1. spacer 1.2|1915046|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP029540 (Aquitalea sp. USM4 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.938
cacagtcgcccacaaggcggcttagttttgga CRISPR spacer
cacagccgccgacaaggcggcttagttttgga Protospacer
*****.**** *********************
2. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP029540 (Aquitalea sp. USM4 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
ttccacccatccggcacctgcgcgggcggggc Protospacer
*. ** ***********************
3. spacer 1.3|1915106|32|NZ_CP047241|CRISPRCasFinder,CRT matches to CP001777 (Spirosoma linguale DSM 74 plasmid pSLIN08, complete sequence) position: , mismatch: 6, identity: 0.812
gggacggcagcaactgatagctggtgcggctg CRISPR spacer
tggtcggcagcaactgataactggtgtagccg Protospacer
** ***************.******..**.*
4. spacer 1.2|1915046|32|NZ_CP047241|CRISPRCasFinder,CRT matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 7, identity: 0.781
cacagtcgcccacaaggcggcttagttttgga CRISPR spacer
cctattcgcccgcaaggcggcttagtttggac Protospacer
* .* ******.**************** *.
5. spacer 1.7|1915346|32|NZ_CP047241|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 7, identity: 0.781
aaggcgttcttgctcggcacgttcggcagcaa CRISPR spacer
tatgcgttttcgctcggcacgttcggcacctt Protospacer
* *****.*.***************** *
6. spacer 1.7|1915346|32|NZ_CP047241|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
aaggcgttcttgctcggcacgttcggcagcaa CRISPR spacer
tatgcgttttcgctcggcacgttcggcacctt Protospacer
* *****.*.***************** *
7. spacer 1.14|1915766|32|NZ_CP047241|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033195 (Xanthomonas oryzae pv. oryzae strain CIAT plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
-gaaacgccaaagccgaagatttcctccagctt CRISPR spacer
tccaatg-cgaagccgatgatttcctcgagctt Protospacer
**.* *.******* ********* *****
8. spacer 1.14|1915766|32|NZ_CP047241|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033202 (Xanthomonas oryzae pv. oryzae strain BXO1 plasmid pBXO1-1, complete sequence) position: , mismatch: 7, identity: 0.781
-gaaacgccaaagccgaagatttcctccagctt CRISPR spacer
tccaatg-cgaagccgatgatttcctcgagctt Protospacer
**.* *.******* ********* *****
9. spacer 1.25|1916426|32|NZ_CP047241|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 7, identity: 0.781
ttgttgcgcgtcttctgctcgcgggtcaggct CRISPR spacer
ttgatcgccgtcttctgctcgtcggtcaggcc Protospacer
*** * *************. ********.
10. spacer 1.25|1916426|32|NZ_CP047241|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.781
ttgttgcgcgtcttctgctcgcgggtcaggct CRISPR spacer
ttgatcgccgtcttctgctcgtcggtcaggcc Protospacer
*** * *************. ********.
11. spacer 1.25|1916426|32|NZ_CP047241|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.781
ttgttgcgcgtcttctgctcgcgggtcaggct CRISPR spacer
ttgatcgccgtcttctgctcgtcggtcaggcc Protospacer
*** * *************. ********.
12. spacer 1.25|1916426|32|NZ_CP047241|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033323 (Azospirillum brasilense strain Cd plasmid p5, complete sequence) position: , mismatch: 7, identity: 0.781
ttgttgcgcgtcttctgctcgcgggtcaggct CRISPR spacer
ttgatcgccgtcttctgctcgtcggtcaggcc Protospacer
*** * *************. ********.
13. spacer 1.25|1916426|32|NZ_CP047241|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.781
ttgttgcgcgtcttctgctcgcgggtcaggct CRISPR spacer
ttgatcgccgtcttctgctcgtcggtcaggcc Protospacer
*** * *************. ********.
14. spacer 1.25|1916426|32|NZ_CP047241|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033317 (Azospirillum brasilense strain Sp 7 plasmid p5, complete sequence) position: , mismatch: 7, identity: 0.781
ttgttgcgcgtcttctgctcgcgggtcaggct CRISPR spacer
ttgatcgccgtcttctgctcgtcggtcaggcc Protospacer
*** * *************. ********.
15. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP029540 (Aquitalea sp. USM4 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
cattcagcatcctgcacctgcgcgggcggggc Protospacer
. .* * *** *******************
16. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
gcgggctcttccgggaactgcgcgggcgggtc Protospacer
**. .******* * ************* *
17. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 8, identity: 0.75
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
gcgggctcttccgggaactgcgcgggcgggtc Protospacer
**. .******* * ************* *
18. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
gcgggctcttccgggaactgcgcgggcgggtc Protospacer
**. .******* * ************* *
19. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
gcgggctcttccgggaactgcgcgggcgggtc Protospacer
**. .******* * ************* *
20. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
gcgggctcttccgggaactgcgcgggcgggtc Protospacer
**. .******* * ************* *
21. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
gcgggctcttccgggagctgcgcgggcgggtc Protospacer
**. .******* * ************* *
22. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
gcgggctcttccgggaactgcgcgggcgggtc Protospacer
**. .******* * ************* *
23. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
gcgggctcttccgggaactgcgcgggcgggtc Protospacer
**. .******* * ************* *
24. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
gcgggctcttccgggaactgcgcgggcgggtc Protospacer
**. .******* * ************* *
25. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
gcgggctcttccgggaactgcgcgggcgggtc Protospacer
**. .******* * ************* *
26. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
gcgggctcttccgggaactgcgcgggcgggtc Protospacer
**. .******* * ************* *
27. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
gcgggctcttccgggaactgcgcgggcgggtc Protospacer
**. .******* * ************* *
28. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
gcgggctcttccgggaactgcgcgggcgggtc Protospacer
**. .******* * ************* *
29. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 8, identity: 0.75
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
gcgggctcttccgggaactgcgcgggcgggtc Protospacer
**. .******* * ************* *
30. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 8, identity: 0.75
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
gcgggctcttccgggagctgcgcgggcgggtc Protospacer
**. .******* * ************* *
31. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
gcgggctcttccgggaactgcgcgggcgggtc Protospacer
**. .******* * ************* *
32. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 8, identity: 0.75
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
gcgggctcttccgggaactgcgcgggcgggtc Protospacer
**. .******* * ************* *
33. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
gcgggctcttccgggaactgcgcgggcgggtc Protospacer
**. .******* * ************* *
34. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
gcgggctcttccgggaactgcgcgggcgggtc Protospacer
**. .******* * ************* *
35. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
gcgggctcttccgggaactgcgcgggcgggtc Protospacer
**. .******* * ************* *
36. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
gcgggctcttccgggaactgcgcgggcgggtc Protospacer
**. .******* * ************* *
37. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
gcgggctcttccgggaactgcgcgggcgggtc Protospacer
**. .******* * ************* *
38. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 8, identity: 0.75
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
gcgggctcttccgggaactgcgcgggcgggtc Protospacer
**. .******* * ************* *
39. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
gcgggctcttccgggaactgcgcgggcgggtc Protospacer
**. .******* * ************* *
40. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
gcgggctcttccgggaactgcgcgggcgggtc Protospacer
**. .******* * ************* *
41. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
gcgggctcttccgggaactgcgcgggcgggtc Protospacer
**. .******* * ************* *
42. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
gcgggctcttccgggaactgcgcgggcgggtc Protospacer
**. .******* * ************* *
43. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
gcgggctcttccgggaactgcgcgggcgggtc Protospacer
**. .******* * ************* *
44. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
gcgggctcttccgggaactgcgcgggcgggtc Protospacer
**. .******* * ************* *
45. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
gcgggctcttccgggaactgcgcgggcgggtc Protospacer
**. .******* * ************* *
46. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
gcgggctcttccgggaactgcgcgggcgggtc Protospacer
**. .******* * ************* *
47. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
gcgggctcttccgggaactgcgcgggcgggtc Protospacer
**. .******* * ************* *
48. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
gcgggctcttccgggaactgcgcgggcgggtc Protospacer
**. .******* * ************* *
49. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
gcgggctcttccgggaactgcgcgggcgggtc Protospacer
**. .******* * ************* *
50. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
gcgggctcttccgggaactgcgcgggcgggtc Protospacer
**. .******* * ************* *
51. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
gcgggctcttccgggaactgcgcgggcgggtc Protospacer
**. .******* * ************* *
52. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
gcgggctcttccgggaactgcgcgggcgggtc Protospacer
**. .******* * ************* *
53. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
gcgggctcttccgggaactgcgcgggcgggtc Protospacer
**. .******* * ************* *
54. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
gcgggctcttccgggaactgcgcgggcgggtc Protospacer
**. .******* * ************* *
55. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
gcgggctcttccgggaactgcgcgggcgggtc Protospacer
**. .******* * ************* *
56. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
gcgggctcttccgggaactgcgcgggcgggtc Protospacer
**. .******* * ************* *
57. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
gcgggctcttccgggaactgcgcgggcgggtc Protospacer
**. .******* * ************* *
58. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
gcgggctcttccgggaactgcgcgggcgggtc Protospacer
**. .******* * ************* *
59. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
gcgggctcttccgggaactgcgcgggcgggtc Protospacer
**. .******* * ************* *
60. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
gcgggctcttccgggaactgcgcgggcgggtc Protospacer
**. .******* * ************* *
61. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
gcgggctcttccgggaactgcgcgggcgggtc Protospacer
**. .******* * ************* *
62. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
gcgggctcttccgggaactgcgcgggcgggtc Protospacer
**. .******* * ************* *
63. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
gcgggctcttccgggaactgcgcgggcgggtc Protospacer
**. .******* * ************* *
64. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
gcgggctcttccgggaactgcgcgggcgggtc Protospacer
**. .******* * ************* *
65. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
gcgggctcttccgggaactgcgcgggcgggtc Protospacer
**. .******* * ************* *
66. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
gcgggctcttccgggaactgcgcgggcgggtc Protospacer
**. .******* * ************* *
67. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
gcgggctcttccgggaactgcgcgggcgggtc Protospacer
**. .******* * ************* *
68. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
gcgggctcttccgggaactgcgcgggcgggtc Protospacer
**. .******* * ************* *
69. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 8, identity: 0.75
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
gcgggctcttccgggaactgcgcgggcgggtc Protospacer
**. .******* * ************* *
70. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
gcgggctcttccgggaactgcgcgggcgggtc Protospacer
**. .******* * ************* *
71. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
gcgggctcttccgggaactgcgcgggcgggtc Protospacer
**. .******* * ************* *
72. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
gcgggctcttccgggaactgcgcgggcgggtc Protospacer
**. .******* * ************* *
73. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
gcgggctcttccgggaactgcgcgggcgggtc Protospacer
**. .******* * ************* *
74. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
gcgggctcttccgggaactgcgcgggcgggtc Protospacer
**. .******* * ************* *
75. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
gcgggctcttccgggaactgcgcgggcgggtc Protospacer
**. .******* * ************* *
76. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
gcgggctcttccgggaactgcgcgggcgggtc Protospacer
**. .******* * ************* *
77. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
gcgggctcttccgggaactgcgcgggcgggtc Protospacer
**. .******* * ************* *
78. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
gcgggctcttccgggaactgcgcgggcgggtc Protospacer
**. .******* * ************* *
79. spacer 1.2|1915046|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
cacagtcgcccacaaggcggcttagttttgga CRISPR spacer
cctattcgcccgcaaggcggcttagcttggac Protospacer
* .* ******.*************.** *.
80. spacer 1.2|1915046|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP030830 (Neorhizobium sp. NCHU2750 plasmid pNCHU2750c, complete sequence) position: , mismatch: 8, identity: 0.75
cacagtcgcccacaaggcggcttagttttgga CRISPR spacer
tcaactcgcccagcaggcggcttagtttgaga Protospacer
. * ******* ************** .**
81. spacer 1.7|1915346|32|NZ_CP047241|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021374 (Rhizobium sp. ACO-34A plasmid pRACO34Ab, complete sequence) position: , mismatch: 8, identity: 0.75
aaggcgttcttgctcggcacgttcggcagcaa CRISPR spacer
cagatgttcttcctcggcccgttcggcagtct Protospacer
**..****** ****** **********.
82. spacer 1.7|1915346|32|NZ_CP047241|CRISPRCasFinder,CRT,PILER-CR matches to NC_048860 (Microbacterium phage Arete, complete genome) position: , mismatch: 8, identity: 0.75
aaggcgttcttgctcggcacgttcggcagcaa CRISPR spacer
gtgcccgactcgctcggcaccttcggcagcaa Protospacer
. * * **.********* ***********
83. spacer 1.13|1915706|32|NZ_CP047241|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034999 (Rhizobium acidisoli strain FH23 plasmid pRapFH23a, complete sequence) position: , mismatch: 8, identity: 0.75
ataagt-cagggtaagcattgccgccttcggac CRISPR spacer
-caggcagagggcaagcattgcggccttcggaa Protospacer
.*.*. ****.********* *********
84. spacer 1.14|1915766|32|NZ_CP047241|CRISPRCasFinder,CRT,PILER-CR matches to MH617305 (Microviridae sp. isolate ctbe084, complete genome) position: , mismatch: 8, identity: 0.75
gaaacgccaaagccgaagatttcctccagctt CRISPR spacer
ggaacgccagaggcgaagatttccttttgcag Protospacer
*.*******.** ************.. **
85. spacer 1.21|1916186|32|NZ_CP047241|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134455 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 13, complete sequence) position: , mismatch: 8, identity: 0.75
gcgccgagcaaggccgacgaatccg--tggctaa CRISPR spacer
ccgtcgagcagggccgacgaatccactcggcc-- Protospacer
**.******.*************. .***.
86. spacer 1.23|1916306|32|NZ_CP047241|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031947 (Ruegeria sp. AD91A plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
aacatttgcagacactcggcactgtccagcat CRISPR spacer
cacatttgcagacacgcggcaatggaccgggt Protospacer
************** ***** ** * * .*
87. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP042276 (Agrobacterium tumefaciens strain 186 plasmid pAt, complete sequence) position: , mismatch: 9, identity: 0.719
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
atcgtctcctccggcaccagcgcgggcggcgc Protospacer
. .* .*.********* ********** **
88. spacer 1.2|1915046|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NC_019846 (Sinorhizobium meliloti GR4 plasmid pRmeGR4a, complete sequence) position: , mismatch: 9, identity: 0.719
cacagtcgcccacaaggcggcttagttttgga CRISPR spacer
agaagtcgcccaaaaggcggctttgttcttct Protospacer
. ********* ********** ***.*
89. spacer 1.2|1915046|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP021826 (Sinorhizobium meliloti strain KH35c plasmid accessoryA, complete sequence) position: , mismatch: 9, identity: 0.719
cacagtcgcccacaaggcggcttagttttgga CRISPR spacer
agaagtcgcccaaaaggcggctttgttcttct Protospacer
. ********* ********** ***.*
90. spacer 1.8|1915406|32|NZ_CP047241|CRISPRCasFinder,CRT,PILER-CR matches to MK816297 (Pseudomonas virus PBPA162, complete genome) position: , mismatch: 9, identity: 0.719
ggaaaaacgctatttactcttcattggctcaa CRISPR spacer
ggaaaaccgctattttctcttcaaactcgctg Protospacer
****** ******** ******* * * .
91. spacer 1.8|1915406|32|NZ_CP047241|CRISPRCasFinder,CRT,PILER-CR matches to MN871474 (UNVERIFIED: Pseudomonas virus Pa-oumiga, complete genome) position: , mismatch: 9, identity: 0.719
ggaaaaacgctatttactcttcattggctcaa CRISPR spacer
ggaaaaccgctattttctcttcaaactcgctg Protospacer
****** ******** ******* * * .
92. spacer 1.8|1915406|32|NZ_CP047241|CRISPRCasFinder,CRT,PILER-CR matches to MN871471 (UNVERIFIED: Pseudomonas virus Pa-V, complete genome) position: , mismatch: 9, identity: 0.719
ggaaaaacgctatttactcttcattggctcaa CRISPR spacer
ggaaaaccgctattttctcttcaaactcgctg Protospacer
****** ******** ******* * * .
93. spacer 1.8|1915406|32|NZ_CP047241|CRISPRCasFinder,CRT,PILER-CR matches to MN871472 (UNVERIFIED: Pseudomonas virus Pa-X, complete genome) position: , mismatch: 9, identity: 0.719
ggaaaaacgctatttactcttcattggctcaa CRISPR spacer
ggaaaaccgctattttctcttcaaactcgctg Protospacer
****** ******** ******* * * .
94. spacer 1.9|1915466|32|NZ_CP047241|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 9, identity: 0.719
attcagtgcgccggtttcatcgccttcaatat CRISPR spacer
ggtcagagcgccggtttcatggccttcggagg Protospacer
. **** ************* ******.. .
95. spacer 1.9|1915466|32|NZ_CP047241|CRISPRCasFinder,CRT,PILER-CR matches to NC_049490 (Acinetobacter phage vB_AbaP_Berthold, complete genome) position: , mismatch: 9, identity: 0.719
attcagtgcgccggtttcatcgccttcaatat CRISPR spacer
catatcagcgtcgttttcatcgccttcaattt Protospacer
* ***.** **************** *
96. spacer 1.9|1915466|32|NZ_CP047241|CRISPRCasFinder,CRT,PILER-CR matches to MT741943 (Acinetobacter phage Meroveus, complete genome) position: , mismatch: 9, identity: 0.719
attcagtgcgccggtttcatcgccttcaatat CRISPR spacer
catatcagcgtcgttttcatcgccttcaattt Protospacer
* ***.** **************** *
97. spacer 1.9|1915466|32|NZ_CP047241|CRISPRCasFinder,CRT,PILER-CR matches to MN648195 (Acinetobacter phage Konradin, complete genome) position: , mismatch: 9, identity: 0.719
attcagtgcgccggtttcatcgccttcaatat CRISPR spacer
catatcagcgtcgttttcatcgccttcaattt Protospacer
* ***.** **************** *
98. spacer 1.9|1915466|32|NZ_CP047241|CRISPRCasFinder,CRT,PILER-CR matches to MN709128 (Acinetobacter phage Berthold, complete genome) position: , mismatch: 9, identity: 0.719
attcagtgcgccggtttcatcgccttcaatat CRISPR spacer
catatcagcgtcgttttcatcgccttcaattt Protospacer
* ***.** **************** *
99. spacer 1.9|1915466|32|NZ_CP047241|CRISPRCasFinder,CRT,PILER-CR matches to MN732883 (Acinetobacter phage Kimel, complete genome) position: , mismatch: 9, identity: 0.719
attcagtgcgccggtttcatcgccttcaatat CRISPR spacer
catatcagcgtcgttttcatcgccttcaattt Protospacer
* ***.** **************** *
100. spacer 1.9|1915466|32|NZ_CP047241|CRISPRCasFinder,CRT,PILER-CR matches to MT385367 (Acinetobacter phage Abraxas, complete genome) position: , mismatch: 9, identity: 0.719
attcagtgcgccggtttcatcgccttcaatat CRISPR spacer
catatcagcgtcgttttcatcgccttcaattt Protospacer
* ***.** **************** *
101. spacer 1.9|1915466|32|NZ_CP047241|CRISPRCasFinder,CRT,PILER-CR matches to MN662249 (Acinetobacter phage Stupor, complete genome) position: , mismatch: 9, identity: 0.719
attcagtgcgccggtttcatcgccttcaatat CRISPR spacer
catatcagcgtcgttttcatcgccttcaattt Protospacer
* ***.** **************** *
102. spacer 1.9|1915466|32|NZ_CP047241|CRISPRCasFinder,CRT,PILER-CR matches to NC_049441 (Acinetobacter phage KARL-1, complete genome) position: , mismatch: 9, identity: 0.719
attcagtgcgccggtttcatcgccttcaatat CRISPR spacer
catatcagcgtcgttttcatcgccttcaattt Protospacer
* ***.** **************** *
103. spacer 1.9|1915466|32|NZ_CP047241|CRISPRCasFinder,CRT,PILER-CR matches to NC_049511 (Acinetobacter phage AM101, complete genome) position: , mismatch: 9, identity: 0.719
attcagtgcgccggtttcatcgccttcaatat CRISPR spacer
catatcagcgtcgttttcatcgccttcaattt Protospacer
* ***.** **************** *
104. spacer 1.9|1915466|32|NZ_CP047241|CRISPRCasFinder,CRT,PILER-CR matches to NC_049479 (Acinetobacter phage vB_AbaP_Konradin, complete genome) position: , mismatch: 9, identity: 0.719
attcagtgcgccggtttcatcgccttcaatat CRISPR spacer
catatcagcgtcgttttcatcgccttcaattt Protospacer
* ***.** **************** *
105. spacer 1.9|1915466|32|NZ_CP047241|CRISPRCasFinder,CRT,PILER-CR matches to MH460829 (Acinetobacter phage vB_ApiM_fHyAci03, complete genome) position: , mismatch: 9, identity: 0.719
attcagtgcgccggtttcatcgccttcaatat CRISPR spacer
catatcagcgtcgttttcatcgccttcaattt Protospacer
* ***.** **************** *
106. spacer 1.9|1915466|32|NZ_CP047241|CRISPRCasFinder,CRT,PILER-CR matches to MN723850 (Acinetobacter phage Apostate, complete genome) position: , mismatch: 9, identity: 0.719
attcagtgcgccggtttcatcgccttcaatat CRISPR spacer
catatcagcgtcgttttcatcgccttcaattt Protospacer
* ***.** **************** *
107. spacer 1.9|1915466|32|NZ_CP047241|CRISPRCasFinder,CRT,PILER-CR matches to NC_049492 (Acinetobacter phage vB_AbaP_Kimel, complete genome) position: , mismatch: 9, identity: 0.719
attcagtgcgccggtttcatcgccttcaatat CRISPR spacer
catatcagcgtcgttttcatcgccttcaattt Protospacer
* ***.** **************** *
108. spacer 1.9|1915466|32|NZ_CP047241|CRISPRCasFinder,CRT,PILER-CR matches to MT409116 (Acinetobacter phage Octan, complete genome) position: , mismatch: 9, identity: 0.719
attcagtgcgccggtttcatcgccttcaatat CRISPR spacer
catatcagcgtcgttttcatcgccttcaattt Protospacer
* ***.** **************** *
109. spacer 1.9|1915466|32|NZ_CP047241|CRISPRCasFinder,CRT,PILER-CR matches to NC_049491 (Acinetobacter phage vB_AbaP_Apostate, complete genome) position: , mismatch: 9, identity: 0.719
attcagtgcgccggtttcatcgccttcaatat CRISPR spacer
catatcagcgtcgttttcatcgccttcaattt Protospacer
* ***.** **************** *
110. spacer 1.14|1915766|32|NZ_CP047241|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP040895 (Leclercia adecarboxylata strain Z96-1 plasmid pIMP-Z96-1, complete sequence) position: , mismatch: 9, identity: 0.719
gaaacgccaaagccgaagatttcctccagctt CRISPR spacer
gaaacgccaaaggcgaagatatcttgaaaaaa Protospacer
************ ******* **.* *.
111. spacer 1.15|1915826|32|NZ_CP047241|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049248 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
ccggcaagcgctttggcacagggcattgcaac CRISPR spacer
gcggcaagcgctgtggcaaagggcaggctgat Protospacer
*********** ***** ****** ..*.
112. spacer 1.23|1916306|32|NZ_CP047241|CRISPRCasFinder,CRT,PILER-CR matches to LC155907 (Achromobacter xylosoxidans plasmid pKUN4507_2 DNA, complete sequence, strain: KUN4507) position: , mismatch: 9, identity: 0.719
aacatttgcagacactcggcactgtccagcat CRISPR spacer
gcctgcgccagacgctcggcactgtccaccat Protospacer
. * . *****.************** ***
113. spacer 1.23|1916306|32|NZ_CP047241|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026220 (Aeromonas sp. ASNIH4 plasmid pAER-a82d, complete sequence) position: , mismatch: 9, identity: 0.719
aacatttgcagacactcggcactgtccagcat CRISPR spacer
gcctgcgccagacgctcggcactgtccaccat Protospacer
. * . *****.************** ***
114. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP027299 (Streptomyces sp. SGAir0924 plasmid unnamed_5) position: , mismatch: 10, identity: 0.688
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
agaagggtctccgccgcctgcgcgggcggggc Protospacer
.* . ..**** *.****************
115. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP020443 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
cgcggggctttcagcacctgcgcgggcgggcc Protospacer
. . . ***.*.***************** *
116. spacer 1.1|1914986|32|NZ_CP047241|CRISPRCasFinder,CRT matches to MH617445 (Inoviridae sp. isolate ctcf2, complete genome) position: , mismatch: 10, identity: 0.688
tcgataccttccggcacctgcgcgggcggggc CRISPR spacer
gccgccatttcctgcaccagcgcgggcggggg Protospacer
* .. .**** ***** ************
117. spacer 1.2|1915046|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP039920 (Agrobacterium tumefaciens strain CFBP6626 plasmid pAtCFBP6626c, complete sequence) position: , mismatch: 10, identity: 0.688
cacagtcgcccacaaggcggcttagttttgga CRISPR spacer
tcaactcgcccagcaggcggcttagtttgaag Protospacer
. * ******* ************** ...
118. spacer 1.2|1915046|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP039694 (Agrobacterium larrymoorei strain CFBP5473 plasmid pTiCFBP5473, complete sequence) position: , mismatch: 10, identity: 0.688
cacagtcgcccacaaggcggcttagttttgga CRISPR spacer
tcaactcgcccagcaggcggcttagtttgaag Protospacer
. * ******* ************** ...
119. spacer 1.2|1915046|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP048637 (Rhizobium oryzihabitans strain M15 plasmid p5, complete sequence) position: , mismatch: 10, identity: 0.688
cacagtcgcccacaaggcggcttagttttgga CRISPR spacer
tcaactcgcccagcaggcggcttagtttgaag Protospacer
. * ******* ************** ...
120. spacer 1.2|1915046|32|NZ_CP047241|CRISPRCasFinder,CRT matches to NZ_CP032928 (Agrobacterium tumefaciens strain 1D1460 plasmid pAt1D1460, complete sequence) position: , mismatch: 10, identity: 0.688
cacagtcgcccacaaggcggcttagttttgga CRISPR spacer
tcaactcgcccagcaggcggcttagtttcaag Protospacer
. * ******* **************....
121. spacer 1.9|1915466|32|NZ_CP047241|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028385 (Providencia heimbachae strain 99101 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
attcagtgcgccggtttcatcgccttcaatat CRISPR spacer
agacagtgcgacgctttcatcgcctttttcgc Protospacer
* ******* ** ************. ...
122. spacer 1.9|1915466|32|NZ_CP047241|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053207 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence) position: , mismatch: 10, identity: 0.688
attcagtgcgccggtttcatcgccttcaatat CRISPR spacer
cgtggcagcgccggattcttcgccttcaatca Protospacer
* . ******* *** ***********
123. spacer 1.12|1915646|32|NZ_CP047241|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022727 (Erwinia persicina strain B64 plasmid pEP2, complete sequence) position: , mismatch: 10, identity: 0.688
tggggtcagcataaccccaaaagggtcatgat CRISPR spacer
atgggacagcatgaccccaaaagggctgacct Protospacer
*** ******.************... *
124. spacer 1.16|1915886|32|NZ_CP047241|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP054606 (Sulfitobacter pseudonitzschiae strain H46 plasmid unnamed7, complete sequence) position: , mismatch: 10, identity: 0.688
agttactgcgtgaagctggacgttttgaggat CRISPR spacer
cagcgtgtcgtgaagctggacgtttttcggat Protospacer
. ... ****************** ****
125. spacer 1.20|1916126|32|NZ_CP047241|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 10, identity: 0.688
cccagcggcccagcagacgccggcatgattca CRISPR spacer
agtcgcggcccagccgacgccggaatgacgtt Protospacer
. ********** ******** ****. .
126. spacer 1.11|1915586|32|NZ_CP047241|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021678 (Bacillus licheniformis strain SRCM100027 plasmid pBL027-1 sequence) position: , mismatch: 11, identity: 0.656
caacgtcaccgtttttccagctattctgaagc CRISPR spacer
tttagtcaccgtttttccaccttttcttctct Protospacer
. *************** ** **** .
