Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP047359 Rickettsia japonica strain LA16/2015 chromosome, complete genome 2 crisprs DEDDh 0 1 0 0

Results visualization

1. NZ_CP047359
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047359_1 307358-307458 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047359_2 902849-902950 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP047359_1 1.1|307394|29|NZ_CP047359|CRISPRCasFinder 307394-307422 29 NC_042028 Acinetobacter phage AB1, complete genome 29746-29774 6 0.793

1. spacer 1.1|307394|29|NZ_CP047359|CRISPRCasFinder matches to NC_042028 (Acinetobacter phage AB1, complete genome) position: , mismatch: 6, identity: 0.793

gtgtttctagcatattaatatctcaatac	CRISPR spacer
gtgtttcaagcatcttaatatctccaaga	Protospacer
******* ***** ********** * . 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage