: , mismatch: 9, identity: 0.719 

tttggacacatagagagctttgtgctcgtctt	CRISPR spacer
aaagtgaacatagagtgctttgtgctcatctg	Protospacer
   * . ******** ***********.***

126. spacer 3.4|469590|32|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031581 (Klebsiella pneumoniae strain N4b plasmid pIncFIA-1502320, complete sequence) position: , mismatch: 9, identity: 0.719 

tttggacacatagagagctttgtgctcgtctt	CRISPR spacer
aaagtgaacatagagtgctttgtgctcatctg	Protospacer
   * . ******** ***********.***

127. spacer 3.4|469590|32|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP019691 (Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-4, complete sequence) position: , mismatch: 9, identity: 0.719 

tttggacacatagagagctttgtgctcgtctt	CRISPR spacer
aaagtgaacatagagtgctttgtgctcatctg	Protospacer
   * . ******** ***********.***

128. spacer 3.4|469590|32|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030068 (Klebsiella pneumoniae strain IA565 plasmid pDA11912.3, complete sequence) position: , mismatch: 9, identity: 0.719 

tttggacacatagagagctttgtgctcgtctt	CRISPR spacer
aaagtgaacatagagtgctttgtgctcatctg	Protospacer
   * . ******** ***********.***

129. spacer 3.4|469590|32|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028551 (Klebsiella variicola strain WCHKP19 plasmid p3_020019, complete sequence) position: , mismatch: 9, identity: 0.719 

tttggacacatagagagctttgtgctcgtctt	CRISPR spacer
aaagtgaacatagagtgctttgtgctcatctg	Protospacer
   * . ******** ***********.***

130. spacer 3.4|469590|32|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT matches to MN256758 (Escherichia coli strain 4M8F plasmid p4M8F, complete sequence) position: , mismatch: 9, identity: 0.719 

tttggacacatagagagctttgtgctcgtctt	CRISPR spacer
aaagtgaacatagagtgctttgtgctcatctg	Protospacer
   * . ******** ***********.***

131. spacer 3.4|469590|32|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010154 (Escherichia coli strain D9 plasmid B, complete genome) position: , mismatch: 9, identity: 0.719 

tttggacacatagagagctttgtgctcgtctt	CRISPR spacer
aaagtgaacatagagtgctttgtgctcatctg	Protospacer
   * . ******** ***********.***

132. spacer 3.4|469590|32|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026578 (Escherichia coli strain WCHEC005237 plasmid pQnrS1_005237, complete sequence) position: , mismatch: 9, identity: 0.719 

tttggacacatagagagctttgtgctcgtctt	CRISPR spacer
aaagtgaacatagagtgctttgtgctcatctg	Protospacer
   * . ******** ***********.***

133. spacer 3.4|469590|32|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047574 (Escherichia coli strain 2EC1 plasmid p2EC1-3, complete sequence) position: , mismatch: 9, identity: 0.719 

tttggacacatagagagctttgtgctcgtctt	CRISPR spacer
aaagtgaacatagagtgctttgtgctcatctg	Protospacer
   * . ******** ***********.***

134. spacer 3.4|469590|32|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT matches to MN256757 (Escherichia coli strain 4M18F plasmid p4M18F, complete sequence) position: , mismatch: 9, identity: 0.719 

tttggacacatagagagctttgtgctcgtctt	CRISPR spacer
aaagtgaacatagagtgctttgtgctcatctg	Protospacer
   * . ******** ***********.***

135. spacer 3.4|469590|32|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY887595 (Escherichia coli strain Ec78 plasmid pEc78, complete sequence) position: , mismatch: 9, identity: 0.719 

tttggacacatagagagctttgtgctcgtctt	CRISPR spacer
aaagtgaacatagagtgctttgtgctcatctg	Protospacer
   * . ******** ***********.***

136. spacer 3.4|469590|32|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016838 (Salmonella enterica subsp. enterica serovar Senftenberg strain 775W (ATCC 43845) plasmid pSSE-ATCC-43845, complete sequence) position: , mismatch: 9, identity: 0.719 

tttggacacatagagagctttgtgctcgtctt	CRISPR spacer
aaagtgaacatagagtgctttgtgctcatctg	Protospacer
   * . ******** ***********.***

137. spacer 5.4|550524|32|NZ_CP046801|CRISPRCasFinder,CRT,PILER-CR matches to MN698242 (Pelagibacter phage HTVC103P, complete genome) position: , mismatch: 9, identity: 0.719 

accatcccggtaaatttgctgcaattgattca	CRISPR spacer
cagatagtagtaaagttgatgcaattgattca	Protospacer
   **  ..***** *** *************

138. spacer 5.5|550584|32|NZ_CP046801|CRISPRCasFinder,CRT,PILER-CR matches to KP282673 (Acidianus bottle-shaped virus 2 strain ABV2, complete genome) position: , mismatch: 9, identity: 0.719 

atgcaagtagagtaattaaatcaattggcgta	CRISPR spacer
ttgcaagtaaagtaattagatcaaaagttttt	Protospacer
 ********.********.*****  * . *

139. spacer 5.7|550704|32|NZ_CP046801|CRISPRCasFinder,CRT,PILER-CR matches to CP053317 (Salmonella enterica subsp. salamae serovar 6,8:a:z52 strain 62-3163 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

ttttaaagatttctttgtttatttgggcgcgt	CRISPR spacer
gtttaaagatttcttggttttttttgacataa	Protospacer
 ************** **** *** *.*...

140. spacer 7.4|562998|32|NZ_CP046801|CRISPRCasFinder,CRT,PILER-CR matches to MN698242 (Pelagibacter phage HTVC103P, complete genome) position: , mismatch: 9, identity: 0.719 

accatcccggtaaatttgctgcaattgattca	CRISPR spacer
cagatagtagtaaagttgatgcaattgattca	Protospacer
   **  ..***** *** *************

141. spacer 7.5|563058|32|NZ_CP046801|CRISPRCasFinder,CRT,PILER-CR matches to KP282673 (Acidianus bottle-shaped virus 2 strain ABV2, complete genome) position: , mismatch: 9, identity: 0.719 

atgcaagtagagtaattaaatcaattggcgta	CRISPR spacer
ttgcaagtaaagtaattagatcaaaagttttt	Protospacer
 ********.********.*****  * . *

142. spacer 7.7|563178|32|NZ_CP046801|CRISPRCasFinder,CRT,PILER-CR matches to CP053317 (Salmonella enterica subsp. salamae serovar 6,8:a:z52 strain 62-3163 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

ttttaaagatttctttgtttatttgggcgcgt	CRISPR spacer
gtttaaagatttcttggttttttttgacataa	Protospacer
 ************** **** *** *.*...

143. spacer 2.11|388140|34|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039048 (Piscirickettsia salmonis strain Psal-073 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.706 

tcccgacgcgattaaaaagcttaaatctaaatta	CRISPR spacer
taaaaaaattattaaacagtttaaatctaaatta	Protospacer
*   .* .. ****** **.**************

144. spacer 4.2|481212|32|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT matches to NC_014023 (Bacillus megaterium QM B1551 plasmid pBM700, complete sequence) position: , mismatch: 10, identity: 0.688 

ctgctatgtttaaatcatcaaaagagtgagca	CRISPR spacer
aaactatgtttaaagcataaaaagagctctaa	Protospacer
  .*********** *** *******.    *

145. spacer 4.2|481212|32|NZ_CP046801|PILER-CR,CRISPRCasFinder,CRT matches to AP014323 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S33-C38, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 10, identity: 0.688 

ctgctatgtttaaatcatcaaaagagtgagca	CRISPR spacer
aagctctttttaaatcatcaaaagaccagtga	Protospacer
  *** * ***************** ...  *

146. spacer 5.7|550704|32|NZ_CP046801|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP047125 (Lactobacillus hilgardii strain FLUB plasmid unnamed4) position: , mismatch: 10, identity: 0.688 

ttttaaagatttctttgtttatttgggcgcgt	CRISPR spacer
ttttaaagacttctttctttatttttttaacc	Protospacer
*********.****** *******   ..  .

147. spacer 5.7|550704|32|NZ_CP046801|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030282 (Escherichia coli strain E308 plasmid pLKSZ01, complete sequence) position: , mismatch: 10, identity: 0.688 

ttttaaagatttctttgtttatttgggcgcgt	CRISPR spacer
cattaaagatttctttgcttctttgccagaaa	Protospacer
. ***************.** ****   * .

148. spacer 5.7|550704|32|NZ_CP046801|CRISPRCasFinder,CRT,PILER-CR matches to AP013554 (Uncultured Mediterranean phage uvMED isolate uvMED-CGR-C28-MedDCM-OCT-S23-C36, *** SEQUENCING IN PROGRESS ***, 7 ordered pieces) position: , mismatch: 10, identity: 0.688 

ttttaaagatttctttgtttatttgggcgcgt	CRISPR spacer
ctttaaatatttctttgtatattttttttatt	Protospacer
.****** ********** *****   .   *

149. spacer 5.9|550824|32|NZ_CP046801|CRISPRCasFinder,CRT,PILER-CR matches to KY798216 (Mycobacterium phage Journey13, complete genome) position: , mismatch: 10, identity: 0.688 

tcgacgtacgacttaaactcgttttcactaaa	CRISPR spacer
tcgacgtacgactcaaactccttcacgtcggc	Protospacer
*************.****** **. *.....

150. spacer 7.7|563178|32|NZ_CP046801|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP047125 (Lactobacillus hilgardii strain FLUB plasmid unnamed4) position: , mismatch: 10, identity: 0.688 

ttttaaagatttctttgtttatttgggcgcgt	CRISPR spacer
ttttaaagacttctttctttatttttttaacc	Protospacer
*********.****** *******   ..  .

151. spacer 7.7|563178|32|NZ_CP046801|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030282 (Escherichia coli strain E308 plasmid pLKSZ01, complete sequence) position: , mismatch: 10, identity: 0.688 

ttttaaagatttctttgtttatttgggcgcgt	CRISPR spacer
cattaaagatttctttgcttctttgccagaaa	Protospacer
. ***************.** ****   * .

152. spacer 7.7|563178|32|NZ_CP046801|CRISPRCasFinder,CRT,PILER-CR matches to AP013554 (Uncultured Mediterranean phage uvMED isolate uvMED-CGR-C28-MedDCM-OCT-S23-C36, *** SEQUENCING IN PROGRESS ***, 7 ordered pieces) position: , mismatch: 10, identity: 0.688 

ttttaaagatttctttgtttatttgggcgcgt	CRISPR spacer
ctttaaatatttctttgtatattttttttatt	Protospacer
.****** ********** *****   .   *

153. spacer 7.9|563298|32|NZ_CP046801|CRISPRCasFinder,CRT,PILER-CR matches to KY798216 (Mycobacterium phage Journey13, complete genome) position: , mismatch: 10, identity: 0.688 

tcgacgtacgacttaaactcgttttcactaaa	CRISPR spacer
tcgacgtacgactcaaactccttcacgtcggc	Protospacer
*************.****** **. *.....

154. spacer 5.1|550344|32|NZ_CP046801|CRISPRCasFinder,CRT matches to NC_047756 (Caulobacter phage Sansa, complete genome) position: , mismatch: 11, identity: 0.656 

gtataaaccaggctcttgcgggcctgggtaat	CRISPR spacer
cggacggccaggctctttccggcctgggtaga	Protospacer
  .  ..********** * **********.

155. spacer 7.1|562818|32|NZ_CP046801|CRISPRCasFinder,CRT matches to NC_047756 (Caulobacter phage Sansa, complete genome) position: , mismatch: 11, identity: 0.656 

gtataaaccaggctcttgcgggcctgggtaat	CRISPR spacer
cggacggccaggctctttccggcctgggtaga	Protospacer
  .  ..********** * **********.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 455369 : 486304 32 Pseudomonas_phage(50.0%) transposase NA
DBSCAN-SWA_2 507350 : 552183 50 Shigella_phage(33.33%) integrase,transposase attL 501957:501972|attR 546187:546202

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP046802
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP046802_1 564863-565078 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP046802_2 1936714-1938182 TypeI-F I-F
24 spacers
cas6f,cas7f,cas5f,cas8f,cas3-cas2,cas1

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP046802_1 1.1|564909|39|NZ_CP046802|PILER-CR 564909-564947 39 NZ_CP046802.1 704297-704335 0 1.0

1. spacer 1.1|564909|39|NZ_CP046802|PILER-CR matches to position: 704297-704335, mismatch: 0, identity: 1.0 

agtaggtcaccagttcgattccggtagtcggcaccattt	CRISPR spacer
agtaggtcaccagttcgattccggtagtcggcaccattt	Protospacer
***************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP046802_2 2.23|1938063|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT 1938063-1938094 32 NC_010113 Vibrio sp. 0908 plasmid p0908, complete sequence 79202-79233 0 1.0
NZ_CP046802_2 2.23|1938063|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT 1938063-1938094 32 NZ_CP046830 Vibrio parahaemolyticus strain 2012AW-0224 plasmid unnamed1, complete sequence 26681-26712 0 1.0
NZ_CP046802_1 1.1|564909|39|NZ_CP046802|PILER-CR 564909-564947 39 NZ_CP022660 Salmonella enterica subsp. enterica strain RM11060 plasmid pRM11060-2, complete sequence 52078-52116 1 0.974
NZ_CP046802_1 1.1|564909|39|NZ_CP046802|PILER-CR 564909-564947 39 NZ_CP045061 Salmonella enterica subsp. enterica serovar Muenchen strain LG26 plasmid pLG26p2, complete sequence 52084-52122 1 0.974
NZ_CP046802_1 1.1|564909|39|NZ_CP046802|PILER-CR 564909-564947 39 NZ_CP045054 Salmonella enterica subsp. enterica serovar Muenchen strain LG24 plasmid pLG24p2, complete sequence 52089-52127 1 0.974
NZ_CP046802_1 1.1|564909|39|NZ_CP046802|PILER-CR 564909-564947 39 NZ_CP045058 Salmonella enterica subsp. enterica serovar Muenchen strain LG25 plasmid pLG25p2, complete sequence 52088-52126 1 0.974
NZ_CP046802_1 1.1|564909|39|NZ_CP046802|PILER-CR 564909-564947 39 LN997803 Escherichia coli phage phi467 15126-15164 1 0.974
NZ_CP046802_1 1.1|564909|39|NZ_CP046802|PILER-CR 564909-564947 39 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 296497-296535 1 0.974
NZ_CP046802_1 1.1|564909|39|NZ_CP046802|PILER-CR 564909-564947 39 KU052038 Escherichia phage SerU-LTIIb, partial genome 1162-1200 1 0.974
NZ_CP046802_1 1.1|564909|39|NZ_CP046802|PILER-CR 564909-564947 39 KU052038 Escherichia phage SerU-LTIIb, partial genome 3068-3106 1 0.974
NZ_CP046802_1 1.1|564909|39|NZ_CP046802|PILER-CR 564909-564947 39 NZ_LN868946 Salmonella enterica subsp. enterica serovar Senftenberg strain NCTC10384 plasmid 4, complete sequence 103819-103857 2 0.949
NZ_CP046802_1 1.1|564909|39|NZ_CP046802|PILER-CR 564909-564947 39 NZ_CP054057 Scandinavium goeteborgense strain CCUG 66741 plasmid pSg66741_1, complete sequence 85817-85855 2 0.949
NZ_CP046802_1 1.1|564909|39|NZ_CP046802|PILER-CR 564909-564947 39 NZ_CP023526 Cedecea neteri strain FDAARGOS_392 plasmid unnamed, complete sequence 1925-1963 3 0.923
NZ_CP046802_1 1.1|564909|39|NZ_CP046802|PILER-CR 564909-564947 39 NC_021742 Serratia liquefaciens ATCC 27592 plasmid unnamed, complete sequence 35428-35466 3 0.923
NZ_CP046802_1 1.1|564909|39|NZ_CP046802|PILER-CR 564909-564947 39 MH791411 UNVERIFIED: Escherichia phage Ecwhy_1, complete genome 13645-13683 3 0.923
NZ_CP046802_1 1.1|564909|39|NZ_CP046802|PILER-CR 564909-564947 39 MH494197 Escherichia phage CMSTMSU, complete genome 196772-196810 3 0.923
NZ_CP046802_1 1.1|564909|39|NZ_CP046802|PILER-CR 564909-564947 39 KY653118 Morganella phage IME1369_01, complete genome 698-736 3 0.923
NZ_CP046802_2 2.2|1936802|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT 1936802-1936833 32 NZ_CP043555 Vibrio cholerae strain RFB16 plasmid unnamed, complete sequence 47662-47693 4 0.875
NZ_CP046802_1 1.1|564909|39|NZ_CP046802|PILER-CR 564909-564947 39 NC_049942 Escherichia phage JLK-2012, complete sequence 23522-23560 5 0.872
NZ_CP046802_1 1.1|564909|39|NZ_CP046802|PILER-CR 564909-564947 39 NC_027364 Escherichia phage PBECO 4, complete genome 207832-207870 6 0.846
NZ_CP046802_1 1.1|564909|39|NZ_CP046802|PILER-CR 564909-564947 39 LC494302 Escherichia phage SP27 DNA, complete genome 76609-76647 6 0.846
NZ_CP046802_1 1.1|564909|39|NZ_CP046802|PILER-CR 564909-564947 39 LT603033 Escherichia phage vB_Eco_slurp01 genome assembly, chromosome: I 17115-17153 6 0.846
NZ_CP046802_2 2.2|1936802|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT 1936802-1936833 32 NZ_CP043555 Vibrio cholerae strain RFB16 plasmid unnamed, complete sequence 794-825 6 0.812
NZ_CP046802_2 2.24|1938123|32|NZ_CP046802|CRISPRCasFinder,CRT 1938123-1938154 32 MH338234 Mycobacterium phage Crucio, complete genome 5846-5877 6 0.812
NZ_CP046802_2 2.24|1938123|32|NZ_CP046802|CRISPRCasFinder,CRT 1938123-1938154 32 MH697591 Mycobacterium phage QueenBeesly, complete genome 5846-5877 6 0.812
NZ_CP046802_2 2.24|1938123|32|NZ_CP046802|CRISPRCasFinder,CRT 1938123-1938154 32 MT498060 Mycobacterium Phage FiringLine, complete genome 5846-5877 6 0.812
NZ_CP046802_2 2.24|1938123|32|NZ_CP046802|CRISPRCasFinder,CRT 1938123-1938154 32 KM463009 Mycobacterium phage Power, complete genome 5846-5877 6 0.812
NZ_CP046802_2 2.24|1938123|32|NZ_CP046802|CRISPRCasFinder,CRT 1938123-1938154 32 MT498066 Mycobacterium phage Georgie2, complete genome 5847-5878 6 0.812
NZ_CP046802_2 2.24|1938123|32|NZ_CP046802|CRISPRCasFinder,CRT 1938123-1938154 32 MN234203 Mycobacterium phage SemperFi, complete genome 6274-6305 6 0.812
NZ_CP046802_2 2.24|1938123|32|NZ_CP046802|CRISPRCasFinder,CRT 1938123-1938154 32 MF919531 Mycobacterium phage SnapTap, complete genome 5846-5877 6 0.812
NZ_CP046802_2 2.24|1938123|32|NZ_CP046802|CRISPRCasFinder,CRT 1938123-1938154 32 NC_029043 Mycobacterium phage SweetiePie, complete genome 5846-5877 6 0.812
NZ_CP046802_1 1.1|564909|39|NZ_CP046802|PILER-CR 564909-564947 39 MK817115 Escherichia phage vB_EcoM_phAPEC6, complete genome 52945-52983 7 0.821
NZ_CP046802_1 1.1|564909|39|NZ_CP046802|PILER-CR 564909-564947 39 MH383160 Escherichia phage UB, complete genome 272124-272162 7 0.821
NZ_CP046802_1 1.1|564909|39|NZ_CP046802|PILER-CR 564909-564947 39 MK327931 Escherichia phage vB_EcoM_G17, complete genome 77929-77967 7 0.821
NZ_CP046802_2 2.8|1937162|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT 1937162-1937193 32 KU234533 Nostoc phage A1, complete genome 67857-67888 7 0.781
NZ_CP046802_2 2.24|1938123|32|NZ_CP046802|CRISPRCasFinder,CRT 1938123-1938154 32 NZ_HG938356 Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence 986087-986118 7 0.781
NZ_CP046802_1 1.1|564909|39|NZ_CP046802|PILER-CR 564909-564947 39 KM507819 Escherichia phage 121Q, complete genome 77936-77974 8 0.795
NZ_CP046802_2 2.16|1937643|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT 1937643-1937674 32 KP010268 Enterobacteria phage SfMu, complete genome 15693-15724 8 0.75
NZ_CP046802_2 2.24|1938123|32|NZ_CP046802|CRISPRCasFinder,CRT 1938123-1938154 32 NZ_CP031193 Humibacter sp. BT305 plasmid unnamed1 94005-94036 8 0.75
NZ_CP046802_2 2.1|1936742|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT 1936742-1936773 32 KU737345 Bacillus phage Juglone, complete genome 22607-22638 9 0.719
NZ_CP046802_2 2.1|1936742|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT 1936742-1936773 32 MN038178 Bacillus phage Beyonphe, complete genome 22733-22764 9 0.719
NZ_CP046802_2 2.1|1936742|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT 1936742-1936773 32 KJ489402 Bacillus phage Riley, complete genome 21198-21229 9 0.719
NZ_CP046802_2 2.1|1936742|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT 1936742-1936773 32 NC_031100 Bacillus phage Phrodo, complete genome 22360-22391 9 0.719
NZ_CP046802_2 2.1|1936742|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT 1936742-1936773 32 KF669647 Bacillus phage BigBertha, complete genome 23576-23607 9 0.719
NZ_CP046802_2 2.1|1936742|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT 1936742-1936773 32 KF669662 Bacillus phage Spock, complete genome 24156-24187 9 0.719
NZ_CP046802_2 2.1|1936742|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT 1936742-1936773 32 MF765814 Bacillus phage Taffo16, complete genome 22682-22713 9 0.719
NZ_CP046802_2 2.1|1936742|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT 1936742-1936773 32 NC_028887 Bacillus phage AvesoBmore, complete genome 22817-22848 9 0.719
NZ_CP046802_2 2.1|1936742|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT 1936742-1936773 32 NC_022088 Bacillus phage Troll, complete genome 23534-23565 9 0.719
NZ_CP046802_2 2.1|1936742|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT 1936742-1936773 32 KT995479 Bacillus phage BM5, complete genome 105182-105213 9 0.719
NZ_CP046802_2 2.1|1936742|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT 1936742-1936773 32 JN797796 Bacillus phage B5S, complete genome 4347-4378 9 0.719
NZ_CP046802_2 2.1|1936742|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT 1936742-1936773 32 NC_018863 Bacillus phage B4, complete genome 4293-4324 9 0.719
NZ_CP046802_2 2.1|1936742|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT 1936742-1936773 32 KY888882 Bacillus phage Flapjack, complete genome 24428-24459 9 0.719
NZ_CP046802_2 2.10|1937282|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT 1937282-1937313 32 NZ_CP024238 Escherichia coli O15:H11 strain 90-9272 plasmid unnamed 167086-167117 9 0.719
NZ_CP046802_2 2.10|1937282|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT 1937282-1937313 32 NC_013507 Escherichia coli ETEC H10407 plasmid pEntH10407, complete sequence 39023-39054 9 0.719
NZ_CP046802_2 2.10|1937282|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT 1937282-1937313 32 NZ_CP024249 Escherichia coli O182:H21 strain D181 plasmid unnamed1, complete sequence 6880-6911 9 0.719
NZ_CP046802_2 2.10|1937282|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT 1937282-1937313 32 NC_017722 Escherichia coli ETEC H10407 plasmid p666, complete sequence 65951-65982 9 0.719
NZ_CP046802_2 2.14|1937522|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT 1937522-1937553 32 MT521994 Gordonia phage Magel, complete genome 3704-3735 9 0.719
NZ_CP046802_2 2.14|1937522|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT 1937522-1937553 32 MN585988 Gordonia Phage Odesza, complete genome 3704-3735 9 0.719
NZ_CP046802_2 2.14|1937522|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT 1937522-1937553 32 NC_048817 Gordonia phage Tanis, complete genome 3554-3585 9 0.719
NZ_CP046802_2 2.24|1938123|32|NZ_CP046802|CRISPRCasFinder,CRT 1938123-1938154 32 NZ_CP050096 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b3, complete sequence 103342-103373 9 0.719
NZ_CP046802_2 2.24|1938123|32|NZ_CP046802|CRISPRCasFinder,CRT 1938123-1938154 32 NZ_CP033227 Sphingobium yanoikuyae strain SJTF8 plasmid pF1, complete sequence 476815-476846 9 0.719
NZ_CP046802_2 2.2|1936802|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT 1936802-1936833 32 NZ_CP018322 Alteromonas macleodii strain Te101 plasmid pTE101a, complete sequence 1940-1971 10 0.688
NZ_CP046802_2 2.5|1936982|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT 1936982-1937013 32 MK765602 Tortoise microvirus 50 isolate 50_SP_154, complete genome 3547-3578 10 0.688
NZ_CP046802_2 2.8|1937162|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT 1937162-1937193 32 NZ_CP013941 Cronobacter malonaticus LMG 23826 plasmid pCMA1, complete sequence 29231-29262 10 0.688
NZ_CP046802_2 2.8|1937162|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT 1937162-1937193 32 NC_023024 Cronobacter malonaticus plasmid p1, complete sequence 23875-23906 10 0.688
NZ_CP046802_2 2.8|1937162|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT 1937162-1937193 32 MG945578 UNVERIFIED: Microviridae sp. isolate 3606-1801, complete genome 4255-4286 10 0.688
NZ_CP046802_2 2.10|1937282|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT 1937282-1937313 32 AY212251 Streptococcus virus C1, complete genome 10386-10417 10 0.688
NZ_CP046802_2 2.10|1937282|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT 1937282-1937313 32 NC_004814 Streptococcus phage C1, complete genome 10386-10417 10 0.688
NZ_CP046802_2 2.16|1937643|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT 1937643-1937674 32 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 893528-893559 10 0.688
NZ_CP046802_2 2.24|1938123|32|NZ_CP046802|CRISPRCasFinder,CRT 1938123-1938154 32 NZ_CP020040 Streptomyces sp. 3211 isolate 3 plasmid p3211-1, complete sequence 489892-489923 10 0.688
NZ_CP046802_2 2.2|1936802|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT 1936802-1936833 32 NC_009927 Acaryochloris marina MBIC11017 plasmid pREB2, complete sequence 320495-320526 11 0.656

1. spacer 2.23|1938063|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT matches to NC_010113 (Vibrio sp. 0908 plasmid p0908, complete sequence) position: , mismatch: 0, identity: 1.0 

ttgcggcccacgcgccccttgatgaatgacag	CRISPR spacer
ttgcggcccacgcgccccttgatgaatgacag	Protospacer
********************************

2. spacer 2.23|1938063|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046830 (Vibrio parahaemolyticus strain 2012AW-0224 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0 

ttgcggcccacgcgccccttgatgaatgacag	CRISPR spacer
ttgcggcccacgcgccccttgatgaatgacag	Protospacer
********************************

3. spacer 1.1|564909|39|NZ_CP046802|PILER-CR matches to NZ_CP022660 (Salmonella enterica subsp. enterica strain RM11060 plasmid pRM11060-2, complete sequence) position: , mismatch: 1, identity: 0.974 

agtaggtcaccagttcgattccggtagtcggcaccattt	CRISPR spacer
agtaggtcaccagttcgattccggtagtcggcaccactt	Protospacer
************************************.**

4. spacer 1.1|564909|39|NZ_CP046802|PILER-CR matches to NZ_CP045061 (Salmonella enterica subsp. enterica serovar Muenchen strain LG26 plasmid pLG26p2, complete sequence) position: , mismatch: 1, identity: 0.974 

agtaggtcaccagttcgattccggtagtcggcaccattt	CRISPR spacer
agtaggtcaccagttcgattccggtagtcggcaccactt	Protospacer
************************************.**

5. spacer 1.1|564909|39|NZ_CP046802|PILER-CR matches to NZ_CP045054 (Salmonella enterica subsp. enterica serovar Muenchen strain LG24 plasmid pLG24p2, complete sequence) position: , mismatch: 1, identity: 0.974 

agtaggtcaccagttcgattccggtagtcggcaccattt	CRISPR spacer
agtaggtcaccagttcgattccggtagtcggcaccactt	Protospacer
************************************.**

6. spacer 1.1|564909|39|NZ_CP046802|PILER-CR matches to NZ_CP045058 (Salmonella enterica subsp. enterica serovar Muenchen strain LG25 plasmid pLG25p2, complete sequence) position: , mismatch: 1, identity: 0.974 

agtaggtcaccagttcgattccggtagtcggcaccattt	CRISPR spacer
agtaggtcaccagttcgattccggtagtcggcaccactt	Protospacer
************************************.**

7. spacer 1.1|564909|39|NZ_CP046802|PILER-CR matches to LN997803 (Escherichia coli phage phi467) position: , mismatch: 1, identity: 0.974 

agtaggtcaccagttcgattccggtagtcggcaccattt	CRISPR spacer
agtaggtcaccagttcgattccggtagtcggcaccatat	Protospacer
************************************* *

8. spacer 1.1|564909|39|NZ_CP046802|PILER-CR matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 1, identity: 0.974 

agtaggtcaccagttcgattccggtagtcggcaccattt	CRISPR spacer
agtaggtcaccagttcgattccggtagtcggcaccatat	Protospacer
************************************* *

9. spacer 1.1|564909|39|NZ_CP046802|PILER-CR matches to KU052038 (Escherichia phage SerU-LTIIb, partial genome) position: , mismatch: 1, identity: 0.974 

agtaggtcaccagttcgattccggtagtcggcaccattt	CRISPR spacer
agtaggtcaccagttcgattccggtagtcggcaccatat	Protospacer
************************************* *

10. spacer 1.1|564909|39|NZ_CP046802|PILER-CR matches to KU052038 (Escherichia phage SerU-LTIIb, partial genome) position: , mismatch: 1, identity: 0.974 

agtaggtcaccagttcgattccggtagtcggcaccattt	CRISPR spacer
agtaggtcaccagttcgattccggtagtcggcaccatat	Protospacer
************************************* *

11. spacer 1.1|564909|39|NZ_CP046802|PILER-CR matches to NZ_LN868946 (Salmonella enterica subsp. enterica serovar Senftenberg strain NCTC10384 plasmid 4, complete sequence) position: , mismatch: 2, identity: 0.949 

agtaggtcaccagttcgattccggtagtcggcaccattt	CRISPR spacer
agtaggtcaccagttcgattccggtagtcggcaccatca	Protospacer
*************************************.

12. spacer 1.1|564909|39|NZ_CP046802|PILER-CR matches to NZ_CP054057 (Scandinavium goeteborgense strain CCUG 66741 plasmid pSg66741_1, complete sequence) position: , mismatch: 2, identity: 0.949 

agtaggtcaccagttcgattccggtagtcggcaccattt	CRISPR spacer
agtaggtcaccagttcgattccggtagtcggcaccaaat	Protospacer
************************************  *

13. spacer 1.1|564909|39|NZ_CP046802|PILER-CR matches to NZ_CP023526 (Cedecea neteri strain FDAARGOS_392 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.923 

agtaggtcaccagttcgattccggtagtcggcaccattt	CRISPR spacer
agtaggtcaccagttcgattccggtagtcggcaccagaa	Protospacer
************************************

14. spacer 1.1|564909|39|NZ_CP046802|PILER-CR matches to NC_021742 (Serratia liquefaciens ATCC 27592 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.923 

agtaggtcaccagttcgattccggtagtcggcaccattt	CRISPR spacer
agtaggtcaccagttcgattccggtagccggcaccaatc	Protospacer
***************************.******** *.

15. spacer 1.1|564909|39|NZ_CP046802|PILER-CR matches to MH791411 (UNVERIFIED: Escherichia phage Ecwhy_1, complete genome) position: , mismatch: 3, identity: 0.923 

agtaggtcaccagttcgattccggtagtcggcaccattt	CRISPR spacer
agtaggtcaccagttcgattccggtagtcggcacaaatc	Protospacer
********************************** * *.

16. spacer 1.1|564909|39|NZ_CP046802|PILER-CR matches to MH494197 (Escherichia phage CMSTMSU, complete genome) position: , mismatch: 3, identity: 0.923 

agtaggtcaccagttcgattccggtagtcggcaccattt	CRISPR spacer
agtaggtcaccagttcgattccggtagtcggcacaaatc	Protospacer
********************************** * *.

17. spacer 1.1|564909|39|NZ_CP046802|PILER-CR matches to KY653118 (Morganella phage IME1369_01, complete genome) position: , mismatch: 3, identity: 0.923 

agtaggtcaccagttcgattccggtagtcggcaccattt	CRISPR spacer
agtaggtcaccagttcgactccggtagccggcaccatat	Protospacer
******************.********.********* *

18. spacer 2.2|1936802|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP043555 (Vibrio cholerae strain RFB16 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.875 

agtcggtgcacctctacctaaaggggttatat	CRISPR spacer
agtcggtgcacctctacctaatgggggtttct	Protospacer
********************* **** * * *

19. spacer 1.1|564909|39|NZ_CP046802|PILER-CR matches to NC_049942 (Escherichia phage JLK-2012, complete sequence) position: , mismatch: 5, identity: 0.872 

agtaggtcaccagttcgattccggtagtcggcaccattt	CRISPR spacer
atcaggtcgccagttcgattccggtagccggcaccatat	Protospacer
* .*****.******************.********* *

20. spacer 1.1|564909|39|NZ_CP046802|PILER-CR matches to NC_027364 (Escherichia phage PBECO 4, complete genome) position: , mismatch: 6, identity: 0.846 

agtaggtcaccagttcgattccggtagtcggcaccattt	CRISPR spacer
gaaaggtcaccagttcgattccggtagtcggcacaaaat	Protospacer
.. ******************************* *  *

21. spacer 1.1|564909|39|NZ_CP046802|PILER-CR matches to LC494302 (Escherichia phage SP27 DNA, complete genome) position: , mismatch: 6, identity: 0.846 

agtaggtcaccagttcgattccggtagtcggcaccattt	CRISPR spacer
gaaaggtcaccagttcgattccggtagtcggcacaaaat	Protospacer
.. ******************************* *  *

22. spacer 1.1|564909|39|NZ_CP046802|PILER-CR matches to LT603033 (Escherichia phage vB_Eco_slurp01 genome assembly, chromosome: I) position: , mismatch: 6, identity: 0.846 

agtaggtcaccagttcgattccggtagtcggcaccattt	CRISPR spacer
gaaaggtcaccagttcgattccggtagtcggcacaaaat	Protospacer
.. ******************************* *  *

23. spacer 2.2|1936802|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP043555 (Vibrio cholerae strain RFB16 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812 

agtcggtgcacctctacctaaaggggttatat	CRISPR spacer
cggtggtgcacctctacctaatggggttgaat	Protospacer
 * .***************** ******. **

24. spacer 2.24|1938123|32|NZ_CP046802|CRISPRCasFinder,CRT matches to MH338234 (Mycobacterium phage Crucio, complete genome) position: , mismatch: 6, identity: 0.812 

atcgc-cagcacgttgatggcgtggacgatatc	CRISPR spacer
-tcgctcagcacgttgatcgcgtggtcgacggc	Protospacer
 **** ************ ****** ***.. *

25. spacer 2.24|1938123|32|NZ_CP046802|CRISPRCasFinder,CRT matches to MH697591 (Mycobacterium phage QueenBeesly, complete genome) position: , mismatch: 6, identity: 0.812 

atcgc-cagcacgttgatggcgtggacgatatc	CRISPR spacer
-tcgctcagcacgttgatcgcgtggtcgacggc	Protospacer
 **** ************ ****** ***.. *

26. spacer 2.24|1938123|32|NZ_CP046802|CRISPRCasFinder,CRT matches to MT498060 (Mycobacterium Phage FiringLine, complete genome) position: , mismatch: 6, identity: 0.812 

atcgc-cagcacgttgatggcgtggacgatatc	CRISPR spacer
-tcgctcagcacgttgatcgcgtggtcgacggc	Protospacer
 **** ************ ****** ***.. *

27. spacer 2.24|1938123|32|NZ_CP046802|CRISPRCasFinder,CRT matches to KM463009 (Mycobacterium phage Power, complete genome) position: , mismatch: 6, identity: 0.812 

atcgc-cagcacgttgatggcgtggacgatatc	CRISPR spacer
-tcgctcagcacgttgatcgcgtggtcgacggc	Protospacer
 **** ************ ****** ***.. *

28. spacer 2.24|1938123|32|NZ_CP046802|CRISPRCasFinder,CRT matches to MT498066 (Mycobacterium phage Georgie2, complete genome) position: , mismatch: 6, identity: 0.812 

atcgc-cagcacgttgatggcgtggacgatatc	CRISPR spacer
-tcgctcagcacgttgatcgcgtggtcgacggc	Protospacer
 **** ************ ****** ***.. *

29. spacer 2.24|1938123|32|NZ_CP046802|CRISPRCasFinder,CRT matches to MN234203 (Mycobacterium phage SemperFi, complete genome) position: , mismatch: 6, identity: 0.812 

atcgc-cagcacgttgatggcgtggacgatatc	CRISPR spacer
-tcgctcagcacgttgatcgcgtggtcgacggc	Protospacer
 **** ************ ****** ***.. *

30. spacer 2.24|1938123|32|NZ_CP046802|CRISPRCasFinder,CRT matches to MF919531 (Mycobacterium phage SnapTap, complete genome) position: , mismatch: 6, identity: 0.812 

atcgc-cagcacgttgatggcgtggacgatatc	CRISPR spacer
-tcgctcagcacgttgatcgcgtggtcgacggc	Protospacer
 **** ************ ****** ***.. *

31. spacer 2.24|1938123|32|NZ_CP046802|CRISPRCasFinder,CRT matches to NC_029043 (Mycobacterium phage SweetiePie, complete genome) position: , mismatch: 6, identity: 0.812 

atcgc-cagcacgttgatggcgtggacgatatc	CRISPR spacer
-tcgctcagcacgttgatcgcgtggtcgacggc	Protospacer
 **** ************ ****** ***.. *

32. spacer 1.1|564909|39|NZ_CP046802|PILER-CR matches to MK817115 (Escherichia phage vB_EcoM_phAPEC6, complete genome) position: , mismatch: 7, identity: 0.821 

agtaggtcaccagttcgattccggtagtcggcaccattt	CRISPR spacer
gaaatgtcaccagttcgattccggtagtcggcacaaaat	Protospacer
.. * ***************************** *  *

33. spacer 1.1|564909|39|NZ_CP046802|PILER-CR matches to MH383160 (Escherichia phage UB, complete genome) position: , mismatch: 7, identity: 0.821 

agtaggtcaccagttcgattccggtagtcggcaccattt	CRISPR spacer
gaaatgtcaccagttcgattccggtagtcggcacaaaat	Protospacer
.. * ***************************** *  *

34. spacer 1.1|564909|39|NZ_CP046802|PILER-CR matches to MK327931 (Escherichia phage vB_EcoM_G17, complete genome) position: , mismatch: 7, identity: 0.821 

agtaggtcaccagttcgattccggtagtcggcaccattt	CRISPR spacer
gaaatgtcaccagttcgattccggtagtcggcacaaaat	Protospacer
.. * ***************************** *  *

35. spacer 2.8|1937162|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT matches to KU234533 (Nostoc phage A1, complete genome) position: , mismatch: 7, identity: 0.781 

agaaagcggcattaatatcgccgcttttttta	CRISPR spacer
tacaagcggcgttaatatcgccacttttttct	Protospacer
 . *******.***********.*******.

36. spacer 2.24|1938123|32|NZ_CP046802|CRISPRCasFinder,CRT matches to NZ_HG938356 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence) position: , mismatch: 7, identity: 0.781 

atcgccagcacgttgatggcgtggacgatatc	CRISPR spacer
gtcgccagcaagttcatggcgtggcggagacc	Protospacer
.********* *** *********  ** *.*

37. spacer 1.1|564909|39|NZ_CP046802|PILER-CR matches to KM507819 (Escherichia phage 121Q, complete genome) position: , mismatch: 8, identity: 0.795 

agtaggtcaccagttcgattccggtagtcggcaccattt	CRISPR spacer
gaaatgtcaccagttcaattccggtagtcggcacaaaat	Protospacer
.. * ***********.***************** *  *

38. spacer 2.16|1937643|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT matches to KP010268 (Enterobacteria phage SfMu, complete genome) position: , mismatch: 8, identity: 0.75 

ccgaaggagccaccaaccgcgaaaaagctacg	CRISPR spacer
cgaccggctccacaaaccgcgaaaaagccacg	Protospacer
* .  **  **** **************.***

39. spacer 2.24|1938123|32|NZ_CP046802|CRISPRCasFinder,CRT matches to NZ_CP031193 (Humibacter sp. BT305 plasmid unnamed1) position: , mismatch: 8, identity: 0.75 

atcgccagcacgttgatggcgtggacgatatc	CRISPR spacer
atcgccagcacgatgatggcgaggagagcgcc	Protospacer
************ ******** *** .....*

40. spacer 2.1|1936742|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT matches to KU737345 (Bacillus phage Juglone, complete genome) position: , mismatch: 9, identity: 0.719 

tgagcaggtggttcttgaccgcctactggtat	CRISPR spacer
tccgcaggtggtttttgtccgcctactacatc	Protospacer
*  **********.*** *********.   .

41. spacer 2.1|1936742|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT matches to MN038178 (Bacillus phage Beyonphe, complete genome) position: , mismatch: 9, identity: 0.719 

tgagcaggtggttcttgaccgcctactggtat	CRISPR spacer
tccgcaggtggtttttgtccgcctactacatc	Protospacer
*  **********.*** *********.   .

42. spacer 2.1|1936742|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT matches to KJ489402 (Bacillus phage Riley, complete genome) position: , mismatch: 9, identity: 0.719 

tgagcaggtggttcttgaccgcctactggtat	CRISPR spacer
tccgcaggtggtttttgtccgcctactacatc	Protospacer
*  **********.*** *********.   .

43. spacer 2.1|1936742|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT matches to NC_031100 (Bacillus phage Phrodo, complete genome) position: , mismatch: 9, identity: 0.719 

tgagcaggtggttcttgaccgcctactggtat	CRISPR spacer
tccgcaggtggtttttgtccgcctactacatc	Protospacer
*  **********.*** *********.   .

44. spacer 2.1|1936742|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT matches to KF669647 (Bacillus phage BigBertha, complete genome) position: , mismatch: 9, identity: 0.719 

tgagcaggtggttcttgaccgcctactggtat	CRISPR spacer
tccgcaggtggtttttgtccgcctactacatc	Protospacer
*  **********.*** *********.   .

45. spacer 2.1|1936742|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT matches to KF669662 (Bacillus phage Spock, complete genome) position: , mismatch: 9, identity: 0.719 

tgagcaggtggttcttgaccgcctactggtat	CRISPR spacer
tccgcaggtggtttttgtccgcctactacatc	Protospacer
*  **********.*** *********.   .

46. spacer 2.1|1936742|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT matches to MF765814 (Bacillus phage Taffo16, complete genome) position: , mismatch: 9, identity: 0.719 

tgagcaggtggttcttgaccgcctactggtat	CRISPR spacer
tccgcaggtggtttttgtccgcctactacatc	Protospacer
*  **********.*** *********.   .

47. spacer 2.1|1936742|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT matches to NC_028887 (Bacillus phage AvesoBmore, complete genome) position: , mismatch: 9, identity: 0.719 

tgagcaggtggttcttgaccgcctactggtat	CRISPR spacer
tccgcaggtggtttttgtccgcctactacatc	Protospacer
*  **********.*** *********.   .

48. spacer 2.1|1936742|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT matches to NC_022088 (Bacillus phage Troll, complete genome) position: , mismatch: 9, identity: 0.719 

tgagcaggtggttcttgaccgcctactggtat	CRISPR spacer
tccgcaggtggtttttgtccgcctactacatc	Protospacer
*  **********.*** *********.   .

49. spacer 2.1|1936742|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT matches to KT995479 (Bacillus phage BM5, complete genome) position: , mismatch: 9, identity: 0.719 

tgagcaggtggttcttgaccgcctactggtat	CRISPR spacer
tccgcaggtggtttttgtccgcctactacatc	Protospacer
*  **********.*** *********.   .

50. spacer 2.1|1936742|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT matches to JN797796 (Bacillus phage B5S, complete genome) position: , mismatch: 9, identity: 0.719 

tgagcaggtggttcttgaccgcctactggtat	CRISPR spacer
tccgcaggtggtttttgtccgcctactacatc	Protospacer
*  **********.*** *********.   .

51. spacer 2.1|1936742|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT matches to NC_018863 (Bacillus phage B4, complete genome) position: , mismatch: 9, identity: 0.719 

tgagcaggtggttcttgaccgcctactggtat	CRISPR spacer
tccgcaggtggtttttgtccgcctactacatc	Protospacer
*  **********.*** *********.   .

52. spacer 2.1|1936742|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT matches to KY888882 (Bacillus phage Flapjack, complete genome) position: , mismatch: 9, identity: 0.719 

tgagcaggtggttcttgaccgcctactggtat	CRISPR spacer
tccgcaggtggtttttgtccgcctactacatc	Protospacer
*  **********.*** *********.   .

53. spacer 2.10|1937282|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024238 (Escherichia coli O15:H11 strain 90-9272 plasmid unnamed) position: , mismatch: 9, identity: 0.719 

tagtgaaaatttaagaacaggcaaatcaccag	CRISPR spacer
aataaaaaatttaagagcagtcaaatcatttg	Protospacer
 *  .***********.*** *******.. *

54. spacer 2.10|1937282|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT matches to NC_013507 (Escherichia coli ETEC H10407 plasmid pEntH10407, complete sequence) position: , mismatch: 9, identity: 0.719 

tagtgaaaatttaagaacaggcaaatcaccag	CRISPR spacer
aataaaaaatttaagagcagtcaaatcatttg	Protospacer
 *  .***********.*** *******.. *

55. spacer 2.10|1937282|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024249 (Escherichia coli O182:H21 strain D181 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

tagtgaaaatttaagaacaggcaaatcaccag	CRISPR spacer
aataaaaaatttaagagcagtcaaatcatttg	Protospacer
 *  .***********.*** *******.. *

56. spacer 2.10|1937282|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT matches to NC_017722 (Escherichia coli ETEC H10407 plasmid p666, complete sequence) position: , mismatch: 9, identity: 0.719 

tagtgaaaatttaagaacaggcaaatcaccag	CRISPR spacer
aataaaaaatttaagagcagtcaaatcatttg	Protospacer
 *  .***********.*** *******.. *

57. spacer 2.14|1937522|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT matches to MT521994 (Gordonia phage Magel, complete genome) position: , mismatch: 9, identity: 0.719 

gcaattcagtgatgaatcactatccattgacc	CRISPR spacer
gagtctggatgatcaatcacaatccattgacc	Protospacer
* . .* ..**** ****** ***********

58. spacer 2.14|1937522|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT matches to MN585988 (Gordonia Phage Odesza, complete genome) position: , mismatch: 9, identity: 0.719 

gcaattcagtgatgaatcactatccattgacc	CRISPR spacer
gagtctggatgatcaatcacaatccattgacc	Protospacer
* . .* ..**** ****** ***********

59. spacer 2.14|1937522|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT matches to NC_048817 (Gordonia phage Tanis, complete genome) position: , mismatch: 9, identity: 0.719 

gcaattcagtgatgaatcactatccattgacc	CRISPR spacer
gagtctggatgatcaatcacaatccattgacc	Protospacer
* . .* ..**** ****** ***********

60. spacer 2.24|1938123|32|NZ_CP046802|CRISPRCasFinder,CRT matches to NZ_CP050096 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b3, complete sequence) position: , mismatch: 9, identity: 0.719 

atcgccagcacgttgatggcgtggacgatatc	CRISPR spacer
atgcccagcacgttgatggtgcggacggcgca	Protospacer
**  ***************.*.*****....

61. spacer 2.24|1938123|32|NZ_CP046802|CRISPRCasFinder,CRT matches to NZ_CP033227 (Sphingobium yanoikuyae strain SJTF8 plasmid pF1, complete sequence) position: , mismatch: 9, identity: 0.719 

atcgccagcacgttgatggcgtggacgatatc	CRISPR spacer
gtggagagcacgttgatggcgagcacgatccg	Protospacer
.* *  *************** * ***** .

62. spacer 2.2|1936802|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018322 (Alteromonas macleodii strain Te101 plasmid pTE101a, complete sequence) position: , mismatch: 10, identity: 0.688 

agtcggtgcacctctacctaaaggggttatat	CRISPR spacer
ttacaaagcacctctacctaaagagattatcc	Protospacer
   *.. ****************.*.**** .

63. spacer 2.5|1936982|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT matches to MK765602 (Tortoise microvirus 50 isolate 50_SP_154, complete genome) position: , mismatch: 10, identity: 0.688 

taaaaaagaagggtggttttaattatggcttt	CRISPR spacer
aaaaaaagaaaggtggttttcattttatgaag	Protospacer
 *********.********* *** *.

64. spacer 2.8|1937162|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013941 (Cronobacter malonaticus LMG 23826 plasmid pCMA1, complete sequence) position: , mismatch: 10, identity: 0.688 

agaaagcggcattaatatcgccgcttttttta	CRISPR spacer
gcgccgcggcattgatatcgccgctgttgatg	Protospacer
. .  ********.*********** **  *.

65. spacer 2.8|1937162|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT matches to NC_023024 (Cronobacter malonaticus plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.688 

agaaagcggcattaatatcgccgcttttttta	CRISPR spacer
gcgccgcggcattgatatcgccgctgttgatg	Protospacer
. .  ********.*********** **  *.

66. spacer 2.8|1937162|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT matches to MG945578 (UNVERIFIED: Microviridae sp. isolate 3606-1801, complete genome) position: , mismatch: 10, identity: 0.688 

agaaagcggcattaatatcgccgcttttttta	CRISPR spacer
cggtcaaatcattaatatcgcctcttgtttta	Protospacer
 *.  . . ************* *** *****

67. spacer 2.10|1937282|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT matches to AY212251 (Streptococcus virus C1, complete genome) position: , mismatch: 10, identity: 0.688 

tagtgaaaatttaagaacaggcaaatcaccag	CRISPR spacer
cttacctaatttacgaacagacaaatcaccac	Protospacer
.      ****** ******.**********

68. spacer 2.10|1937282|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT matches to NC_004814 (Streptococcus phage C1, complete genome) position: , mismatch: 10, identity: 0.688 

tagtgaaaatttaagaacaggcaaatcaccag	CRISPR spacer
cttacctaatttacgaacagacaaatcaccac	Protospacer
.      ****** ******.**********

69. spacer 2.16|1937643|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 10, identity: 0.688 

ccgaaggagccaccaaccgcgaaaaagctacg	CRISPR spacer
gaacgggaaccacccaccgcgaaaaagccgag	Protospacer
  . .***.***** *************.. *

70. spacer 2.24|1938123|32|NZ_CP046802|CRISPRCasFinder,CRT matches to NZ_CP020040 (Streptomyces sp. 3211 isolate 3 plasmid p3211-1, complete sequence) position: , mismatch: 10, identity: 0.688 

atcgccagcacgttgatggcgtggacgatatc	CRISPR spacer
ccacccagcacgttgagagcgtggacgtggcc	Protospacer
 .  ************ .*********  ..*

71. spacer 2.2|1936802|32|NZ_CP046802|PILER-CR,CRISPRCasFinder,CRT matches to NC_009927 (Acaryochloris marina MBIC11017 plasmid pREB2, complete sequence) position: , mismatch: 11, identity: 0.656 

agtcggtgcacctctacctaaaggggttatat	CRISPR spacer
ttccggtgcagctctacctgaaggggcaggca	Protospacer
  .******* ********.******. .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 2215 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_2 12739 : 14731 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_3 21272 : 24125 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_4 32800 : 33085 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_5 38538 : 46810 6 Sodalis_phage(20.0%) protease NA
DBSCAN-SWA_6 51512 : 56181 4 Acanthocystis_turfacea_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_7 66630 : 68145 1 Mollivirus(100.0%) NA NA
DBSCAN-SWA_8 76675 : 78346 1 Escherichia_phage(100.0%) tRNA NA
DBSCAN-SWA_9 84843 : 86508 1 Mimivirus(100.0%) NA NA
DBSCAN-SWA_10 91227 : 93135 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_11 102965 : 110394 6 Serratia_phage(33.33%) NA NA
DBSCAN-SWA_12 114066 : 115167 1 Erwinia_phage(100.0%) NA NA
DBSCAN-SWA_13 118822 : 121399 1 Staphylococcus_phage(100.0%) tRNA NA
DBSCAN-SWA_14 127016 : 129073 2 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_15 133768 : 139709 4 Vibrio_phage(33.33%) NA NA
DBSCAN-SWA_16 147043 : 148078 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_17 151121 : 155714 3 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_18 176732 : 180626 1 Burkholderia_phage(100.0%) NA NA
DBSCAN-SWA_19 184531 : 185662 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_20 208902 : 212154 2 Cafeteria_roenbergensis_virus(50.0%) NA NA
DBSCAN-SWA_21 217406 : 217892 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_22 233674 : 236115 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_23 246720 : 253488 6 Escherichia_phage(66.67%) NA NA
DBSCAN-SWA_24 270610 : 275812 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_25 279845 : 282851 2 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_26 292189 : 306416 16 uncultured_Mediterranean_phage(40.0%) tRNA NA
DBSCAN-SWA_27 315518 : 316337 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_28 325041 : 330017 5 Bacillus_phage(40.0%) tRNA NA
DBSCAN-SWA_29 341362 : 342574 1 environmental_halophage(100.0%) NA NA
DBSCAN-SWA_30 347728 : 353466 2 Brevibacillus_phage(50.0%) NA NA
DBSCAN-SWA_31 369978 : 373896 2 Catovirus(50.0%) NA NA
DBSCAN-SWA_32 381931 : 383275 1 Geobacillus_virus(100.0%) NA NA
DBSCAN-SWA_33 390885 : 393483 3 Equid_alphaherpesvirus(33.33%) NA NA
DBSCAN-SWA_34 401753 : 404102 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_35 421851 : 424776 3 Halovirus(50.0%) NA NA
DBSCAN-SWA_36 445179 : 449979 6 Streptococcus_phage(33.33%) protease NA
DBSCAN-SWA_37 456595 : 459258 2 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_38 471107 : 472058 1 Moumouvirus(100.0%) NA NA
DBSCAN-SWA_39 476932 : 484820 7 Pseudomonas_phage(40.0%) tRNA NA
DBSCAN-SWA_40 487827 : 494977 6 uncultured_Mediterranean_phage(33.33%) NA NA
DBSCAN-SWA_41 500228 : 505992 5 Moraxella_phage(25.0%) tRNA NA
DBSCAN-SWA_42 512241 : 516841 4 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_43 527922 : 531105 2 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_44 542162 : 544121 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_45 547556 : 548711 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_46 563501 : 566964 2 Geobacillus_virus(50.0%) NA NA
DBSCAN-SWA_47 575701 : 576202 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_48 579876 : 583964 4 Indivirus(50.0%) NA NA
DBSCAN-SWA_49 599128 : 600172 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_50 606345 : 606804 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_51 611934 : 612780 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_52 619019 : 624551 4 Vibrio_phage(33.33%) NA NA
DBSCAN-SWA_53 629448 : 634614 2 Dickeya_phage(50.0%) NA NA
DBSCAN-SWA_54 651858 : 653265 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_55 656840 : 660245 2 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_56 670770 : 674437 2 Wolbachia_phage(50.0%) NA NA
DBSCAN-SWA_57 678491 : 679037 1 Diachasmimorpha_longicaudata_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_58 690457 : 698792 2 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_59 702696 : 705503 2 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_60 711185 : 712511 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_61 729798 : 736508 4 Streptomyces_phage(33.33%) NA NA
DBSCAN-SWA_62 740681 : 742628 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_63 747941 : 749582 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_64 756349 : 760468 4 Prochlorococcus_phage(50.0%) NA NA
DBSCAN-SWA_65 770251 : 774972 3 Prochlorococcus_phage(50.0%) NA NA
DBSCAN-SWA_66 779134 : 780460 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_67 784618 : 791620 8 Catovirus(25.0%) NA NA
DBSCAN-SWA_68 802474 : 804604 2 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_69 815877 : 824797 9 uncultured_Mediterranean_phage(25.0%) NA NA
DBSCAN-SWA_70 829167 : 830391 1 Morganella_phage(100.0%) integrase attL 822910:822924|attR 834326:834340
DBSCAN-SWA_71 837856 : 838969 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_72 846302 : 847271 1 Enterococcus_phage(100.0%) NA NA
DBSCAN-SWA_73 859766 : 860486 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_74 871067 : 873212 1 Cedratvirus(100.0%) NA NA
DBSCAN-SWA_75 891340 : 898507 5 Catovirus(66.67%) NA NA
DBSCAN-SWA_76 901939 : 906275 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_77 913545 : 919590 3 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_78 936432 : 936990 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_79 942242 : 943785 2 Synechococcus_phage(50.0%) tRNA NA
DBSCAN-SWA_80 956432 : 958079 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_81 964089 : 964338 1 Dickeya_phage(100.0%) NA NA
DBSCAN-SWA_82 983952 : 984576 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_83 990534 : 991893 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_84 999095 : 1000790 2 Leptospira_phage(50.0%) NA NA
DBSCAN-SWA_85 1007290 : 1016335 9 Staphylococcus_phage(25.0%) NA NA
DBSCAN-SWA_86 1030314 : 1032105 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_87 1043732 : 1045247 1 Cedratvirus(100.0%) NA NA
DBSCAN-SWA_88 1052272 : 1064078 10 Alteromonas_phage(25.0%) NA NA
DBSCAN-SWA_89 1080123 : 1081053 1 Virus_Rctr41k(100.0%) NA NA
DBSCAN-SWA_90 1090257 : 1090728 1 Clostridium_phage(100.0%) NA NA
DBSCAN-SWA_91 1096551 : 1099257 3 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_92 1105655 : 1106279 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_93 1124970 : 1130602 4 Ectocarpus_siliculosus_virus(50.0%) NA NA
DBSCAN-SWA_94 1135032 : 1141527 5 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_95 1163579 : 1167313 3 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_96 1170499 : 1174688 4 uncultured_Mediterranean_phage(33.33%) NA NA
DBSCAN-SWA_97 1190791 : 1193688 4 Bacillus_phage(66.67%) tRNA NA
DBSCAN-SWA_98 1210858 : 1212190 1 Erwinia_phage(100.0%) NA NA
DBSCAN-SWA_99 1218528 : 1225498 5 uncultured_virus(25.0%) NA NA
DBSCAN-SWA_100 1230980 : 1231955 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_101 1235307 : 1235847 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_102 1246083 : 1246815 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_103 1253240 : 1254962 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_104 1258340 : 1262460 5 Vibrio_phage(50.0%) tRNA NA
DBSCAN-SWA_105 1271213 : 1273136 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_106 1276709 : 1281647 3 Brazilian_cedratvirus(50.0%) NA NA
DBSCAN-SWA_107 1298894 : 1300277 1 Diachasmimorpha_longicaudata_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_108 1304485 : 1310256 6 Hokovirus(33.33%) NA NA
DBSCAN-SWA_109 1318899 : 1320689 2 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_110 1325784 : 1326489 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_111 1330515 : 1339224 11 Thermobifida_phage(20.0%) NA NA
DBSCAN-SWA_112 1344870 : 1360344 10 Paramecium_bursaria_Chlorella_virus(16.67%) tRNA NA
DBSCAN-SWA_113 1387780 : 1393535 4 Catovirus(66.67%) NA NA
DBSCAN-SWA_114 1404140 : 1417597 13 Sinorhizobium_phage(20.0%) NA NA
DBSCAN-SWA_115 1420898 : 1427414 5 Only_Syngen_Nebraska_virus(25.0%) NA NA
DBSCAN-SWA_116 1430421 : 1431678 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_117 1439843 : 1444814 3 Bacillus_virus(66.67%) NA NA
DBSCAN-SWA_118 1452075 : 1456759 5 Pelagibaca_phage(33.33%) NA NA
DBSCAN-SWA_119 1462728 : 1467729 5 Erysipelothrix_phage(33.33%) NA NA
DBSCAN-SWA_120 1470844 : 1472224 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_121 1475960 : 1478423 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_122 1486140 : 1498419 10 Bacillus_phage(20.0%) NA NA
DBSCAN-SWA_123 1506578 : 1507562 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_124 1512177 : 1515567 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_125 1519919 : 1521648 2 Lake_Baikal_phage(50.0%) NA NA
DBSCAN-SWA_126 1527774 : 1529748 1 Ostreococcus_lucimarinus_virus(100.0%) protease NA
DBSCAN-SWA_127 1535072 : 1537775 1 Cafeteria_roenbergensis_virus(100.0%) NA NA
DBSCAN-SWA_128 1543991 : 1556224 11 Phage_TP(20.0%) tRNA NA
DBSCAN-SWA_129 1562480 : 1567241 4 Hokovirus(50.0%) NA NA
DBSCAN-SWA_130 1573754 : 1576601 1 Megavirus(100.0%) tRNA NA
DBSCAN-SWA_131 1583964 : 1592530 6 Enterobacteria_phage(25.0%) NA NA
DBSCAN-SWA_132 1596550 : 1600925 3 Bodo_saltans_virus(50.0%) NA NA
DBSCAN-SWA_133 1624894 : 1625800 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_134 1636776 : 1647122 11 Staphylococcus_phage(57.14%) NA NA
DBSCAN-SWA_135 1656614 : 1657367 1 Flavobacterium_phage(100.0%) NA NA
DBSCAN-SWA_136 1667499 : 1671694 2 Emiliania_huxleyi_virus(50.0%) NA NA
DBSCAN-SWA_137 1675912 : 1680364 5 Lactobacillus_phage(33.33%) NA NA
DBSCAN-SWA_138 1686011 : 1687694 2 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_139 1695118 : 1697824 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_140 1707348 : 1708275 1 Bacillus_thuringiensis_phage(100.0%) NA NA
DBSCAN-SWA_141 1715943 : 1716876 1 Clostridium_phage(100.0%) NA NA
DBSCAN-SWA_142 1726531 : 1727617 1 Thermus_virus(100.0%) NA NA
DBSCAN-SWA_143 1733221 : 1745536 7 uncultured_Mediterranean_phage(33.33%) transposase,tRNA NA
DBSCAN-SWA_144 1751818 : 1752670 1 Cafeteria_roenbergensis_virus(100.0%) NA NA
DBSCAN-SWA_145 1757804 : 1758377 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_146 1761926 : 1763798 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_147 1770607 : 1771627 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_148 1777617 : 1778736 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_149 1788429 : 1792225 4 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_150 1818563 : 1819649 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_151 1825817 : 1826963 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_152 1832332 : 1833097 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_153 1849306 : 1850092 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_154 1858804 : 1864113 3 Tupanvirus(50.0%) tRNA NA
DBSCAN-SWA_155 1870420 : 1870789 1 Bacillus_thuringiensis_phage(100.0%) NA NA
DBSCAN-SWA_156 1875084 : 1878850 5 Natrialba_phage(50.0%) NA NA
DBSCAN-SWA_157 1887552 : 1898251 9 uncultured_Caudovirales_phage(40.0%) NA NA
DBSCAN-SWA_158 1906671 : 1918380 10 Salinibacter_virus(25.0%) tRNA NA
DBSCAN-SWA_159 1925619 : 1935909 6 Vibrio_phage(75.0%) NA NA
DBSCAN-SWA_160 1941344 : 1943979 3 Feldmannia_irregularis_virus(50.0%) NA NA
DBSCAN-SWA_161 1947758 : 2063964 114 Vibrio_phage(17.24%) protease,tRNA,tail,plate,integrase attL 1983519:1983574|attR 2023286:2023341
DBSCAN-SWA_162 2074551 : 2075952 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_163 2105108 : 2106694 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_164 2158987 : 2160619 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_165 2168178 : 2170142 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_166 2191003 : 2197659 6 Bacillus_phage(33.33%) tRNA NA
DBSCAN-SWA_167 2201431 : 2202382 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_168 2205822 : 2210857 4 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_169 2216142 : 2217513 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_170 2229176 : 2229914 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_171 2236233 : 2240392 3 Bodo_saltans_virus(33.33%) tRNA NA
DBSCAN-SWA_172 2257988 : 2270258 10 Indivirus(25.0%) NA NA
DBSCAN-SWA_173 2279090 : 2280062 1 Bacillus_thuringiensis_phage(100.0%) NA NA
DBSCAN-SWA_174 2303468 : 2327636 20 uncultured_Caudovirales_phage(22.22%) NA NA
DBSCAN-SWA_175 2335807 : 2338410 3 Enterococcus_phage(50.0%) NA NA
DBSCAN-SWA_176 2341990 : 2343570 2 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_177 2356473 : 2357388 1 Mimivirus(100.0%) NA NA
DBSCAN-SWA_178 2361060 : 2361879 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_179 2365936 : 2366452 1 Clostridium_phage(100.0%) NA NA
DBSCAN-SWA_180 2371120 : 2371831 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_181 2384739 : 2387729 4 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_182 2391779 : 2401957 10 Mycoplasma_phage(33.33%) tRNA NA
DBSCAN-SWA_183 2407610 : 2417976 12 Enterobacteria_phage(33.33%) NA NA
DBSCAN-SWA_184 2427182 : 2432946 5 Vibrio_phage(66.67%) protease NA
DBSCAN-SWA_185 2437714 : 2439283 1 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_186 2444648 : 2449771 5 Pelagibacter_phage(33.33%) NA NA
DBSCAN-SWA_187 2460204 : 2461470 1 Diachasmimorpha_longicaudata_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_188 2464684 : 2465701 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_189 2472546 : 2473227 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_190 2480428 : 2493592 12 Vibrio_phage(20.0%) protease NA
DBSCAN-SWA_191 2511575 : 2512364 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_192 2517246 : 2519732 2 Citrobacter_phage(50.0%) tRNA NA
DBSCAN-SWA_193 2539404 : 2543727 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_194 2548127 : 2551499 3 Agrobacterium_phage(33.33%) protease NA
DBSCAN-SWA_195 2557823 : 2560187 1 Yellowstone_lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_196 2576267 : 2578616 1 Acanthamoeba_polyphaga_mimivirus(100.0%) NA NA
DBSCAN-SWA_197 2584687 : 2589265 3 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_198 2592471 : 2597533 6 Acinetobacter_phage(66.67%) NA NA
DBSCAN-SWA_199 2601285 : 2603693 3 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_200 2612922 : 2618540 3 Pseudomonas_phage(33.33%) NA NA
DBSCAN-SWA_201 2627304 : 2632012 4 Pandoravirus(50.0%) NA NA
DBSCAN-SWA_202 2645176 : 2646876 2 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_203 2657033 : 2669601 10 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_204 2692054 : 2693164 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_205 2696236 : 2699502 3 Micromonas_sp._RCC1109_virus(33.33%) NA NA
DBSCAN-SWA_206 2736842 : 2741347 5 Bacillus_phage(25.0%) tRNA NA
DBSCAN-SWA_207 2746274 : 2759947 12 Tetraselmis_virus(40.0%) NA NA
DBSCAN-SWA_208 2763844 : 2765116 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_209 2768683 : 2770432 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_210 2777335 : 2778022 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_211 2789041 : 2789848 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA

Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_CP046802.1|WP_115174031.1|702696_703881_-|elongation-factor-Tu 702696_703881_- 394 aa aa NA NA NA 702696-705503 yes