Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP047095 Bacillus marisflavi strain 151-25 chromosome, complete genome 0 crisprs DinG,csa3,WYL,cas3,DEDDh 0 0 2 0
NZ_CP047096 Bacillus marisflavi strain 151-25 plasmid p25, complete sequence 1 crisprs csa3 0 1 0 0

Results visualization

1. NZ_CP047096
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047096_1 97564-97669 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP047096_1 1.1|97593|48|NZ_CP047096|CRISPRCasFinder 97593-97640 48 NZ_CP047096 Bacillus marisflavi strain 151-25 plasmid p25, complete sequence 97593-97640 0 1.0

1. spacer 1.1|97593|48|NZ_CP047096|CRISPRCasFinder matches to NZ_CP047096 (Bacillus marisflavi strain 151-25 plasmid p25, complete sequence) position: , mismatch: 0, identity: 1.0

taaattattgtaacatttataaaaaccttataaaatcaacgtttttat	CRISPR spacer
taaattattgtaacatttataaaaaccttataaaatcaacgtttttat	Protospacer
************************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP047095
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 373483 : 381797 8 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_2 2718485 : 2738047 22 Paenibacillus_phage(58.33%) holin,terminase,portal,tail,capsid NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage