Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP046531 Mannheimia sp. ZY170218 chromosome, complete genome 1 crisprs cas3,cas2,DEDDh,DinG 0 1 6 0

Results visualization

1. NZ_CP046531
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP046531_1 1661235-1661309 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP046531_1 1.1|1661258|29|NZ_CP046531|CRISPRCasFinder 1661258-1661286 29 MH791397 UNVERIFIED: Enterococcus phage EfsSzw-1, complete genome 22354-22382 5 0.828

1. spacer 1.1|1661258|29|NZ_CP046531|CRISPRCasFinder matches to MH791397 (UNVERIFIED: Enterococcus phage EfsSzw-1, complete genome) position: , mismatch: 5, identity: 0.828

agacctgatactaatctagggtataaaga	CRISPR spacer
aaacctcataataatctagggtataaggc	Protospacer
*.**** *** ***************.* 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 209542 : 255570 41 Bodo_saltans_virus(22.22%) transposase,protease,integrase,tRNA attL 204067:204084|attR 230040:230057
DBSCAN-SWA_2 767241 : 838028 56 Mannheimia_phage(14.29%) transposase,protease,integrase,tRNA attL 787025:787042|attR 817698:817715
DBSCAN-SWA_3 1204332 : 1212821 9 Hokovirus(16.67%) NA NA
DBSCAN-SWA_4 1440731 : 1533012 109 Mannheimia_phage(64.91%) integrase,transposase,protease,capsid,tail,holin,head,plate,terminase,portal,tRNA attL 1439087:1439106|attR 1536344:1536363
DBSCAN-SWA_5 1596772 : 1607408 9 Bacillus_phage(28.57%) NA NA
DBSCAN-SWA_6 1893570 : 2001270 104 Mannheimia_phage(20.83%) integrase,transposase,holin,protease,capsid,tail,head,terminase,portal,tRNA attL 1915368:1915414|attR 1955819:1955865
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage