Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP031983 Acinetobacter haemolyticus strain AN4 plasmid pAhaemAN4a, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP031980 Acinetobacter haemolyticus strain AN4 plasmid pAhaemAN4d, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP031981 Acinetobacter haemolyticus strain AN4 plasmid pAhaemAN4c, complete sequence 1 crisprs NA 0 1 0 0
NZ_CP031979 Acinetobacter haemolyticus strain AN4 chromosome, complete genome 4 crisprs cas3,WYL,DEDDh,csa3 5 3 20 1
NZ_CP031982 Acinetobacter haemolyticus strain AN4 plasmid pAhaemAN4b, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP031980
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 7660 : 62124 45 Vibrio_phage(29.41%) integrase,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP031979
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP031979_1 639416-639509 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP031979_2 1503481-1503688 Orphan I-F
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP031979_3 2755597-2755694 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP031979_4 2999078-2999398 Orphan NA
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP031979_4 4.1|2999114|18|NZ_CP031979|CRT 2999114-2999131 18 NZ_CP031979.1 2999399-2999416 1 0.944
NZ_CP031979_4 4.1|2999114|18|NZ_CP031979|CRT 2999114-2999131 18 NZ_CP031979.1 3000827-3000844 1 0.944
NZ_CP031979_4 4.2|2999168|30|NZ_CP031979|CRT 2999168-2999197 30 NZ_CP031979.1 2999387-2999416 0 1.0
NZ_CP031979_4 4.2|2999168|30|NZ_CP031979|CRT 2999168-2999197 30 NZ_CP031979.1 3000815-3000844 0 1.0
NZ_CP031979_4 4.3|2999234|18|NZ_CP031979|CRT 2999234-2999251 18 NZ_CP031979.1 2999399-2999416 0 1.0
NZ_CP031979_4 4.3|2999234|18|NZ_CP031979|CRT 2999234-2999251 18 NZ_CP031979.1 3000827-3000844 0 1.0
NZ_CP031979_4 4.4|2999288|18|NZ_CP031979|CRT 2999288-2999305 18 NZ_CP031979.1 2999399-2999416 1 0.944
NZ_CP031979_4 4.4|2999288|18|NZ_CP031979|CRT 2999288-2999305 18 NZ_CP031979.1 3000827-3000844 1 0.944
NZ_CP031979_4 4.5|2999342|21|NZ_CP031979|CRT 2999342-2999362 21 NZ_CP031979.1 2999399-2999419 0 1.0
NZ_CP031979_4 4.5|2999342|21|NZ_CP031979|CRT 2999342-2999362 21 NZ_CP031979.1 3000827-3000847 0 1.0

1. spacer 4.1|2999114|18|NZ_CP031979|CRT matches to position: 2999399-2999416, mismatch: 1, identity: 0.944

ccaatcactggcatcatt	CRISPR spacer
ccaatcactggcattatt	Protospacer
**************.***

2. spacer 4.1|2999114|18|NZ_CP031979|CRT matches to position: 3000827-3000844, mismatch: 1, identity: 0.944

ccaatcactggcatcatt	CRISPR spacer
ccaatcactggcattatt	Protospacer
**************.***

3. spacer 4.2|2999168|30|NZ_CP031979|CRT matches to position: 2999387-2999416, mismatch: 0, identity: 1.0

ggtttattaagcccaatcactggcattatt	CRISPR spacer
ggtttattaagcccaatcactggcattatt	Protospacer
******************************

4. spacer 4.2|2999168|30|NZ_CP031979|CRT matches to position: 3000815-3000844, mismatch: 0, identity: 1.0

ggtttattaagcccaatcactggcattatt	CRISPR spacer
ggtttattaagcccaatcactggcattatt	Protospacer
******************************

5. spacer 4.3|2999234|18|NZ_CP031979|CRT matches to position: 2999399-2999416, mismatch: 0, identity: 1.0

ccaatcactggcattatt	CRISPR spacer
ccaatcactggcattatt	Protospacer
******************

6. spacer 4.3|2999234|18|NZ_CP031979|CRT matches to position: 3000827-3000844, mismatch: 0, identity: 1.0

ccaatcactggcattatt	CRISPR spacer
ccaatcactggcattatt	Protospacer
******************

7. spacer 4.4|2999288|18|NZ_CP031979|CRT matches to position: 2999399-2999416, mismatch: 1, identity: 0.944

ccaatcactggcatcatt	CRISPR spacer
ccaatcactggcattatt	Protospacer
**************.***

8. spacer 4.4|2999288|18|NZ_CP031979|CRT matches to position: 3000827-3000844, mismatch: 1, identity: 0.944

ccaatcactggcatcatt	CRISPR spacer
ccaatcactggcattatt	Protospacer
**************.***

9. spacer 4.5|2999342|21|NZ_CP031979|CRT matches to position: 2999399-2999419, mismatch: 0, identity: 1.0

ccaatcactggcattattggt	CRISPR spacer
ccaatcactggcattattggt	Protospacer
*********************

10. spacer 4.5|2999342|21|NZ_CP031979|CRT matches to position: 3000827-3000847, mismatch: 0, identity: 1.0

ccaatcactggcattattggt	CRISPR spacer
ccaatcactggcattattggt	Protospacer
*********************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP031979_4 4.2|2999168|30|NZ_CP031979|CRT 2999168-2999197 30 NZ_CP040048 Acinetobacter baumannii strain VB1190 plasmid unnamed1, complete sequence 572753-572782 6 0.8
NZ_CP031979_2 2.3|1503629|32|NZ_CP031979|CRISPRCasFinder,CRT,PILER-CR 1503629-1503660 32 NC_019526 Enterobacteria phage vB_KleM-RaK2, complete genome 133452-133483 8 0.75
NZ_CP031979_2 2.3|1503629|32|NZ_CP031979|CRISPRCasFinder,CRT,PILER-CR 1503629-1503660 32 MT708547 Klebsiella phage Muenster, complete genome 256186-256217 8 0.75
NZ_CP031979_2 2.3|1503629|32|NZ_CP031979|CRISPRCasFinder,CRT,PILER-CR 1503629-1503660 32 AB897757 Klebsiella phage K64-1 DNA, complete genome 133403-133434 8 0.75
NZ_CP031979_2 2.3|1503629|32|NZ_CP031979|CRISPRCasFinder,CRT,PILER-CR 1503629-1503660 32 NZ_CP023514 Enterococcus sp. FDAARGOS_375 plasmid unnamed1, complete sequence 105874-105905 8 0.75
NZ_CP031979_2 2.3|1503629|32|NZ_CP031979|CRISPRCasFinder,CRT,PILER-CR 1503629-1503660 32 MN693967 Marine virus AFVG_250M992, complete genome 26160-26191 8 0.75
NZ_CP031979_2 2.1|1503509|32|NZ_CP031979|CRISPRCasFinder,CRT 1503509-1503540 32 NZ_CP028268 Pediococcus pentosaceus strain SRCM102739 plasmid unnamed2, complete sequence 16654-16685 9 0.719
NZ_CP031979_2 2.1|1503509|32|NZ_CP031979|CRISPRCasFinder,CRT 1503509-1503540 32 NC_021529 Vibrio phage nt-1, complete genome 193447-193478 9 0.719
NZ_CP031979_2 2.1|1503509|32|NZ_CP031979|CRISPRCasFinder,CRT 1503509-1503540 32 KX349253 Synechococcus phage S-RIM2 isolate Np_33_0912, complete genome 31363-31394 9 0.719
NZ_CP031979_2 2.1|1503509|32|NZ_CP031979|CRISPRCasFinder,CRT 1503509-1503540 32 KX349251 Synechococcus phage S-RIM2 isolate Np_24_1112, complete genome 31366-31397 9 0.719
NZ_CP031979_2 2.1|1503509|32|NZ_CP031979|CRISPRCasFinder,CRT 1503509-1503540 32 KX349268 Synechococcus phage S-RIM2 isolate RW_30_0905, complete genome 31369-31400 9 0.719
NZ_CP031979_2 2.1|1503509|32|NZ_CP031979|CRISPRCasFinder,CRT 1503509-1503540 32 KX349230 Synechococcus phage S-RIM2 isolate LIS_02_1013, complete genome 31710-31741 9 0.719
NZ_CP031979_2 2.1|1503509|32|NZ_CP031979|CRISPRCasFinder,CRT 1503509-1503540 32 MF042360 Pseudomonas phage Phabio, complete genome 227106-227137 9 0.719
NZ_CP031979_2 2.3|1503629|32|NZ_CP031979|CRISPRCasFinder,CRT,PILER-CR 1503629-1503660 32 NZ_CP033935 Chryseobacterium balustinum strain KC_1863 plasmid unnamed, complete sequence 17595-17626 9 0.719
NZ_CP031979_2 2.3|1503629|32|NZ_CP031979|CRISPRCasFinder,CRT,PILER-CR 1503629-1503660 32 NC_048015 Cyanophage S-TIM4, complete genome 145348-145379 9 0.719
NZ_CP031979_2 2.3|1503629|32|NZ_CP031979|CRISPRCasFinder,CRT,PILER-CR 1503629-1503660 32 MH512890 Cyanophage S-TIM4 145348-145379 9 0.719
NZ_CP031979_2 2.3|1503629|32|NZ_CP031979|CRISPRCasFinder,CRT,PILER-CR 1503629-1503660 32 NC_015283 Prochlorococcus phage P-RSM4, complete genome 145281-145312 9 0.719
NZ_CP031979_2 2.1|1503509|32|NZ_CP031979|CRISPRCasFinder,CRT 1503509-1503540 32 MN693397 Marine virus AFVG_25M279, complete genome 27311-27342 10 0.688
NZ_CP031979_2 2.1|1503509|32|NZ_CP031979|CRISPRCasFinder,CRT 1503509-1503540 32 MN693087 Marine virus AFVG_25M280, complete genome 25316-25347 10 0.688
NZ_CP031979_2 2.1|1503509|32|NZ_CP031979|CRISPRCasFinder,CRT 1503509-1503540 32 MN693388 Marine virus AFVG_25M277, complete genome 3618-3649 10 0.688
NZ_CP031979_2 2.1|1503509|32|NZ_CP031979|CRISPRCasFinder,CRT 1503509-1503540 32 MN693389 Marine virus AFVG_25M278, complete genome 1147-1178 10 0.688
NZ_CP031979_2 2.1|1503509|32|NZ_CP031979|CRISPRCasFinder,CRT 1503509-1503540 32 MN693389 Marine virus AFVG_25M278, complete genome 31527-31558 10 0.688

1. spacer 4.2|2999168|30|NZ_CP031979|CRT matches to NZ_CP040048 (Acinetobacter baumannii strain VB1190 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

ggtttattaagcccaatcactggcattatt	CRISPR spacer
gatattttaagcccgattactggcattatc	Protospacer
*.* * ********.**.***********.

2. spacer 2.3|1503629|32|NZ_CP031979|CRISPRCasFinder,CRT,PILER-CR matches to NC_019526 (Enterobacteria phage vB_KleM-RaK2, complete genome) position: , mismatch: 8, identity: 0.75

aattaaaagtaattcttgatgagtatgtgttg	CRISPR spacer
gtttaaaagtaattcttgaaaagtattatttt	Protospacer
. ***************** .*****   ** 

3. spacer 2.3|1503629|32|NZ_CP031979|CRISPRCasFinder,CRT,PILER-CR matches to MT708547 (Klebsiella phage Muenster, complete genome) position: , mismatch: 8, identity: 0.75

aattaaaagtaattcttgatgagtatgtgttg	CRISPR spacer
gtttaaaagtaattcttgaaaagtattatttt	Protospacer
. ***************** .*****   ** 

4. spacer 2.3|1503629|32|NZ_CP031979|CRISPRCasFinder,CRT,PILER-CR matches to AB897757 (Klebsiella phage K64-1 DNA, complete genome) position: , mismatch: 8, identity: 0.75

aattaaaagtaattcttgatgagtatgtgttg	CRISPR spacer
gtttaaaagtaattcttgaaaagtattatttt	Protospacer
. ***************** .*****   ** 

5. spacer 2.3|1503629|32|NZ_CP031979|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023514 (Enterococcus sp. FDAARGOS_375 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

--aattaaaagtaattcttgatgagtatgtgttg	CRISPR spacer
ttatttcaga--aattcttgatgagtaggtgtaa	Protospacer
  * ** *.*  *************** **** .

6. spacer 2.3|1503629|32|NZ_CP031979|CRISPRCasFinder,CRT,PILER-CR matches to MN693967 (Marine virus AFVG_250M992, complete genome) position: , mismatch: 8, identity: 0.75

-----aattaaaagtaattcttgatgagtatgtgttg	CRISPR spacer
ccaagtatt-----taatcctggatgagtatgtgttg	Protospacer
      ***     ****.** ***************

7. spacer 2.1|1503509|32|NZ_CP031979|CRISPRCasFinder,CRT matches to NZ_CP028268 (Pediococcus pentosaceus strain SRCM102739 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

caacaatggctacagatacagctacaaagtta	CRISPR spacer
tttcagtggctactgatacagctacaattgga	Protospacer
.  **.******* *************    *

8. spacer 2.1|1503509|32|NZ_CP031979|CRISPRCasFinder,CRT matches to NC_021529 (Vibrio phage nt-1, complete genome) position: , mismatch: 9, identity: 0.719

caacaatggctacagatacagctacaaagtta	CRISPR spacer
tgaatttggctacaaatacatctacaaagatt	Protospacer
..*   ********.***** ******** * 

9. spacer 2.1|1503509|32|NZ_CP031979|CRISPRCasFinder,CRT matches to KX349253 (Synechococcus phage S-RIM2 isolate Np_33_0912, complete genome) position: , mismatch: 9, identity: 0.719

caacaatggctacagatacagctacaaagtta	CRISPR spacer
cagttcacgctacagatacatctacaaacttg	Protospacer
**..    ************ ******* **.

10. spacer 2.1|1503509|32|NZ_CP031979|CRISPRCasFinder,CRT matches to KX349251 (Synechococcus phage S-RIM2 isolate Np_24_1112, complete genome) position: , mismatch: 9, identity: 0.719

caacaatggctacagatacagctacaaagtta	CRISPR spacer
cagttcacgctacagatacatctacaaacttg	Protospacer
**..    ************ ******* **.

11. spacer 2.1|1503509|32|NZ_CP031979|CRISPRCasFinder,CRT matches to KX349268 (Synechococcus phage S-RIM2 isolate RW_30_0905, complete genome) position: , mismatch: 9, identity: 0.719

caacaatggctacagatacagctacaaagtta	CRISPR spacer
cagttcacgctacagatacatctacaaacttg	Protospacer
**..    ************ ******* **.

12. spacer 2.1|1503509|32|NZ_CP031979|CRISPRCasFinder,CRT matches to KX349230 (Synechococcus phage S-RIM2 isolate LIS_02_1013, complete genome) position: , mismatch: 9, identity: 0.719

caacaatggctacagatacagctacaaagtta	CRISPR spacer
cagttcacgctacagatacatctacaaacttg	Protospacer
**..    ************ ******* **.

13. spacer 2.1|1503509|32|NZ_CP031979|CRISPRCasFinder,CRT matches to MF042360 (Pseudomonas phage Phabio, complete genome) position: , mismatch: 9, identity: 0.719

caacaatggctacagatacagctacaaagtta	CRISPR spacer
taggggtagctacaaatacagcttcaaagttt	Protospacer
.*. ..*.******.******** ******* 

14. spacer 2.3|1503629|32|NZ_CP031979|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033935 (Chryseobacterium balustinum strain KC_1863 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

aattaaaagtaattcttgatgagtatgtgttg	CRISPR spacer
aaacaaaaaaaattcttgatgagtatgaccac	Protospacer
** .****. *****************  .  

15. spacer 2.3|1503629|32|NZ_CP031979|CRISPRCasFinder,CRT,PILER-CR matches to NC_048015 (Cyanophage S-TIM4, complete genome) position: , mismatch: 9, identity: 0.719

aattaaaagtaattcttgatgagtatgtgttg	CRISPR spacer
aaagaaaagtaaatcatgatgagtatgaaaac	Protospacer
**  ******** ** *********** .   

16. spacer 2.3|1503629|32|NZ_CP031979|CRISPRCasFinder,CRT,PILER-CR matches to MH512890 (Cyanophage S-TIM4) position: , mismatch: 9, identity: 0.719

aattaaaagtaattcttgatgagtatgtgttg	CRISPR spacer
aaagaaaagtaaatcatgatgagtatgaaaac	Protospacer
**  ******** ** *********** .   

17. spacer 2.3|1503629|32|NZ_CP031979|CRISPRCasFinder,CRT,PILER-CR matches to NC_015283 (Prochlorococcus phage P-RSM4, complete genome) position: , mismatch: 9, identity: 0.719

aattaaaagtaattcttgatgagtatgtgttg	CRISPR spacer
aaagaaaagtaaatcatgatgagtatgaaaac	Protospacer
**  ******** ** *********** .   

18. spacer 2.1|1503509|32|NZ_CP031979|CRISPRCasFinder,CRT matches to MN693397 (Marine virus AFVG_25M279, complete genome) position: , mismatch: 10, identity: 0.688

caacaatggctacagatacagctacaaagtta	CRISPR spacer
ataaaatggctacagttacaggtacaagtggc	Protospacer
  * *********** ***** *****.    

19. spacer 2.1|1503509|32|NZ_CP031979|CRISPRCasFinder,CRT matches to MN693087 (Marine virus AFVG_25M280, complete genome) position: , mismatch: 10, identity: 0.688

caacaatggctacagatacagctacaaagtta	CRISPR spacer
ataaaatggctacagttacaggtacaagtggc	Protospacer
  * *********** ***** *****.    

20. spacer 2.1|1503509|32|NZ_CP031979|CRISPRCasFinder,CRT matches to MN693388 (Marine virus AFVG_25M277, complete genome) position: , mismatch: 10, identity: 0.688

caacaatggctacagatacagctacaaagtta	CRISPR spacer
ataaaatggctacagttacaggtacaagtggc	Protospacer
  * *********** ***** *****.    

21. spacer 2.1|1503509|32|NZ_CP031979|CRISPRCasFinder,CRT matches to MN693389 (Marine virus AFVG_25M278, complete genome) position: , mismatch: 10, identity: 0.688

caacaatggctacagatacagctacaaagtta	CRISPR spacer
ataaaatggctacagttacaggtacaagtggc	Protospacer
  * *********** ***** *****.    

22. spacer 2.1|1503509|32|NZ_CP031979|CRISPRCasFinder,CRT matches to MN693389 (Marine virus AFVG_25M278, complete genome) position: , mismatch: 10, identity: 0.688

caacaatggctacagatacagctacaaagtta	CRISPR spacer
acaaaatggctacagttacaggtacaagtggc	Protospacer
  * *********** ***** *****.    

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 105711 : 169166 54 Escherichia_phage(22.22%) transposase NA
DBSCAN-SWA_2 175234 : 243401 55 Enterobacteria_phage(20.0%) transposase,integrase attL 183360:183377|attR 252239:252256
DBSCAN-SWA_3 585340 : 636423 52 uncultured_virus(13.33%) transposase,tRNA NA
DBSCAN-SWA_4 651732 : 721114 57 uncultured_Caudovirales_phage(27.78%) integrase,tRNA,transposase attL 643849:643865|attR 683975:683991
DBSCAN-SWA_5 919728 : 942426 23 Hokovirus(14.29%) transposase,tRNA NA
DBSCAN-SWA_6 1102661 : 1161509 48 uncultured_virus(20.0%) transposase,protease NA
DBSCAN-SWA_7 1218744 : 1282671 83 Acinetobacter_phage(67.44%) transposase,capsid,terminase NA
DBSCAN-SWA_8 1286480 : 1351076 59 Acinetobacter_phage(31.58%) integrase,holin,transposase attL 1285509:1285525|attR 1289366:1289382
DBSCAN-SWA_9 1489010 : 1559601 58 Pseudomonas_phage(16.67%) transposase,tRNA NA
DBSCAN-SWA_10 1570362 : 1620143 46 Enterobacteria_phage(25.0%) transposase,tRNA,capsid NA
DBSCAN-SWA_11 1628720 : 1676417 40 Enterobacteria_phage(40.0%) transposase NA
DBSCAN-SWA_12 1769008 : 1837610 53 Faecalibacterium_phage(33.33%) transposase NA
DBSCAN-SWA_13 2184935 : 2240338 70 Acinetobacter_phage(63.41%) transposase,integrase,terminase,tail,capsid attL 2183954:2183969|attR 2203004:2203019
DBSCAN-SWA_14 2243415 : 2248558 9 Acinetobacter_phage(33.33%) integrase attL 2243495:2243510|attR 2249717:2249732
DBSCAN-SWA_15 2293937 : 2372955 75 Bordetella_phage(25.0%) integrase,transposase,head,terminase,protease,tRNA,tail attL 2331371:2331426|attR 2373740:2373795
DBSCAN-SWA_16 2452235 : 2646399 174 Enterobacteria_phage(23.26%) transposase,tRNA,integrase,protease attL 2546807:2546823|attR 2577482:2577498
DBSCAN-SWA_17 2958036 : 3005941 37 Paenibacillus_phage(16.67%) transposase,protease NA
DBSCAN-SWA_18 3209874 : 3252380 33 uncultured_virus(30.0%) transposase,integrase attL 3209387:3209402|attR 3251720:3251735
DBSCAN-SWA_19 3329143 : 3386511 55 Faecalibacterium_phage(16.67%) integrase,tRNA,transposase attL 3348331:3348350|attR 3388924:3388943
DBSCAN-SWA_20 3474665 : 3527458 45 Bacillus_virus(33.33%) protease,holin,tRNA,transposase NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_CP031979.1|WP_004640952.1|2979587_2979806_+|Sec-independent-protein-translocase-subunit-TatA 2979587_2979806_+ 72 aa aa NA NA NA 2958036-3005941 yes
3. NZ_CP031981
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP031981_1 748-843 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP044476 Acinetobacter schindleri strain HZE33-1 plasmid pHZE33-1-2, complete sequence 6018-6049 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP044476 Acinetobacter schindleri strain HZE33-1 plasmid pHZE33-1-2, complete sequence 6039-6070 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_LR026972 Acinetobacter baumannii strain KCRI-28 isolate RDK36_28 plasmid pKCRI-28-1, complete sequence 14314-14345 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_LR026972 Acinetobacter baumannii strain KCRI-28 isolate RDK36_28 plasmid pKCRI-28-1, complete sequence 14335-14366 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP023027 Acinetobacter baumannii strain 10042 plasmid pAba10042a, complete sequence 2706-2737 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP023027 Acinetobacter baumannii strain 10042 plasmid pAba10042a, complete sequence 2727-2758 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP020587 Acinetobacter nosocomialis strain SSA3 plasmid pSSA3_1, complete sequence 1572-1603 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP020587 Acinetobacter nosocomialis strain SSA3 plasmid pSSA3_1, complete sequence 1593-1624 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP021348 Acinetobacter baumannii strain B8300 plasmid pB8300, complete sequence 15134-15165 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP021348 Acinetobacter baumannii strain B8300 plasmid pB8300, complete sequence 15155-15186 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP023021 Acinetobacter baumannii strain 9201 plasmid pAba9201a, complete sequence 4058-4089 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP023021 Acinetobacter baumannii strain 9201 plasmid pAba9201a, complete sequence 4079-4110 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_KY499579 Acinetobacter pittii strain CCBH10253 plasmid pAP10253-1, complete sequence 6031-6062 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_KY499579 Acinetobacter pittii strain CCBH10253 plasmid pAP10253-1, complete sequence 6052-6083 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP027248 Acinetobacter pittii strain WCHAP100004 plasmid p2_100004, complete sequence 13480-13511 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP027248 Acinetobacter pittii strain WCHAP100004 plasmid p2_100004, complete sequence 13501-13532 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP028570 Acinetobacter pittii strain WCHAP005046 plasmid p2_005046, complete sequence 3684-3715 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP028570 Acinetobacter pittii strain WCHAP005046 plasmid p2_005046, complete sequence 3705-3736 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP031994 Acinetobacter haemolyticus strain 2126ch plasmid pAhaem2126chd, complete sequence 2307-2338 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP031994 Acinetobacter haemolyticus strain 2126ch plasmid pAhaem2126chd, complete sequence 2328-2359 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP044462 Acinetobacter indicus strain B18 plasmid pB18-7, complete sequence 3598-3629 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP044462 Acinetobacter indicus strain B18 plasmid pB18-7, complete sequence 3619-3650 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NC_010481 Acinetobacter baumannii plasmid pABIR, complete sequence 228-259 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NC_010481 Acinetobacter baumannii plasmid pABIR, complete sequence 249-280 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 CP033542 Acinetobacter pittii strain 2014S06-099 plasmid p2014S06-099-2, complete sequence 59-90 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 CP033542 Acinetobacter pittii strain 2014S06-099 plasmid p2014S06-099-2, complete sequence 80-111 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP038648 Acinetobacter baumannii strain ACN21 plasmid unnamed4, complete sequence 1817-1848 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP038648 Acinetobacter baumannii strain ACN21 plasmid unnamed4, complete sequence 1838-1869 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 CP033571 Acinetobacter pittii strain 2014N21-145 plasmid p2014N21-145-3, complete sequence 6654-6685 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 CP033571 Acinetobacter pittii strain 2014N21-145 plasmid p2014N21-145-3, complete sequence 6675-6706 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP033132 Acinetobacter wuhouensis strain WCHAW010062 plasmid pOXA653_010062, complete sequence 8645-8676 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP033132 Acinetobacter wuhouensis strain WCHAW010062 plasmid pOXA653_010062, complete sequence 8666-8697 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP033752 Acinetobacter baumannii strain FDAARGOS_540 plasmid unnamed2, complete sequence 9523-9554 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP033752 Acinetobacter baumannii strain FDAARGOS_540 plasmid unnamed2, complete sequence 9544-9575 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP027252 Acinetobacter pittii strain WCHAP100020 plasmid p2_100020, complete sequence 8103-8134 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP027252 Acinetobacter pittii strain WCHAP100020 plasmid p2_100020, complete sequence 8124-8155 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_LT984691 Acinetobacter baumannii isolate K50 plasmid II, complete sequence 9414-9445 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_LT984691 Acinetobacter baumannii isolate K50 plasmid II, complete sequence 9435-9466 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP029572 Acinetobacter baumannii strain DA33098 plasmid pDA33098-9-2, complete sequence 6928-6959 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP029572 Acinetobacter baumannii strain DA33098 plasmid pDA33098-9-2, complete sequence 6949-6980 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 MN461228 Acinetobacter pittii strain A2584 plasmid pA2584, complete sequence 3638-3669 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 MN461228 Acinetobacter pittii strain A2584 plasmid pA2584, complete sequence 3659-3690 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 MN481286 Acinetobacter baylyi strain A2702 plasmid pA2702, complete sequence 2718-2749 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 MN481286 Acinetobacter baylyi strain A2702 plasmid pA2702, complete sequence 2739-2770 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 MN495625 Acinetobacter baumannii strain A2485 plasmid pA2485, complete sequence 8318-8349 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 MN495625 Acinetobacter baumannii strain A2485 plasmid pA2485, complete sequence 8339-8370 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 MN495626 Acinetobacter baumannii strain A2503 plasmid pA2503, complete sequence 8318-8349 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 MN495626 Acinetobacter baumannii strain A2503 plasmid pA2503, complete sequence 8339-8370 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP051871 Acinetobacter baumannii strain Ab-D10a-a plasmid pAb-D10a-a_2, complete sequence 2122-2153 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP051871 Acinetobacter baumannii strain Ab-D10a-a plasmid pAb-D10a-a_2, complete sequence 2143-2174 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NC_013506 Acinetobacter baumannii plasmid pMMCU2, complete sequence 8537-8568 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NC_013506 Acinetobacter baumannii plasmid pMMCU2, complete sequence 8558-8589 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 MK978160 Acinetobacter lwoffii strain M2a plasmid pAVAci119, complete sequence 2818-2849 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 MK978160 Acinetobacter lwoffii strain M2a plasmid pAVAci119, complete sequence 2839-2870 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NC_013056 Acinetobacter calcoaceticus strain Acal H12O-07 plasmid pMMCU1, complete sequence 7752-7783 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NC_013056 Acinetobacter calcoaceticus strain Acal H12O-07 plasmid pMMCU1, complete sequence 7773-7804 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 CP042207 Acinetobacter baumannii strain DS002 plasmid pTS9900, complete sequence 8144-8175 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 CP042207 Acinetobacter baumannii strain DS002 plasmid pTS9900, complete sequence 8165-8196 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP042367 Acinetobacter pittii strain C54 plasmid pC54_003, complete sequence 10198-10229 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP042367 Acinetobacter pittii strain C54 plasmid pC54_003, complete sequence 10219-10250 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP018141 Acinetobacter larvae strain BRTC-1 plasmid pRW1, complete sequence 4129-4160 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP018141 Acinetobacter larvae strain BRTC-1 plasmid pRW1, complete sequence 4150-4181 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP038260 Acinetobacter baumannii strain 39741 plasmid pEH_gr3, complete sequence 10478-10509 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP038260 Acinetobacter baumannii strain 39741 plasmid pEH_gr3, complete sequence 10499-10530 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP049810 Acinetobacter pittii strain A1254 plasmid pA1254_4, complete sequence 7568-7599 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP049810 Acinetobacter pittii strain A1254 plasmid pA1254_4, complete sequence 7589-7620 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP015146 Acinetobacter pittii strain IEC338SC plasmid pIEC338SCOX, complete sequence 247-278 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP015146 Acinetobacter pittii strain IEC338SC plasmid pIEC338SCOX, complete sequence 268-299 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP051877 Acinetobacter baumannii strain Ab-B004d-c plasmid pAb-B004d-c_2, complete sequence 1389-1420 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP051877 Acinetobacter baumannii strain Ab-B004d-c plasmid pAb-B004d-c_2, complete sequence 1410-1441 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP031981 Acinetobacter haemolyticus strain AN4 plasmid pAhaemAN4c, complete sequence 759-790 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP031981 Acinetobacter haemolyticus strain AN4 plasmid pAhaemAN4c, complete sequence 780-811 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP026427 Acinetobacter sp. ACNIH1 plasmid unnamed, complete sequence 6952-6983 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP026427 Acinetobacter sp. ACNIH1 plasmid unnamed, complete sequence 6973-7004 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP014479 Acinetobacter pittii strain AP_882 plasmid pOXA58-AP_882, complete sequence 17984-18015 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP014479 Acinetobacter pittii strain AP_882 plasmid pOXA58-AP_882, complete sequence 18005-18036 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP016899 Acinetobacter soli strain GFJ2 plasmid pGFJ3, complete sequence 2195-2226 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP016899 Acinetobacter soli strain GFJ2 plasmid pGFJ3, complete sequence 2216-2247 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP051868 Acinetobacter baumannii strain Ab-C63 plasmid pAb-C63_2, complete sequence 7686-7717 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP051868 Acinetobacter baumannii strain Ab-C63 plasmid pAb-C63_2, complete sequence 7707-7738 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NC_019280 Acinetobacter baumannii plasmid pMMD, complete sequence 7703-7734 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NC_019280 Acinetobacter baumannii plasmid pMMD, complete sequence 7724-7755 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP023035 Acinetobacter baumannii strain 5845 plasmid pAba5845a, complete sequence 2972-3003 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP023035 Acinetobacter baumannii strain 5845 plasmid pAba5845a, complete sequence 2993-3024 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_KT022421 Acinetobacter baumannii strain ML plasmid pAB-ML, complete sequence 4250-4281 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_KT022421 Acinetobacter baumannii strain ML plasmid pAB-ML, complete sequence 4271-4302 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP032127 Acinetobacter chinensis strain WCHAc010005 plasmid p1_010005, complete sequence 18027-18058 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP032127 Acinetobacter chinensis strain WCHAc010005 plasmid p1_010005, complete sequence 18048-18079 0 1.0
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP015112 Acinetobacter sp. TGL-Y2 plasmid unnamed2, complete sequence 7417-7448 1 0.969
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP015112 Acinetobacter sp. TGL-Y2 plasmid unnamed2, complete sequence 7438-7469 1 0.969
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP032275 Acinetobacter sp. WCHAc010034 plasmid p7_010034, complete sequence 4788-4819 1 0.969
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP032275 Acinetobacter sp. WCHAc010034 plasmid p7_010034, complete sequence 4809-4840 1 0.969
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP010354 Acinetobacter johnsonii XBB1 plasmid pXBB1-3, complete sequence 8559-8590 1 0.969
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP010354 Acinetobacter johnsonii XBB1 plasmid pXBB1-3, complete sequence 8580-8611 1 0.969
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP050406 Acinetobacter baumannii strain VB2486 plasmid pVB2486_3, complete sequence 9450-9481 1 0.969
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP050406 Acinetobacter baumannii strain VB2486 plasmid pVB2486_3, complete sequence 9471-9502 1 0.969
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP035940 Acinetobacter cumulans strain WCHAc060092 plasmid p5_060092, complete sequence 3221-3252 1 0.969
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP035940 Acinetobacter cumulans strain WCHAc060092 plasmid p5_060092, complete sequence 3242-3273 1 0.969
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NC_014312 Klebsiella pneumoniae plasmid pKP048, complete sequence 33923-33954 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_KY399978 Vibrio cholerae O139 strain ICDC-211 plasmid pVC211, complete sequence 33736-33767 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_AP023051 Citrobacter portucalensis strain IOMTU157 plasmid pIOMTU157, complete sequence 137476-137507 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 MF399199 Acinetobacter baumannii strain D46 plasmid pD46-4, complete sequence 81897-81928 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP016764 Citrobacter freundii strain B38 plasmid pOZ181, complete sequence 208670-208701 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NC_021728 Acinetobacter baumannii BJAB07104 plasmid p2BJAB07104, complete sequence 14498-14529 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_KX443408 Klebsiella pneumoniae strain SC24 plasmid pKSC24, complete sequence 59126-59157 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_KU302802 Enterobacter cloacae strain SZECL1 plasmid pNDM1_SZ2 clone ST231, complete sequence 72945-72976 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_KX009507 Escherichia coli strain 06K2206 plasmid LM6771, complete sequence 30580-30611 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_KU302801 Enterobacter cloacae strain SZECL1 plasmid pNDM1_SZ1 clone ST231, complete sequence 72945-72976 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_KM083064 Vibrio cholerae strain ICDC-1447 plasmid pVC1447, complete sequence 11040-11071 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_KT225462 Klebsiella pneumoniae strain YDC676 plasmid pYDC676, complete sequence 15891-15922 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_KR091911 Salmonella enterica subsp. enterica serovar Corvallis strain RH-1238 plasmid pRH-1238, complete sequence 82195-82226 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP012428 Klebsiella pneumoniae strain KP5 plasmid pSg1-2, complete sequence 33092-33123 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP026156 Klebsiella pneumoniae strain B12(AN) plasmid pB12AN_1, complete sequence 5686-5717 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP040051 Acinetobacter baumannii strain VB16141 plasmid unnamed1, complete sequence 157830-157861 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NC_004464 Citrobacter freundii plasmid pCTX-M3, complete sequence 78331-78362 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NC_007682 Escherichia coli plasmid pMUR050, complete sequence 23523-23554 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP034201 Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence 269347-269378 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 CP052160 Klebsiella pneumoniae strain F16KP0084 plasmid pF16KP0084-2, complete sequence 1306-1337 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NC_021180 Klebsiella pneumoniae plasmid pNDM-1saitama01 DNA, complete sequence, strain: NDM-1saitama01 47233-47264 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 CP052311 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-2, complete sequence 123333-123364 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP027679 Salmonella enterica subsp. enterica serovar Corvallis strain 12-01738 plasmid pSE12-01738-2, complete sequence 71941-71972 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP021328 Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence 66516-66547 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP021328 Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence 379170-379201 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP029729 Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed1, complete sequence 192795-192826 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_LS992184 Citrobacter freundii isolate Citrobacter freundii str. U2785 plasmid 2, complete sequence 4269-4300 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_LS992184 Citrobacter freundii isolate Citrobacter freundii str. U2785 plasmid 2, complete sequence 172346-172377 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_KJ187752 Klebsiella pneumoniae strain 7433 plasmid pTR2, complete sequence 51083-51114 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 CP052145 Klebsiella pneumoniae strain F17KP0012 plasmid pF17KP0012-2, complete sequence 21151-21182 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_AP014650 Acinetobacter baumannii strain IOMTU433 plasmid pIOMTU433, complete sequence 1251-1282 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP044454 Acinetobacter indicus strain MMS9-2 plasmid pMMS9-2-4, complete sequence 6554-6585 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP033628 Klebsiella pneumoniae strain 4743 plasmid unnamed3, complete sequence 70170-70201 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP038646 Acinetobacter baumannii strain ACN21 plasmid unnamed2, complete sequence 1306-1337 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NC_018107 Klebsiella michiganensis E718 plasmid pKOX_R1, complete sequence 136022-136053 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NC_018107 Klebsiella michiganensis E718 plasmid pKOX_R1, complete sequence 353358-353389 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP012007 Acinetobacter baumannii strain Ab04-mff plasmid pAB04-1, complete sequence 115941-115972 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP020854 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence 80036-80067 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 MN175387 Klebsiella pneumoniae strain KP-14-6 plasmid pKP-14-6-NDM-1, complete sequence 140438-140469 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP031563 Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence 213043-213074 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NC_019165 Klebsiella pneumoniae plasmid pKPN101-IT, complete sequence 73574-73605 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP012754 Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence 1992-2023 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 MH909331 Leclercia adecarboxylata plasmid p707804-NDM, complete sequence 140993-141024 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP031736 Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence 57768-57799 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP041083 Klebsiella pneumoniae strain Kp202 plasmid pKp202_1, complete sequence 123289-123320 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP022441 Klebsiella sp. LY plasmid unnamed3, complete sequence 252486-252517 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP036336 Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence 1306-1337 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NC_016974 Providencia stuartii plasmid pMR0211, complete sequence 129281-129312 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NC_017172 Acinetobacter baumannii MDR-ZJ06 plasmid pMDR-ZJ06, complete sequence 7220-7251 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 MN310378 Klebsiella pneumoniae strain A2293 plasmid pA2293-Ct2, complete sequence 64116-64147 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP035180 Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence 210601-210632 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 KU318419 Enterbacter aerogenes strain EA49 plasmid pEA49-KPC, complete sequence 2279-2310 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP021958 Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u 18918-18949 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_LT985387 Escherichia coli strain 694 genome assembly, plasmid: RCS55_pI 10636-10667 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP045003 Pseudomonas aeruginosa strain PAG5 plasmid pPAG5, complete sequence 96027-96058 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP036195 Klebsiella pneumoniae strain BA34918 plasmid pIncX3 46739-46770 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 LC508263 Klebsiella pneumoniae A1-3 plasmid pA1-3 DNA, complete sequence 75060-75091 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP039526 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence 225163-225194 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP050416 Acinetobacter baumannii strain PM193665 plasmid pPM193665_1, complete sequence 1306-1337 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NC_019063 Escherichia coli plasmid pNDM-HK, complete sequence 24804-24835 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP050426 Acinetobacter baumannii strain PM194188 plasmid pPM194122_1, complete sequence 1306-1337 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 LT009689 Klebsiella pneumoniae plasmid pIT-12C73, strain 12C73, complete sequence 71778-71809 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 CP040054 Acinetobacter baumannii strain VB35179 plasmid unnamed1, complete sequence 178122-178153 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP008933 Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence 204413-204444 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 MF344571 Pseudomonas aeruginosa plasmid pR31014-IMP, complete sequence 240182-240213 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP050433 Acinetobacter baumannii strain PM194229 plasmid pPM194229_1, complete sequence 1306-1337 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP050386 Acinetobacter baumannii strain VB82 plasmid pVB82_1, complete sequence 190142-190173 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP040726 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence 117937-117968 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP029118 Escherichia coli strain AR435 plasmid unnamed5, complete sequence 117666-117697 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 MF344568 Pseudomonas aeruginosa plasmid p727-IMP, complete sequence 234138-234169 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 MF344570 Pseudomonas aeruginosa plasmid pA681-IMP, complete sequence 232207-232238 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP041052 Enterobacter hormaechei strain C126 plasmid pEnC126NDM, complete sequence 24288-24319 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP020068 Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence 260033-260064 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP028929 Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence 175110-175141 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 CP050162 Escherichia coli plasmid Carbapenemase(NDM-1)_IncA/C2, complete sequence 82577-82608 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP050380 Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence 186059-186090 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP031235 Escherichia coli strain Es_ST410_NW1_NDM_09_2017 plasmid pEsST410_NW_NDM, complete sequence 50975-51006 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP016921 Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence 59097-59128 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 CP050156 Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence 238004-238035 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 CP052423 Klebsiella pneumoniae strain C16KP0164 plasmid pC16KP0164-1, complete sequence 168984-169015 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP022612 Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence 131618-131649 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NC_019065 Escherichia coli plasmid pPG010208, complete sequence 20620-20651 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP026154 Klebsiella pneumoniae strain F10(AN) plasmid pF10AN_1, complete sequence 211170-211201 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP020902 Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence 85298-85329 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 LC536683 Klebsiella pneumoniae MyNCGM084 plasmid pMyNCGM084, complete sequence 23823-23854 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 LC542971 Escherichia coli IOMTU413 plasmid pIOMTU413 DNA, complete sequence 96278-96309 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 LC542972 Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence 101394-101425 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_AP018748 Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence 116343-116374 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 KX957970 Vibrio parahaemolyticus plasmid pVPS43, complete sequence 110095-110126 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP021709 Klebsiella pneumoniae strain AR_0143 plasmid tig00000001_p1, complete sequence 82830-82861 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP021551 Proteus mirabilis strain AR_0159 plasmid tig00000137, complete sequence 96680-96711 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP023488 Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_01, complete sequence 152490-152521 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 KX957969 Vibrio alginolyticus plasmid pVAS114, complete sequence 113977-114008 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP013115 Shewanella xiamenensis strain T17 plasmid pSx1, complete sequence 97345-97376 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 CP052205 Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-2, complete sequence 1306-1337 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP006799 Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence 1992-2023 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP012902 Escherichia coli strain N15-01078 plasmid pNDM15-1078, complete sequence 47690-47721 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP020596 Acinetobacter baumannii strain HWBA8 plasmid pHWBA8_1, complete sequence 9354-9385 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP031372 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence 208719-208750 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP032193 Salmonella enterica subsp. enterica serovar Senftenberg strain AR_0127 plasmid unnamed2, complete sequence 12765-12796 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP040260 Acinetobacter baumannii strain P7774 plasmid unnamed1, complete sequence 80809-80840 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NC_022589 Providencia rettgeri strain 09ACRGNY2001 plasmid pPrY2001, complete sequence 77049-77080 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 CP052352 Klebsiella pneumoniae strain D16KP0146 plasmid pD17KP0032-1, complete sequence 16262-16293 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP044337 Enterobacter hormaechei strain AKB48 plasmid unnamed2, complete sequence 53382-53413 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 CP007579 Acinetobacter baumannii AC30 plasmid pAC30b, complete sequence 6758-6789 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NC_019360 Citrobacter freundii plasmid pNDM-CIT, complete sequence 31352-31383 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP043933 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence 161706-161737 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 CP046598 Acinetobacter indicus strain FS42-2 plasmid pFS42-2-3, complete sequence 3413-3444 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP030345 Enterobacter hormaechei strain AR_038 plasmid unnamed1 10319-10350 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP030345 Enterobacter hormaechei strain AR_038 plasmid unnamed1 132235-132266 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_AP018830 Enterobacter hormaechei subsp. xiangfangensis strain M206 plasmid pM206-NDM1, complete sequence 189638-189669 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 CP052393 Klebsiella pneumoniae strain C17KP0040 plasmid pC17KP0040-1, complete sequence 16262-16293 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP026014 Klebsiella variicola strain 13450 plasmid p13450-1, complete sequence 52169-52200 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP026014 Klebsiella variicola strain 13450 plasmid p13450-1, complete sequence 263190-263221 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_AP018143 Escherichia coli strain M214 isolate M214 plasmid pM214_AC2, complete sequence 126288-126319 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_AP018145 Escherichia coli strain M216 isolate M216 plasmid pM216_AC2, complete sequence 145049-145080 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 CP052316 Klebsiella pneumoniae strain E16KP0093 plasmid pE16KP0093-1, complete sequence 1306-1337 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_LN831184 Vibrio cholerae isolate V. cholerae 116-14 plasmid pNDM-116-14, complete sequence 232232-232263 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_LN831185 Vibrio cholerae isolate V. cholerae 116-17a plasmid pNDM-116-17, complete sequence 74417-74448 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 MN937241 Enterobacter cloacae strain BSI034 plasmid pBSI034-MCR9, complete sequence 107980-108011 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_LT985241 Escherichia coli strain 721 plasmid RCS40_p, complete sequence 33073-33104 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 LC505604 Klebsiella pneumoniae A1-1 plasmid pKp1-1 genomic DNA, complete sequence 75060-75091 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 LC508722 Klebsiella pneumoniae A2-1 plasmid pA2-4 DNA, complete sequence 75060-75091 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_MN101852 Escherichia coli strain 13ZX28-TC-98 plasmid p13ZX28-TC-98, complete sequence 18954-18985 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_MK262712 Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence 174691-174722 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_MN101850 Escherichia coli strain 13ZX28 plasmid p13ZX28-272, complete sequence 214047-214078 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_MN101853 Escherichia coli strain 13ZX36 plasmid p13ZX36-200, complete sequence 140400-140431 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NC_019889 Klebsiella pneumoniae strain 601 plasmid pNDM-OM, complete sequence 62261-62292 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 MN657249 Enterobacteriaceae bacterium strain 1086-16 plasmid pKP39-T3, complete sequence 111158-111189 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 MN657250 Enterobacteriaceae bacterium strain 1083-16 plasmid pKP39-T4, complete sequence 111194-111225 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 MN657252 Enterobacteriaceae bacterium strain 21-16 plasmid pPS-T1, complete sequence 134420-134451 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_MK191024 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence 65657-65688 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_MH011352 Klebsiella pneumoniae strain 185 plasmid pNDM-185, complete sequence 180693-180724 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_MK413720 Enterobacter cloacae strain 12949 plasmid p12949-HI2, complete sequence 121318-121349 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP016215 Pseudomonas aeruginosa strain PA121617 plasmid pBM413, complete sequence 75770-75801 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 MN657241 Enterobacteriaceae bacterium strain 20-16 plasmid pCF104a-T3, complete sequence 132511-132542 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP012903 Providencia rettgeri strain N15-01091 plasmid pNDM15-1091, complete sequence 49446-49477 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_MH001166 Escherichia coli strain TAEC1 plasmid pNDM-TAEC1, complete sequence 159056-159087 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_MF344561 Klebsiella pneumoniae strain 11219 plasmid p11219-IMP, complete sequence 193045-193076 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_MF344561 Klebsiella pneumoniae strain 11219 plasmid p11219-IMP, complete sequence 294301-294332 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_MF344565 Klebsiella pneumoniae strain 19051 plasmid p19051-IMP, complete sequence 151708-151739 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_MF344565 Klebsiella pneumoniae strain 19051 plasmid p19051-IMP, complete sequence 287996-288027 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_MF344562 Klebsiella pneumoniae strain 12208 plasmid p12208-IMP, complete sequence 166624-166655 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_MF344562 Klebsiella pneumoniae strain 12208 plasmid p12208-IMP, complete sequence 302552-302583 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_MF344564 Klebsiella pneumoniae strain 13450 plasmid p13450-IMP, complete sequence 183933-183964 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_MF344564 Klebsiella pneumoniae strain 13450 plasmid p13450-IMP, complete sequence 317390-317421 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_MF344572 Enterobacter hormaechei strain 24845 plasmid p24845-Ct2, complete sequence 88579-88610 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_MG450360 Escherichia coli strain AMA566 plasmid pAMA566, complete sequence 134913-134944 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_MH892479 Citrobacter freundii strain 2262 plasmid pNDM-2262, complete sequence 150519-150550 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP049048 Enterobacter hormaechei strain Y233 plasmid p233-142, complete sequence 72812-72843 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NC_021732 Acinetobacter baumannii BJAB0868 plasmid p3BJAB0868, complete sequence 15627-15658 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP044468 Acinetobacter schindleri strain HZE23-1 plasmid pHZE23-1-5, complete sequence 5814-5845 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_KY883660 Pseudomonas putida strain SY153 plasmid pSY153-MDR, complete sequence 257700-257731 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_MF072965 Citrobacter freundii strain P10159 plasmid pP10159-5, complete sequence 138794-138825 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_MG288680 Klebsiella pneumoniae strain D610 plasmid pD610-HI2, complete sequence 121625-121656 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 247967-247998 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_MG288682 Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence 74577-74608 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 247998-248029 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_MF344582 Citrobacter freundii strain 525011 plasmid p525011-HI2, complete sequence 143388-143419 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP040068 Escherichia coli strain A1_181 plasmid p_unnamed1_KPC2, complete sequence 124572-124603 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP034406 Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence 244179-244210 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 MN661402 Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-IMP,KPC, complete sequence 279108-279139 7 0.781
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP032275 Acinetobacter sp. WCHAc010034 plasmid p7_010034, complete sequence 4767-4798 8 0.75
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP050406 Acinetobacter baumannii strain VB2486 plasmid pVB2486_3, complete sequence 9492-9523 8 0.75
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP035940 Acinetobacter cumulans strain WCHAc060092 plasmid p5_060092, complete sequence 3200-3231 8 0.75
NZ_CP031981_1 1.1|780|32|NZ_CP031981|CRISPRCasFinder 780-811 32 NZ_CP033846 Klebsiella oxytoca strain FDAARGOS_500 plasmid unnamed2, complete sequence 381-412 10 0.688

1. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP044476 (Acinetobacter schindleri strain HZE33-1 plasmid pHZE33-1-2, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

2. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP044476 (Acinetobacter schindleri strain HZE33-1 plasmid pHZE33-1-2, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

3. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_LR026972 (Acinetobacter baumannii strain KCRI-28 isolate RDK36_28 plasmid pKCRI-28-1, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

4. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_LR026972 (Acinetobacter baumannii strain KCRI-28 isolate RDK36_28 plasmid pKCRI-28-1, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

5. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP023027 (Acinetobacter baumannii strain 10042 plasmid pAba10042a, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

6. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP023027 (Acinetobacter baumannii strain 10042 plasmid pAba10042a, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

7. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP020587 (Acinetobacter nosocomialis strain SSA3 plasmid pSSA3_1, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

8. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP020587 (Acinetobacter nosocomialis strain SSA3 plasmid pSSA3_1, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

9. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP021348 (Acinetobacter baumannii strain B8300 plasmid pB8300, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

10. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP021348 (Acinetobacter baumannii strain B8300 plasmid pB8300, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

11. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP023021 (Acinetobacter baumannii strain 9201 plasmid pAba9201a, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

12. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP023021 (Acinetobacter baumannii strain 9201 plasmid pAba9201a, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

13. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_KY499579 (Acinetobacter pittii strain CCBH10253 plasmid pAP10253-1, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

14. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_KY499579 (Acinetobacter pittii strain CCBH10253 plasmid pAP10253-1, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

15. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP027248 (Acinetobacter pittii strain WCHAP100004 plasmid p2_100004, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

16. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP027248 (Acinetobacter pittii strain WCHAP100004 plasmid p2_100004, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

17. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP028570 (Acinetobacter pittii strain WCHAP005046 plasmid p2_005046, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

18. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP028570 (Acinetobacter pittii strain WCHAP005046 plasmid p2_005046, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

19. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP031994 (Acinetobacter haemolyticus strain 2126ch plasmid pAhaem2126chd, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

20. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP031994 (Acinetobacter haemolyticus strain 2126ch plasmid pAhaem2126chd, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

21. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP044462 (Acinetobacter indicus strain B18 plasmid pB18-7, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

22. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP044462 (Acinetobacter indicus strain B18 plasmid pB18-7, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

23. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NC_010481 (Acinetobacter baumannii plasmid pABIR, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

24. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NC_010481 (Acinetobacter baumannii plasmid pABIR, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

25. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to CP033542 (Acinetobacter pittii strain 2014S06-099 plasmid p2014S06-099-2, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

26. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to CP033542 (Acinetobacter pittii strain 2014S06-099 plasmid p2014S06-099-2, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

27. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP038648 (Acinetobacter baumannii strain ACN21 plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

28. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP038648 (Acinetobacter baumannii strain ACN21 plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

29. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to CP033571 (Acinetobacter pittii strain 2014N21-145 plasmid p2014N21-145-3, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

30. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to CP033571 (Acinetobacter pittii strain 2014N21-145 plasmid p2014N21-145-3, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

31. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP033132 (Acinetobacter wuhouensis strain WCHAW010062 plasmid pOXA653_010062, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

32. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP033132 (Acinetobacter wuhouensis strain WCHAW010062 plasmid pOXA653_010062, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

33. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP033752 (Acinetobacter baumannii strain FDAARGOS_540 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

34. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP033752 (Acinetobacter baumannii strain FDAARGOS_540 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

35. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP027252 (Acinetobacter pittii strain WCHAP100020 plasmid p2_100020, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

36. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP027252 (Acinetobacter pittii strain WCHAP100020 plasmid p2_100020, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

37. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_LT984691 (Acinetobacter baumannii isolate K50 plasmid II, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

38. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_LT984691 (Acinetobacter baumannii isolate K50 plasmid II, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

39. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP029572 (Acinetobacter baumannii strain DA33098 plasmid pDA33098-9-2, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

40. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP029572 (Acinetobacter baumannii strain DA33098 plasmid pDA33098-9-2, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

41. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to MN461228 (Acinetobacter pittii strain A2584 plasmid pA2584, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

42. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to MN461228 (Acinetobacter pittii strain A2584 plasmid pA2584, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

43. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to MN481286 (Acinetobacter baylyi strain A2702 plasmid pA2702, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

44. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to MN481286 (Acinetobacter baylyi strain A2702 plasmid pA2702, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

45. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to MN495625 (Acinetobacter baumannii strain A2485 plasmid pA2485, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

46. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to MN495625 (Acinetobacter baumannii strain A2485 plasmid pA2485, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

47. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to MN495626 (Acinetobacter baumannii strain A2503 plasmid pA2503, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

48. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to MN495626 (Acinetobacter baumannii strain A2503 plasmid pA2503, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

49. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP051871 (Acinetobacter baumannii strain Ab-D10a-a plasmid pAb-D10a-a_2, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

50. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP051871 (Acinetobacter baumannii strain Ab-D10a-a plasmid pAb-D10a-a_2, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

51. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NC_013506 (Acinetobacter baumannii plasmid pMMCU2, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

52. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NC_013506 (Acinetobacter baumannii plasmid pMMCU2, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

53. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to MK978160 (Acinetobacter lwoffii strain M2a plasmid pAVAci119, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

54. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to MK978160 (Acinetobacter lwoffii strain M2a plasmid pAVAci119, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

55. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NC_013056 (Acinetobacter calcoaceticus strain Acal H12O-07 plasmid pMMCU1, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

56. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NC_013056 (Acinetobacter calcoaceticus strain Acal H12O-07 plasmid pMMCU1, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

57. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to CP042207 (Acinetobacter baumannii strain DS002 plasmid pTS9900, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

58. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to CP042207 (Acinetobacter baumannii strain DS002 plasmid pTS9900, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

59. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP042367 (Acinetobacter pittii strain C54 plasmid pC54_003, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

60. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP042367 (Acinetobacter pittii strain C54 plasmid pC54_003, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

61. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP018141 (Acinetobacter larvae strain BRTC-1 plasmid pRW1, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

62. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP018141 (Acinetobacter larvae strain BRTC-1 plasmid pRW1, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

63. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP038260 (Acinetobacter baumannii strain 39741 plasmid pEH_gr3, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

64. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP038260 (Acinetobacter baumannii strain 39741 plasmid pEH_gr3, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

65. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP049810 (Acinetobacter pittii strain A1254 plasmid pA1254_4, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

66. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP049810 (Acinetobacter pittii strain A1254 plasmid pA1254_4, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

67. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP015146 (Acinetobacter pittii strain IEC338SC plasmid pIEC338SCOX, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

68. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP015146 (Acinetobacter pittii strain IEC338SC plasmid pIEC338SCOX, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

69. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP051877 (Acinetobacter baumannii strain Ab-B004d-c plasmid pAb-B004d-c_2, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

70. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP051877 (Acinetobacter baumannii strain Ab-B004d-c plasmid pAb-B004d-c_2, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

71. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP031981 (Acinetobacter haemolyticus strain AN4 plasmid pAhaemAN4c, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

72. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP031981 (Acinetobacter haemolyticus strain AN4 plasmid pAhaemAN4c, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

73. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP026427 (Acinetobacter sp. ACNIH1 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

74. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP026427 (Acinetobacter sp. ACNIH1 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

75. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP014479 (Acinetobacter pittii strain AP_882 plasmid pOXA58-AP_882, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

76. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP014479 (Acinetobacter pittii strain AP_882 plasmid pOXA58-AP_882, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

77. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP016899 (Acinetobacter soli strain GFJ2 plasmid pGFJ3, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

78. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP016899 (Acinetobacter soli strain GFJ2 plasmid pGFJ3, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

79. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP051868 (Acinetobacter baumannii strain Ab-C63 plasmid pAb-C63_2, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

80. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP051868 (Acinetobacter baumannii strain Ab-C63 plasmid pAb-C63_2, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

81. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NC_019280 (Acinetobacter baumannii plasmid pMMD, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

82. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NC_019280 (Acinetobacter baumannii plasmid pMMD, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

83. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP023035 (Acinetobacter baumannii strain 5845 plasmid pAba5845a, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

84. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP023035 (Acinetobacter baumannii strain 5845 plasmid pAba5845a, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

85. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_KT022421 (Acinetobacter baumannii strain ML plasmid pAB-ML, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

86. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_KT022421 (Acinetobacter baumannii strain ML plasmid pAB-ML, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

87. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP032127 (Acinetobacter chinensis strain WCHAc010005 plasmid p1_010005, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

88. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP032127 (Acinetobacter chinensis strain WCHAc010005 plasmid p1_010005, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

89. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP015112 (Acinetobacter sp. TGL-Y2 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactaccaactatgacggattgactac	Protospacer
***********.********************

90. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP015112 (Acinetobacter sp. TGL-Y2 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactaccaactatgacggattgactac	Protospacer
***********.********************

91. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP032275 (Acinetobacter sp. WCHAc010034 plasmid p7_010034, complete sequence) position: , mismatch: 1, identity: 0.969

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgagggattgactac	Protospacer
******************** ***********

92. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP032275 (Acinetobacter sp. WCHAc010034 plasmid p7_010034, complete sequence) position: , mismatch: 1, identity: 0.969

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgagggattgactac	Protospacer
******************** ***********

93. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP010354 (Acinetobacter johnsonii XBB1 plasmid pXBB1-3, complete sequence) position: , mismatch: 1, identity: 0.969

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgagggattgactac	Protospacer
******************** ***********

94. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP010354 (Acinetobacter johnsonii XBB1 plasmid pXBB1-3, complete sequence) position: , mismatch: 1, identity: 0.969

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgagggattgactac	Protospacer
******************** ***********

95. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP050406 (Acinetobacter baumannii strain VB2486 plasmid pVB2486_3, complete sequence) position: , mismatch: 1, identity: 0.969

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgagggattgactac	Protospacer
******************** ***********

96. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP050406 (Acinetobacter baumannii strain VB2486 plasmid pVB2486_3, complete sequence) position: , mismatch: 1, identity: 0.969

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgagggattgactac	Protospacer
******************** ***********

97. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP035940 (Acinetobacter cumulans strain WCHAc060092 plasmid p5_060092, complete sequence) position: , mismatch: 1, identity: 0.969

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgagggattgactac	Protospacer
******************** ***********

98. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP035940 (Acinetobacter cumulans strain WCHAc060092 plasmid p5_060092, complete sequence) position: , mismatch: 1, identity: 0.969

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgagggattgactac	Protospacer
******************** ***********

99. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NC_014312 (Klebsiella pneumoniae plasmid pKP048, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

100. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_KY399978 (Vibrio cholerae O139 strain ICDC-211 plasmid pVC211, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

101. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_AP023051 (Citrobacter portucalensis strain IOMTU157 plasmid pIOMTU157, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

102. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to MF399199 (Acinetobacter baumannii strain D46 plasmid pD46-4, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

103. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP016764 (Citrobacter freundii strain B38 plasmid pOZ181, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

104. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NC_021728 (Acinetobacter baumannii BJAB07104 plasmid p2BJAB07104, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

105. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_KX443408 (Klebsiella pneumoniae strain SC24 plasmid pKSC24, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

106. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_KU302802 (Enterobacter cloacae strain SZECL1 plasmid pNDM1_SZ2 clone ST231, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

107. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_KX009507 (Escherichia coli strain 06K2206 plasmid LM6771, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

108. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_KU302801 (Enterobacter cloacae strain SZECL1 plasmid pNDM1_SZ1 clone ST231, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

109. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_KM083064 (Vibrio cholerae strain ICDC-1447 plasmid pVC1447, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

110. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_KT225462 (Klebsiella pneumoniae strain YDC676 plasmid pYDC676, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

111. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_KR091911 (Salmonella enterica subsp. enterica serovar Corvallis strain RH-1238 plasmid pRH-1238, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

112. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP012428 (Klebsiella pneumoniae strain KP5 plasmid pSg1-2, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

113. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP026156 (Klebsiella pneumoniae strain B12(AN) plasmid pB12AN_1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

114. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP040051 (Acinetobacter baumannii strain VB16141 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

115. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NC_004464 (Citrobacter freundii plasmid pCTX-M3, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

116. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NC_007682 (Escherichia coli plasmid pMUR050, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

117. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

118. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to CP052160 (Klebsiella pneumoniae strain F16KP0084 plasmid pF16KP0084-2, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

119. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NC_021180 (Klebsiella pneumoniae plasmid pNDM-1saitama01 DNA, complete sequence, strain: NDM-1saitama01) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

120. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to CP052311 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-2, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

121. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP027679 (Salmonella enterica subsp. enterica serovar Corvallis strain 12-01738 plasmid pSE12-01738-2, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

122. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP021328 (Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

123. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP021328 (Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

124. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP029729 (Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

125. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_LS992184 (Citrobacter freundii isolate Citrobacter freundii str. U2785 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

126. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_LS992184 (Citrobacter freundii isolate Citrobacter freundii str. U2785 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

127. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_KJ187752 (Klebsiella pneumoniae strain 7433 plasmid pTR2, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

128. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to CP052145 (Klebsiella pneumoniae strain F17KP0012 plasmid pF17KP0012-2, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

129. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_AP014650 (Acinetobacter baumannii strain IOMTU433 plasmid pIOMTU433, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

130. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP044454 (Acinetobacter indicus strain MMS9-2 plasmid pMMS9-2-4, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

131. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP033628 (Klebsiella pneumoniae strain 4743 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

132. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP038646 (Acinetobacter baumannii strain ACN21 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

133. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NC_018107 (Klebsiella michiganensis E718 plasmid pKOX_R1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

134. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NC_018107 (Klebsiella michiganensis E718 plasmid pKOX_R1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

135. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP012007 (Acinetobacter baumannii strain Ab04-mff plasmid pAB04-1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

136. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

137. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to MN175387 (Klebsiella pneumoniae strain KP-14-6 plasmid pKP-14-6-NDM-1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

138. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

139. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NC_019165 (Klebsiella pneumoniae plasmid pKPN101-IT, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

140. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

141. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to MH909331 (Leclercia adecarboxylata plasmid p707804-NDM, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

142. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

143. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP041083 (Klebsiella pneumoniae strain Kp202 plasmid pKp202_1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

144. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP022441 (Klebsiella sp. LY plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

145. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

146. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NC_016974 (Providencia stuartii plasmid pMR0211, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

147. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NC_017172 (Acinetobacter baumannii MDR-ZJ06 plasmid pMDR-ZJ06, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

148. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to MN310378 (Klebsiella pneumoniae strain A2293 plasmid pA2293-Ct2, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

149. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP035180 (Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

150. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to KU318419 (Enterbacter aerogenes strain EA49 plasmid pEA49-KPC, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

151. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

152. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_LT985387 (Escherichia coli strain 694 genome assembly, plasmid: RCS55_pI) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

153. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP045003 (Pseudomonas aeruginosa strain PAG5 plasmid pPAG5, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

154. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP036195 (Klebsiella pneumoniae strain BA34918 plasmid pIncX3) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

155. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to LC508263 (Klebsiella pneumoniae A1-3 plasmid pA1-3 DNA, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

156. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

157. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP050416 (Acinetobacter baumannii strain PM193665 plasmid pPM193665_1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

158. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NC_019063 (Escherichia coli plasmid pNDM-HK, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

159. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP050426 (Acinetobacter baumannii strain PM194188 plasmid pPM194122_1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

160. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to LT009689 (Klebsiella pneumoniae plasmid pIT-12C73, strain 12C73, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

161. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to CP040054 (Acinetobacter baumannii strain VB35179 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

162. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

163. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to MF344571 (Pseudomonas aeruginosa plasmid pR31014-IMP, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

164. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP050433 (Acinetobacter baumannii strain PM194229 plasmid pPM194229_1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

165. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP050386 (Acinetobacter baumannii strain VB82 plasmid pVB82_1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

166. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

167. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP029118 (Escherichia coli strain AR435 plasmid unnamed5, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

168. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to MF344568 (Pseudomonas aeruginosa plasmid p727-IMP, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

169. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to MF344570 (Pseudomonas aeruginosa plasmid pA681-IMP, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

170. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP041052 (Enterobacter hormaechei strain C126 plasmid pEnC126NDM, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

171. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

172. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

173. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to CP050162 (Escherichia coli plasmid Carbapenemase(NDM-1)_IncA/C2, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

174. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

175. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP031235 (Escherichia coli strain Es_ST410_NW1_NDM_09_2017 plasmid pEsST410_NW_NDM, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

176. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

177. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

178. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to CP052423 (Klebsiella pneumoniae strain C16KP0164 plasmid pC16KP0164-1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

179. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

180. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NC_019065 (Escherichia coli plasmid pPG010208, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

181. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP026154 (Klebsiella pneumoniae strain F10(AN) plasmid pF10AN_1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

182. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

183. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to LC536683 (Klebsiella pneumoniae MyNCGM084 plasmid pMyNCGM084, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

184. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to LC542971 (Escherichia coli IOMTU413 plasmid pIOMTU413 DNA, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

185. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

186. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

187. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to KX957970 (Vibrio parahaemolyticus plasmid pVPS43, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

188. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP021709 (Klebsiella pneumoniae strain AR_0143 plasmid tig00000001_p1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

189. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP021551 (Proteus mirabilis strain AR_0159 plasmid tig00000137, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

190. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP023488 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_01, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

191. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to KX957969 (Vibrio alginolyticus plasmid pVAS114, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

192. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP013115 (Shewanella xiamenensis strain T17 plasmid pSx1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

193. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to CP052205 (Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-2, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

194. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

195. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP012902 (Escherichia coli strain N15-01078 plasmid pNDM15-1078, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

196. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP020596 (Acinetobacter baumannii strain HWBA8 plasmid pHWBA8_1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

197. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

198. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP032193 (Salmonella enterica subsp. enterica serovar Senftenberg strain AR_0127 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

199. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP040260 (Acinetobacter baumannii strain P7774 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

200. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NC_022589 (Providencia rettgeri strain 09ACRGNY2001 plasmid pPrY2001, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

201. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to CP052352 (Klebsiella pneumoniae strain D16KP0146 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

202. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP044337 (Enterobacter hormaechei strain AKB48 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

203. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to CP007579 (Acinetobacter baumannii AC30 plasmid pAC30b, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

204. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NC_019360 (Citrobacter freundii plasmid pNDM-CIT, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

205. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

206. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to CP046598 (Acinetobacter indicus strain FS42-2 plasmid pFS42-2-3, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

207. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP030345 (Enterobacter hormaechei strain AR_038 plasmid unnamed1) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

208. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP030345 (Enterobacter hormaechei strain AR_038 plasmid unnamed1) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

209. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_AP018830 (Enterobacter hormaechei subsp. xiangfangensis strain M206 plasmid pM206-NDM1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

210. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to CP052393 (Klebsiella pneumoniae strain C17KP0040 plasmid pC17KP0040-1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

211. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP026014 (Klebsiella variicola strain 13450 plasmid p13450-1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

212. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP026014 (Klebsiella variicola strain 13450 plasmid p13450-1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

213. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_AP018143 (Escherichia coli strain M214 isolate M214 plasmid pM214_AC2, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

214. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_AP018145 (Escherichia coli strain M216 isolate M216 plasmid pM216_AC2, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

215. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to CP052316 (Klebsiella pneumoniae strain E16KP0093 plasmid pE16KP0093-1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

216. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_LN831184 (Vibrio cholerae isolate V. cholerae 116-14 plasmid pNDM-116-14, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

217. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_LN831185 (Vibrio cholerae isolate V. cholerae 116-17a plasmid pNDM-116-17, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

218. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to MN937241 (Enterobacter cloacae strain BSI034 plasmid pBSI034-MCR9, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

219. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_LT985241 (Escherichia coli strain 721 plasmid RCS40_p, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

220. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to LC505604 (Klebsiella pneumoniae A1-1 plasmid pKp1-1 genomic DNA, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

221. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to LC508722 (Klebsiella pneumoniae A2-1 plasmid pA2-4 DNA, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

222. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_MN101852 (Escherichia coli strain 13ZX28-TC-98 plasmid p13ZX28-TC-98, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

223. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

224. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_MN101850 (Escherichia coli strain 13ZX28 plasmid p13ZX28-272, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

225. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_MN101853 (Escherichia coli strain 13ZX36 plasmid p13ZX36-200, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

226. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NC_019889 (Klebsiella pneumoniae strain 601 plasmid pNDM-OM, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

227. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to MN657249 (Enterobacteriaceae bacterium strain 1086-16 plasmid pKP39-T3, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

228. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to MN657250 (Enterobacteriaceae bacterium strain 1083-16 plasmid pKP39-T4, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

229. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to MN657252 (Enterobacteriaceae bacterium strain 21-16 plasmid pPS-T1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

230. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

231. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_MH011352 (Klebsiella pneumoniae strain 185 plasmid pNDM-185, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

232. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_MK413720 (Enterobacter cloacae strain 12949 plasmid p12949-HI2, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

233. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP016215 (Pseudomonas aeruginosa strain PA121617 plasmid pBM413, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

234. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to MN657241 (Enterobacteriaceae bacterium strain 20-16 plasmid pCF104a-T3, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

235. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP012903 (Providencia rettgeri strain N15-01091 plasmid pNDM15-1091, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

236. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_MH001166 (Escherichia coli strain TAEC1 plasmid pNDM-TAEC1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

237. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_MF344561 (Klebsiella pneumoniae strain 11219 plasmid p11219-IMP, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

238. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_MF344561 (Klebsiella pneumoniae strain 11219 plasmid p11219-IMP, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

239. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_MF344565 (Klebsiella pneumoniae strain 19051 plasmid p19051-IMP, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

240. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_MF344565 (Klebsiella pneumoniae strain 19051 plasmid p19051-IMP, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

241. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_MF344562 (Klebsiella pneumoniae strain 12208 plasmid p12208-IMP, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

242. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_MF344562 (Klebsiella pneumoniae strain 12208 plasmid p12208-IMP, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

243. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_MF344564 (Klebsiella pneumoniae strain 13450 plasmid p13450-IMP, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

244. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_MF344564 (Klebsiella pneumoniae strain 13450 plasmid p13450-IMP, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

245. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_MF344572 (Enterobacter hormaechei strain 24845 plasmid p24845-Ct2, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

246. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_MG450360 (Escherichia coli strain AMA566 plasmid pAMA566, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

247. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_MH892479 (Citrobacter freundii strain 2262 plasmid pNDM-2262, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

248. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP049048 (Enterobacter hormaechei strain Y233 plasmid p233-142, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

249. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NC_021732 (Acinetobacter baumannii BJAB0868 plasmid p3BJAB0868, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

250. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP044468 (Acinetobacter schindleri strain HZE23-1 plasmid pHZE23-1-5, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

251. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_KY883660 (Pseudomonas putida strain SY153 plasmid pSY153-MDR, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

252. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_MF072965 (Citrobacter freundii strain P10159 plasmid pP10159-5, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

253. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_MG288680 (Klebsiella pneumoniae strain D610 plasmid pD610-HI2, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

254. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

255. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_MG288682 (Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

256. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

257. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_MF344582 (Citrobacter freundii strain 525011 plasmid p525011-HI2, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

258. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP040068 (Escherichia coli strain A1_181 plasmid p_unnamed1_KPC2, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

259. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

260. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to MN661402 (Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-IMP,KPC, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

261. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP032275 (Acinetobacter sp. WCHAc010034 plasmid p7_010034, complete sequence) position: , mismatch: 8, identity: 0.75

ggattgactactaactatgacggattgactac	CRISPR spacer
ctttcagctcctaactatgagggattgactac	Protospacer
   *...** ********** ***********

262. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP050406 (Acinetobacter baumannii strain VB2486 plasmid pVB2486_3, complete sequence) position: , mismatch: 8, identity: 0.75

ggattgactactaactatgacggattgactac	CRISPR spacer
ctttcagctcctaactatgagggattgactac	Protospacer
   *...** ********** ***********

263. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP035940 (Acinetobacter cumulans strain WCHAc060092 plasmid p5_060092, complete sequence) position: , mismatch: 8, identity: 0.75

ggattgactactaactatgacggattgactac	CRISPR spacer
ctttcagctcctaactatgagggattgactac	Protospacer
   *...** ********** ***********

264. spacer 1.1|780|32|NZ_CP031981|CRISPRCasFinder matches to NZ_CP033846 (Klebsiella oxytoca strain FDAARGOS_500 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

ggattgactactaactatgacggattgactac	CRISPR spacer
acagcagaaactaaacatgacggattgactac	Protospacer
. * ...  ***** .****************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage