Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP047186 Rathayibacter tanaceti strain VKM Ac-2761 chromosome, complete genome 1 crisprs WYL,csa3,cas3,DEDDh,Cas9_archaeal,RT 0 1 0 0

Results visualization

1. NZ_CP047186
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047186_1 1984331-1984417 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP047186_1 1.1|1984358|33|NZ_CP047186|CRISPRCasFinder 1984358-1984390 33 NZ_CP022191 Yangia pacifica strain YSBP01 plasmid unnamed1, complete sequence 451361-451393 9 0.727
NZ_CP047186_1 1.1|1984358|33|NZ_CP047186|CRISPRCasFinder 1984358-1984390 33 NC_009128 Corynebacterium sp. L2-79-05 plasmid pLEW279a, complete sequence 25600-25632 9 0.727
NZ_CP047186_1 1.1|1984358|33|NZ_CP047186|CRISPRCasFinder 1984358-1984390 33 NZ_CP054618 Azospirillum oryzae strain KACC 14407 plasmid unnamed4, complete sequence 27741-27773 10 0.697

1. spacer 1.1|1984358|33|NZ_CP047186|CRISPRCasFinder matches to NZ_CP022191 (Yangia pacifica strain YSBP01 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727

cggggcggccggacgctgacccatgccctggtt	CRISPR spacer
gaggctggcgcgacgctgacccatgccctgaag	Protospacer
 .** .***  *******************.  

2. spacer 1.1|1984358|33|NZ_CP047186|CRISPRCasFinder matches to NC_009128 (Corynebacterium sp. L2-79-05 plasmid pLEW279a, complete sequence) position: , mismatch: 9, identity: 0.727

cggggcggccggacgctgacccatgccctggtt	CRISPR spacer
cgggtcggccggacggtgacccatcaggtgcgc	Protospacer
**** ********** ********    **  .

3. spacer 1.1|1984358|33|NZ_CP047186|CRISPRCasFinder matches to NZ_CP054618 (Azospirillum oryzae strain KACC 14407 plasmid unnamed4, complete sequence) position: , mismatch: 10, identity: 0.697

cggggcggccggacgctgacccatgccctggtt	CRISPR spacer
gatggcggctggacgcagacccatgccgacggg	Protospacer
 . ******.****** **********   *  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage