Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP023861 Listeria monocytogenes EGD-e chromosome, complete genome 4 crisprs DinG,cas3,WYL,casR,csa3,DEDDh 0 2 6 0

Results visualization

1. NZ_CP023861
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023861_1 210311-210462 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023861_2 544374-544662 Orphan I-A
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023861_3 1136612-1136691 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023861_4 2779693-2779803 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP023861_2 2.3|544533|35|NZ_CP023861|PILER-CR,CRISPRCasFinder,CRT 544533-544567 35 MH341453 Listeria phage PSU-VKH-LP041, complete genome 10139-10173 1 0.971
NZ_CP023861_2 2.3|544533|35|NZ_CP023861|PILER-CR,CRISPRCasFinder,CRT 544533-544567 35 NC_009813 Listeria phage B054, complete genome 10139-10173 2 0.943
NZ_CP023861_3 3.1|1136637|30|NZ_CP023861|CRISPRCasFinder 1136637-1136666 30 LC492751 Staphylococcus phage KSAP7 genomic DNA, compelete genome 2378-2407 7 0.767
NZ_CP023861_3 3.1|1136637|30|NZ_CP023861|CRISPRCasFinder 1136637-1136666 30 LC492752 Staphylococcus phage KSAP11 genomic DNA, compelete genome 2378-2407 7 0.767

1. spacer 2.3|544533|35|NZ_CP023861|PILER-CR,CRISPRCasFinder,CRT matches to MH341453 (Listeria phage PSU-VKH-LP041, complete genome) position: , mismatch: 1, identity: 0.971

gcgatttttgtcaaagggacagcgatgggttacaa	CRISPR spacer
gcgatttttgtcaaaggaacagcgatgggttacaa	Protospacer
*****************.*****************

2. spacer 2.3|544533|35|NZ_CP023861|PILER-CR,CRISPRCasFinder,CRT matches to NC_009813 (Listeria phage B054, complete genome) position: , mismatch: 2, identity: 0.943

gcgatttttgtcaaagggacagcgatgggttacaa	CRISPR spacer
gcgatttttgtcaaaggaacggcgatgggttacaa	Protospacer
*****************.**.**************

3. spacer 3.1|1136637|30|NZ_CP023861|CRISPRCasFinder matches to LC492751 (Staphylococcus phage KSAP7 genomic DNA, compelete genome) position: , mismatch: 7, identity: 0.767

tttacaaatacataatatcagattatataa	CRISPR spacer
cttacaaatacattatatcatattcttttt	Protospacer
.************ ****** *** * *  

4. spacer 3.1|1136637|30|NZ_CP023861|CRISPRCasFinder matches to LC492752 (Staphylococcus phage KSAP11 genomic DNA, compelete genome) position: , mismatch: 7, identity: 0.767

tttacaaatacataatatcagattatataa	CRISPR spacer
cttacaaatacattatatcatattcttttt	Protospacer
.************ ****** *** * *  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 120651 : 127176 10 Listeria_phage(33.33%) tail NA
DBSCAN-SWA_2 1124077 : 1149719 27 Streptococcus_phage(66.67%) integrase attL 1129849:1129864|attR 1153641:1153656
DBSCAN-SWA_3 1285607 : 1345099 58 Bacillus_virus(16.67%) protease,tRNA NA
DBSCAN-SWA_4 1838048 : 1846334 8 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_5 2360905 : 2403233 66 Listeria_phage(96.61%) coat,plate,terminase,tail,portal,holin NA
DBSCAN-SWA_6 2546526 : 2554370 7 Streptococcus_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage