Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP047045 Caulobacteraceae bacterium 0127_4 chromosome, complete genome 1 crisprs csa3,WYL,cas3,DEDDh 0 2 3 0

Results visualization

1. NZ_CP047045
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047045_1 3277770-3278108 Orphan NA
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP047045_1 1.5|3278055|28|NZ_CP047045|CRISPRCasFinder 3278055-3278082 28 NZ_CP047900 Pseudarthrobacter sp. YJ56 plasmid unnamed2, complete sequence 14627-14654 5 0.821
NZ_CP047045_1 1.1|3277796|29|NZ_CP047045|CRISPRCasFinder 3277796-3277824 29 NZ_CP043499 Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence 1091779-1091807 6 0.793
NZ_CP047045_1 1.5|3278055|28|NZ_CP047045|CRISPRCasFinder 3278055-3278082 28 MK864266 Gordonia phage Arri, complete genome 7789-7816 6 0.786
NZ_CP047045_1 1.5|3278055|28|NZ_CP047045|CRISPRCasFinder 3278055-3278082 28 MN284907 Gordonia phage Fireball, complete genome 7721-7748 6 0.786
NZ_CP047045_1 1.5|3278055|28|NZ_CP047045|CRISPRCasFinder 3278055-3278082 28 MK864264 Gordonia phage VanDeWege, complete genome 7909-7936 6 0.786
NZ_CP047045_1 1.5|3278055|28|NZ_CP047045|CRISPRCasFinder 3278055-3278082 28 MK937603 Gordonia phage Bakery, complete genome 7490-7517 6 0.786
NZ_CP047045_1 1.5|3278055|28|NZ_CP047045|CRISPRCasFinder 3278055-3278082 28 MH479910 Gordonia phage Danyall, complete genome 7617-7644 6 0.786
NZ_CP047045_1 1.5|3278055|28|NZ_CP047045|CRISPRCasFinder 3278055-3278082 28 MT639651 Gordonia phage Portcullis, complete genome 7677-7704 6 0.786
NZ_CP047045_1 1.5|3278055|28|NZ_CP047045|CRISPRCasFinder 3278055-3278082 28 MH479917 Gordonia phage KimmyK, complete genome 7745-7772 6 0.786
NZ_CP047045_1 1.5|3278055|28|NZ_CP047045|CRISPRCasFinder 3278055-3278082 28 MH669015 Gordonia phage TillyBobJoe, complete genome 7432-7459 6 0.786
NZ_CP047045_1 1.5|3278055|28|NZ_CP047045|CRISPRCasFinder 3278055-3278082 28 MK814761 Gordonia phage SmokingBunny, complete genome 7596-7623 6 0.786
NZ_CP047045_1 1.5|3278055|28|NZ_CP047045|CRISPRCasFinder 3278055-3278082 28 KX557286 Gordonia phage Twister6, complete genome 7528-7555 6 0.786
NZ_CP047045_1 1.5|3278055|28|NZ_CP047045|CRISPRCasFinder 3278055-3278082 28 MK864267 Gordonia phage Valary, complete genome 7981-8008 6 0.786
NZ_CP047045_1 1.5|3278055|28|NZ_CP047045|CRISPRCasFinder 3278055-3278082 28 MK967381 Gordonia phage RogerDodger, complete genome 7981-8008 6 0.786
NZ_CP047045_1 1.5|3278055|28|NZ_CP047045|CRISPRCasFinder 3278055-3278082 28 MT310872 Gordonia phage Evamon, complete genome 7598-7625 6 0.786
NZ_CP047045_1 1.5|3278055|28|NZ_CP047045|CRISPRCasFinder 3278055-3278082 28 MT521998 Gordonia phage Jambalaya, complete genome 7429-7456 6 0.786
NZ_CP047045_1 1.5|3278055|28|NZ_CP047045|CRISPRCasFinder 3278055-3278082 28 MK864265 Gordonia phage Barb, complete genome 7745-7772 6 0.786
NZ_CP047045_1 1.5|3278055|28|NZ_CP047045|CRISPRCasFinder 3278055-3278082 28 NC_030913 Gordonia phage Wizard, complete genome 7721-7748 6 0.786
NZ_CP047045_1 1.5|3278055|28|NZ_CP047045|CRISPRCasFinder 3278055-3278082 28 MK305889 Gordonia phage Mutzi, complete genome 7617-7644 6 0.786
NZ_CP047045_1 1.5|3278055|28|NZ_CP047045|CRISPRCasFinder 3278055-3278082 28 MN010760 Gordonia phage Nubi, complete genome 7618-7645 6 0.786
NZ_CP047045_1 1.5|3278055|28|NZ_CP047045|CRISPRCasFinder 3278055-3278082 28 MT723933 Streptomyces phage Keanu, complete genome 10862-10889 6 0.786
NZ_CP047045_1 1.5|3278055|28|NZ_CP047045|CRISPRCasFinder 3278055-3278082 28 NZ_CP049749 Rhodococcus fascians A21d2 plasmid pA21d2, complete sequence 25445-25472 7 0.75
NZ_CP047045_1 1.5|3278055|28|NZ_CP047045|CRISPRCasFinder 3278055-3278082 28 NZ_CP015236 Rhodococcus fascians D188 plasmid pFiD188, complete sequence 73079-73106 7 0.75

1. spacer 1.5|3278055|28|NZ_CP047045|CRISPRCasFinder matches to NZ_CP047900 (Pseudarthrobacter sp. YJ56 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.821

ggacaactcgatcgacaccgacaactcc	CRISPR spacer
ctacgactcgatcgacaccgactactac	Protospacer
  **.***************** *** *

2. spacer 1.1|3277796|29|NZ_CP047045|CRISPRCasFinder matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793

ggaaaacagaccgagatcgacaccacgag	CRISPR spacer
agaacgttgaccgagatcgacgccacgag	Protospacer
.*** .. *************.*******

3. spacer 1.5|3278055|28|NZ_CP047045|CRISPRCasFinder matches to MK864266 (Gordonia phage Arri, complete genome) position: , mismatch: 6, identity: 0.786

ggacaactcgatcgacaccgacaactcc	CRISPR spacer
ggagaactcgatcgacaccgacgggatc	Protospacer
*** ******************..  .*

4. spacer 1.5|3278055|28|NZ_CP047045|CRISPRCasFinder matches to MN284907 (Gordonia phage Fireball, complete genome) position: , mismatch: 6, identity: 0.786

ggacaactcgatcgacaccgacaactcc	CRISPR spacer
ggagaactcgatcgacaccgacgggatc	Protospacer
*** ******************..  .*

5. spacer 1.5|3278055|28|NZ_CP047045|CRISPRCasFinder matches to MK864264 (Gordonia phage VanDeWege, complete genome) position: , mismatch: 6, identity: 0.786

ggacaactcgatcgacaccgacaactcc	CRISPR spacer
ggagaactcgatcgacaccgacgggatc	Protospacer
*** ******************..  .*

6. spacer 1.5|3278055|28|NZ_CP047045|CRISPRCasFinder matches to MK937603 (Gordonia phage Bakery, complete genome) position: , mismatch: 6, identity: 0.786

ggacaactcgatcgacaccgacaactcc	CRISPR spacer
ggagaactcgatcgacaccgacgggatc	Protospacer
*** ******************..  .*

7. spacer 1.5|3278055|28|NZ_CP047045|CRISPRCasFinder matches to MH479910 (Gordonia phage Danyall, complete genome) position: , mismatch: 6, identity: 0.786

ggacaactcgatcgacaccgacaactcc	CRISPR spacer
ggagaactcgatcgacaccgacgggatc	Protospacer
*** ******************..  .*

8. spacer 1.5|3278055|28|NZ_CP047045|CRISPRCasFinder matches to MT639651 (Gordonia phage Portcullis, complete genome) position: , mismatch: 6, identity: 0.786

ggacaactcgatcgacaccgacaactcc	CRISPR spacer
ggagaactcgatcgacaccgacgggatc	Protospacer
*** ******************..  .*

9. spacer 1.5|3278055|28|NZ_CP047045|CRISPRCasFinder matches to MH479917 (Gordonia phage KimmyK, complete genome) position: , mismatch: 6, identity: 0.786

ggacaactcgatcgacaccgacaactcc	CRISPR spacer
ggagaactcgatcgacaccgacgggatc	Protospacer
*** ******************..  .*

10. spacer 1.5|3278055|28|NZ_CP047045|CRISPRCasFinder matches to MH669015 (Gordonia phage TillyBobJoe, complete genome) position: , mismatch: 6, identity: 0.786

ggacaactcgatcgacaccgacaactcc	CRISPR spacer
ggagaactcgatcgacaccgacgggatc	Protospacer
*** ******************..  .*

11. spacer 1.5|3278055|28|NZ_CP047045|CRISPRCasFinder matches to MK814761 (Gordonia phage SmokingBunny, complete genome) position: , mismatch: 6, identity: 0.786

ggacaactcgatcgacaccgacaactcc	CRISPR spacer
ggagaactcgatcgacaccgacgggatc	Protospacer
*** ******************..  .*

12. spacer 1.5|3278055|28|NZ_CP047045|CRISPRCasFinder matches to KX557286 (Gordonia phage Twister6, complete genome) position: , mismatch: 6, identity: 0.786

ggacaactcgatcgacaccgacaactcc	CRISPR spacer
ggagaactcgatcgacaccgacgggatc	Protospacer
*** ******************..  .*

13. spacer 1.5|3278055|28|NZ_CP047045|CRISPRCasFinder matches to MK864267 (Gordonia phage Valary, complete genome) position: , mismatch: 6, identity: 0.786

ggacaactcgatcgacaccgacaactcc	CRISPR spacer
ggagaactcgatcgacaccgacgggatc	Protospacer
*** ******************..  .*

14. spacer 1.5|3278055|28|NZ_CP047045|CRISPRCasFinder matches to MK967381 (Gordonia phage RogerDodger, complete genome) position: , mismatch: 6, identity: 0.786

ggacaactcgatcgacaccgacaactcc	CRISPR spacer
ggagaactcgatcgacaccgacgggatc	Protospacer
*** ******************..  .*

15. spacer 1.5|3278055|28|NZ_CP047045|CRISPRCasFinder matches to MT310872 (Gordonia phage Evamon, complete genome) position: , mismatch: 6, identity: 0.786

ggacaactcgatcgacaccgacaactcc	CRISPR spacer
ggagaactcgatcgacaccgacgggatc	Protospacer
*** ******************..  .*

16. spacer 1.5|3278055|28|NZ_CP047045|CRISPRCasFinder matches to MT521998 (Gordonia phage Jambalaya, complete genome) position: , mismatch: 6, identity: 0.786

ggacaactcgatcgacaccgacaactcc	CRISPR spacer
ggagaactcgatcgacaccgacgggatc	Protospacer
*** ******************..  .*

17. spacer 1.5|3278055|28|NZ_CP047045|CRISPRCasFinder matches to MK864265 (Gordonia phage Barb, complete genome) position: , mismatch: 6, identity: 0.786

ggacaactcgatcgacaccgacaactcc	CRISPR spacer
ggagaactcgatcgacaccgacgggatc	Protospacer
*** ******************..  .*

18. spacer 1.5|3278055|28|NZ_CP047045|CRISPRCasFinder matches to NC_030913 (Gordonia phage Wizard, complete genome) position: , mismatch: 6, identity: 0.786

ggacaactcgatcgacaccgacaactcc	CRISPR spacer
ggagaactcgatcgacaccgacgggatc	Protospacer
*** ******************..  .*

19. spacer 1.5|3278055|28|NZ_CP047045|CRISPRCasFinder matches to MK305889 (Gordonia phage Mutzi, complete genome) position: , mismatch: 6, identity: 0.786

ggacaactcgatcgacaccgacaactcc	CRISPR spacer
ggagaactcgatcgacaccgacgggatc	Protospacer
*** ******************..  .*

20. spacer 1.5|3278055|28|NZ_CP047045|CRISPRCasFinder matches to MN010760 (Gordonia phage Nubi, complete genome) position: , mismatch: 6, identity: 0.786

ggacaactcgatcgacaccgacaactcc	CRISPR spacer
ggagaactcgatcgacaccgacgggatc	Protospacer
*** ******************..  .*

21. spacer 1.5|3278055|28|NZ_CP047045|CRISPRCasFinder matches to MT723933 (Streptomyces phage Keanu, complete genome) position: , mismatch: 6, identity: 0.786

ggacaactcgatcgacaccgacaactcc	CRISPR spacer
cgacaacacgatcgacaccgccaagtgg	Protospacer
 ****** ************ *** *  

22. spacer 1.5|3278055|28|NZ_CP047045|CRISPRCasFinder matches to NZ_CP049749 (Rhodococcus fascians A21d2 plasmid pA21d2, complete sequence) position: , mismatch: 7, identity: 0.75

ggacaactcgatcgacaccgacaactcc	CRISPR spacer
ctcggtctcgatcgacaccgacacctcc	Protospacer
    . ***************** ****

23. spacer 1.5|3278055|28|NZ_CP047045|CRISPRCasFinder matches to NZ_CP015236 (Rhodococcus fascians D188 plasmid pFiD188, complete sequence) position: , mismatch: 7, identity: 0.75

ggacaactcgatcgacaccgacaactcc	CRISPR spacer
ctcggtctcgatcgacaccgacacctcc	Protospacer
    . ***************** ****

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2067539 : 2072961 7 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_2 2105361 : 2118402 12 uncultured_Mediterranean_phage(57.14%) tRNA NA
DBSCAN-SWA_3 2354477 : 2366947 9 Chrysochromulina_ericina_virus(14.29%) protease,head,capsid,portal NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage