Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP047651 Xylophilus sp. KACC 21265 plasmid unnamed1, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP047650 Xylophilus sp. KACC 21265 chromosome, complete genome 2 crisprs WYL,cas3,PD-DExK,DinG,Cas9_archaeal,DEDDh 1 1 5 0

Results visualization

1. NZ_CP047650
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047650_1 1026202-1026287 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047650_2 5368759-5368857 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP047650_1 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder 1026225-1026264 40 NZ_CP047650.1 3221327-3221366 2 0.95

1. spacer 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder matches to position: 3221327-3221366, mismatch: 2, identity: 0.95

gatgggcgagcccgccgcagcaccgatgcgctcggcaacg	CRISPR spacer
gacgggcgagcccgccgcagcaccgatgcgctgggcaacg	Protospacer
**.***************************** *******

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP047650_1 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder 1026225-1026264 40 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 546498-546537 9 0.775
NZ_CP047650_1 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder 1026225-1026264 40 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 545750-545789 9 0.775
NZ_CP047650_1 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder 1026225-1026264 40 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 1852841-1852880 9 0.775
NZ_CP047650_1 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder 1026225-1026264 40 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 1886234-1886273 9 0.775
NZ_CP047650_1 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder 1026225-1026264 40 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1889901-1889940 9 0.775
NZ_CP047650_1 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder 1026225-1026264 40 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 327226-327265 9 0.775
NZ_CP047650_1 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder 1026225-1026264 40 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 299269-299308 9 0.775
NZ_CP047650_1 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder 1026225-1026264 40 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 1925718-1925757 9 0.775
NZ_CP047650_1 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder 1026225-1026264 40 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 1000605-1000644 9 0.775
NZ_CP047650_1 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder 1026225-1026264 40 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 162391-162430 9 0.775
NZ_CP047650_1 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder 1026225-1026264 40 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 105890-105929 9 0.775
NZ_CP047650_1 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder 1026225-1026264 40 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 83838-83877 9 0.775
NZ_CP047650_1 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder 1026225-1026264 40 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 141530-141569 9 0.775
NZ_CP047650_1 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder 1026225-1026264 40 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 242573-242612 9 0.775
NZ_CP047650_1 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder 1026225-1026264 40 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 83521-83560 9 0.775
NZ_CP047650_1 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder 1026225-1026264 40 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 700709-700748 9 0.775
NZ_CP047650_1 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder 1026225-1026264 40 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 1122505-1122544 9 0.775
NZ_CP047650_1 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder 1026225-1026264 40 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 315177-315216 9 0.775
NZ_CP047650_1 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder 1026225-1026264 40 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 85162-85201 9 0.775
NZ_CP047650_1 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder 1026225-1026264 40 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 87622-87661 9 0.775
NZ_CP047650_1 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder 1026225-1026264 40 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 116950-116989 9 0.775
NZ_CP047650_1 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder 1026225-1026264 40 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 83460-83499 9 0.775
NZ_CP047650_1 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder 1026225-1026264 40 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 85180-85219 9 0.775
NZ_CP047650_1 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder 1026225-1026264 40 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 101124-101163 9 0.775
NZ_CP047650_1 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder 1026225-1026264 40 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 83537-83576 9 0.775
NZ_CP047650_1 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder 1026225-1026264 40 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 116948-116987 9 0.775
NZ_CP047650_1 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder 1026225-1026264 40 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 85334-85373 9 0.775
NZ_CP047650_1 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder 1026225-1026264 40 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 101124-101163 9 0.775
NZ_CP047650_1 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder 1026225-1026264 40 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 83537-83576 9 0.775
NZ_CP047650_1 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder 1026225-1026264 40 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 101124-101163 9 0.775
NZ_CP047650_1 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder 1026225-1026264 40 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 85334-85373 9 0.775
NZ_CP047650_1 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder 1026225-1026264 40 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 101124-101163 9 0.775
NZ_CP047650_1 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder 1026225-1026264 40 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 83537-83576 9 0.775
NZ_CP047650_1 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder 1026225-1026264 40 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 83537-83576 9 0.775
NZ_CP047650_1 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder 1026225-1026264 40 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 83537-83576 9 0.775
NZ_CP047650_1 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder 1026225-1026264 40 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 85079-85118 9 0.775
NZ_CP047650_1 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder 1026225-1026264 40 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 85334-85373 9 0.775
NZ_CP047650_1 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder 1026225-1026264 40 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 87623-87662 9 0.775
NZ_CP047650_1 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder 1026225-1026264 40 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 87616-87655 9 0.775
NZ_CP047650_1 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder 1026225-1026264 40 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 85057-85096 9 0.775
NZ_CP047650_1 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder 1026225-1026264 40 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 85963-86002 9 0.775
NZ_CP047650_1 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder 1026225-1026264 40 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 82359-82398 9 0.775
NZ_CP047650_1 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder 1026225-1026264 40 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 85334-85373 9 0.775
NZ_CP047650_1 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder 1026225-1026264 40 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 101124-101163 9 0.775
NZ_CP047650_1 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder 1026225-1026264 40 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 119818-119857 9 0.775
NZ_CP047650_1 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder 1026225-1026264 40 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 85334-85373 9 0.775
NZ_CP047650_1 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder 1026225-1026264 40 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 85334-85373 9 0.775
NZ_CP047650_1 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder 1026225-1026264 40 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 83537-83576 9 0.775
NZ_CP047650_1 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder 1026225-1026264 40 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 83912-83951 9 0.775
NZ_CP047650_1 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder 1026225-1026264 40 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 83912-83951 9 0.775

1. spacer 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.775

gatgggcga-gcccgccgcagcaccgatgcgctcggcaacg	CRISPR spacer
-ctgatcgatgcccgccgcatcaccgatgcggtcggcattc	Protospacer
  **. *** ********** ********** ****** . 

2. spacer 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.775

gatgggcga-gcccgccgcagcaccgatgcgctcggcaacg	CRISPR spacer
-ctgatcgatgcccgccgcatcaccgatgcggtcggcattc	Protospacer
  **. *** ********** ********** ****** . 

3. spacer 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.775

gatgggcga-gcccgccgcagcaccgatgcgctcggcaacg	CRISPR spacer
-ctgatcgatgcccgccgcatcaccgatgcggtcggcattc	Protospacer
  **. *** ********** ********** ****** . 

4. spacer 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.775

gatgggcga-gcccgccgcagcaccgatgcgctcggcaacg	CRISPR spacer
-ctgatcgatgcccgccgcatcaccgatgcggtcggcattc	Protospacer
  **. *** ********** ********** ****** . 

5. spacer 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.775

gatgggcga-gcccgccgcagcaccgatgcgctcggcaacg	CRISPR spacer
-ctgatcgatgcccgccgcatcaccgatgcggtcggcattc	Protospacer
  **. *** ********** ********** ****** . 

6. spacer 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.775

gatgggcga-gcccgccgcagcaccgatgcgctcggcaacg	CRISPR spacer
-ctgatcgatgcccgccgcatcaccgatgcggtcggcattc	Protospacer
  **. *** ********** ********** ****** . 

7. spacer 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 9, identity: 0.775

gatgggcga-gcccgccgcagcaccgatgcgctcggcaacg	CRISPR spacer
-ctgatcgatgcccgccgcatcaccgatgcggtcggcattc	Protospacer
  **. *** ********** ********** ****** . 

8. spacer 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.775

gatgggcga-gcccgccgcagcaccgatgcgctcggcaacg	CRISPR spacer
-ctgatcgatgcccgccgcatcaccgatgcggtcggcattc	Protospacer
  **. *** ********** ********** ****** . 

9. spacer 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 9, identity: 0.775

gatgggcga-gcccgccgcagcaccgatgcgctcggcaacg	CRISPR spacer
-ctgatcgatgcccgccgcatcaccgatgcggtcggcattc	Protospacer
  **. *** ********** ********** ****** . 

10. spacer 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 9, identity: 0.775

gatgggcga-gcccgccgcagcaccgatgcgctcggcaacg	CRISPR spacer
-ctgatcgatgcccgccgcatcaccgatgcggtcggcattc	Protospacer
  **. *** ********** ********** ****** . 

11. spacer 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.775

gatgggcga-gcccgccgcagcaccgatgcgctcggcaacg	CRISPR spacer
-ctgatcgatgcccgccgcatcaccgatgcggtcggcattc	Protospacer
  **. *** ********** ********** ****** . 

12. spacer 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.775

gatgggcga-gcccgccgcagcaccgatgcgctcggcaacg	CRISPR spacer
-ctgatcgatgcccgccgcatcaccgatgcggtcggcattc	Protospacer
  **. *** ********** ********** ****** . 

13. spacer 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.775

gatgggcga-gcccgccgcagcaccgatgcgctcggcaacg	CRISPR spacer
-ctgatcgatgcccgccgcatcaccgatgcggtcggcattc	Protospacer
  **. *** ********** ********** ****** . 

14. spacer 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.775

gatgggcga-gcccgccgcagcaccgatgcgctcggcaacg	CRISPR spacer
-ctgatcgatgcccgccgcatcaccgatgcggtcggcattc	Protospacer
  **. *** ********** ********** ****** . 

15. spacer 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.775

gatgggcga-gcccgccgcagcaccgatgcgctcggcaacg	CRISPR spacer
-ctgatcgatgcccgccgcatcaccgatgcggtcggcattc	Protospacer
  **. *** ********** ********** ****** . 

16. spacer 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.775

gatgggcga-gcccgccgcagcaccgatgcgctcggcaacg	CRISPR spacer
-ctgatcgatgcccgccgcatcaccgatgcggtcggcattc	Protospacer
  **. *** ********** ********** ****** . 

17. spacer 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 9, identity: 0.775

gatgggcga-gcccgccgcagcaccgatgcgctcggcaacg	CRISPR spacer
-ctgatcgatgcccgccgcatcaccgatgcggtcggcattc	Protospacer
  **. *** ********** ********** ****** . 

18. spacer 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 9, identity: 0.775

gatgggcga-gcccgccgcagcaccgatgcgctcggcaacg	CRISPR spacer
-ctgatcgatgcccgccgcatcaccgatgcggtcggcattc	Protospacer
  **. *** ********** ********** ****** . 

19. spacer 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.775

gatgggcga-gcccgccgcagcaccgatgcgctcggcaacg	CRISPR spacer
-ctgatcgatgcccgccgcatcaccgatgcggtcggcattc	Protospacer
  **. *** ********** ********** ****** . 

20. spacer 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.775

gatgggcga-gcccgccgcagcaccgatgcgctcggcaacg	CRISPR spacer
-ctgatcgatgcccgccgcatcaccgatgcggtcggcattc	Protospacer
  **. *** ********** ********** ****** . 

21. spacer 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.775

gatgggcga-gcccgccgcagcaccgatgcgctcggcaacg	CRISPR spacer
-ctgatcgatgcccgccgcatcaccgatgcggtcggcattc	Protospacer
  **. *** ********** ********** ****** . 

22. spacer 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.775

gatgggcga-gcccgccgcagcaccgatgcgctcggcaacg	CRISPR spacer
-ctgatcgatgcccgccgcatcaccgatgcggtcggcattc	Protospacer
  **. *** ********** ********** ****** . 

23. spacer 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.775

gatgggcga-gcccgccgcagcaccgatgcgctcggcaacg	CRISPR spacer
-ctgatcgatgcccgccgcatcaccgatgcggtcggcattc	Protospacer
  **. *** ********** ********** ****** . 

24. spacer 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.775

gatgggcga-gcccgccgcagcaccgatgcgctcggcaacg	CRISPR spacer
-ctgatcgatgcccgccgcatcaccgatgcggtcggcattc	Protospacer
  **. *** ********** ********** ****** . 

25. spacer 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.775

gatgggcga-gcccgccgcagcaccgatgcgctcggcaacg	CRISPR spacer
-ctgatcgatgcccgccgcatcaccgatgcggtcggcattc	Protospacer
  **. *** ********** ********** ****** . 

26. spacer 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.775

gatgggcga-gcccgccgcagcaccgatgcgctcggcaacg	CRISPR spacer
-ctgatcgatgcccgccgcatcaccgatgcggtcggcattc	Protospacer
  **. *** ********** ********** ****** . 

27. spacer 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.775

gatgggcga-gcccgccgcagcaccgatgcgctcggcaacg	CRISPR spacer
-ctgatcgatgcccgccgcatcaccgatgcggtcggcattc	Protospacer
  **. *** ********** ********** ****** . 

28. spacer 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.775

gatgggcga-gcccgccgcagcaccgatgcgctcggcaacg	CRISPR spacer
-ctgatcgatgcccgccgcatcaccgatgcggtcggcattc	Protospacer
  **. *** ********** ********** ****** . 

29. spacer 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.775

gatgggcga-gcccgccgcagcaccgatgcgctcggcaacg	CRISPR spacer
-ctgatcgatgcccgccgcatcaccgatgcggtcggcattc	Protospacer
  **. *** ********** ********** ****** . 

30. spacer 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.775

gatgggcga-gcccgccgcagcaccgatgcgctcggcaacg	CRISPR spacer
-ctgatcgatgcccgccgcatcaccgatgcggtcggcattc	Protospacer
  **. *** ********** ********** ****** . 

31. spacer 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.775

gatgggcga-gcccgccgcagcaccgatgcgctcggcaacg	CRISPR spacer
-ctgatcgatgcccgccgcatcaccgatgcggtcggcattc	Protospacer
  **. *** ********** ********** ****** . 

32. spacer 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.775

gatgggcga-gcccgccgcagcaccgatgcgctcggcaacg	CRISPR spacer
-ctgatcgatgcccgccgcatcaccgatgcggtcggcattc	Protospacer
  **. *** ********** ********** ****** . 

33. spacer 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.775

gatgggcga-gcccgccgcagcaccgatgcgctcggcaacg	CRISPR spacer
-ctgatcgatgcccgccgcatcaccgatgcggtcggcattc	Protospacer
  **. *** ********** ********** ****** . 

34. spacer 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.775

gatgggcga-gcccgccgcagcaccgatgcgctcggcaacg	CRISPR spacer
-ctgatcgatgcccgccgcatcaccgatgcggtcggcattc	Protospacer
  **. *** ********** ********** ****** . 

35. spacer 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.775

gatgggcga-gcccgccgcagcaccgatgcgctcggcaacg	CRISPR spacer
-ctgatcgatgcccgccgcatcaccgatgcggtcggcattc	Protospacer
  **. *** ********** ********** ****** . 

36. spacer 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.775

gatgggcga-gcccgccgcagcaccgatgcgctcggcaacg	CRISPR spacer
-ctgatcgatgcccgccgcatcaccgatgcggtcggcattc	Protospacer
  **. *** ********** ********** ****** . 

37. spacer 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.775

gatgggcga-gcccgccgcagcaccgatgcgctcggcaacg	CRISPR spacer
-ctgatcgatgcccgccgcatcaccgatgcggtcggcattc	Protospacer
  **. *** ********** ********** ****** . 

38. spacer 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.775

gatgggcga-gcccgccgcagcaccgatgcgctcggcaacg	CRISPR spacer
-ctgatcgatgcccgccgcatcaccgatgcggtcggcattc	Protospacer
  **. *** ********** ********** ****** . 

39. spacer 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.775

gatgggcga-gcccgccgcagcaccgatgcgctcggcaacg	CRISPR spacer
-ctgatcgatgcccgccgcatcaccgatgcggtcggcattc	Protospacer
  **. *** ********** ********** ****** . 

40. spacer 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.775

gatgggcga-gcccgccgcagcaccgatgcgctcggcaacg	CRISPR spacer
-ctgatcgatgcccgccgcatcaccgatgcggtcggcattc	Protospacer
  **. *** ********** ********** ****** . 

41. spacer 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.775

gatgggcga-gcccgccgcagcaccgatgcgctcggcaacg	CRISPR spacer
-ctgatcgatgcccgccgcatcaccgatgcggtcggcattc	Protospacer
  **. *** ********** ********** ****** . 

42. spacer 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.775

gatgggcga-gcccgccgcagcaccgatgcgctcggcaacg	CRISPR spacer
-ctgatcgatgcccgccgcatcaccgatgcggtcggcattc	Protospacer
  **. *** ********** ********** ****** . 

43. spacer 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.775

gatgggcga-gcccgccgcagcaccgatgcgctcggcaacg	CRISPR spacer
-ctgatcgatgcccgccgcatcaccgatgcggtcggcattc	Protospacer
  **. *** ********** ********** ****** . 

44. spacer 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.775

gatgggcga-gcccgccgcagcaccgatgcgctcggcaacg	CRISPR spacer
-ctgatcgatgcccgccgcatcaccgatgcggtcggcattc	Protospacer
  **. *** ********** ********** ****** . 

45. spacer 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 9, identity: 0.775

gatgggcga-gcccgccgcagcaccgatgcgctcggcaacg	CRISPR spacer
-ctgatcgatgcccgccgcatcaccgatgcggtcggcattc	Protospacer
  **. *** ********** ********** ****** . 

46. spacer 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.775

gatgggcga-gcccgccgcagcaccgatgcgctcggcaacg	CRISPR spacer
-ctgatcgatgcccgccgcatcaccgatgcggtcggcattc	Protospacer
  **. *** ********** ********** ****** . 

47. spacer 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.775

gatgggcga-gcccgccgcagcaccgatgcgctcggcaacg	CRISPR spacer
-ctgatcgatgcccgccgcatcaccgatgcggtcggcattc	Protospacer
  **. *** ********** ********** ****** . 

48. spacer 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.775

gatgggcga-gcccgccgcagcaccgatgcgctcggcaacg	CRISPR spacer
-ctgatcgatgcccgccgcatcaccgatgcggtcggcattc	Protospacer
  **. *** ********** ********** ****** . 

49. spacer 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.775

gatgggcga-gcccgccgcagcaccgatgcgctcggcaacg	CRISPR spacer
-ctgatcgatgcccgccgcatcaccgatgcggtcggcattc	Protospacer
  **. *** ********** ********** ****** . 

50. spacer 1.1|1026225|40|NZ_CP047650|CRISPRCasFinder matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.775

gatgggcga-gcccgccgcagcaccgatgcgctcggcaacg	CRISPR spacer
-ctgatcgatgcccgccgcatcaccgatgcggtcggcattc	Protospacer
  **. *** ********** ********** ****** . 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 783518 : 792756 10 Streptococcus_phage(16.67%) NA NA
DBSCAN-SWA_2 2566132 : 2577779 11 Acinetobacter_phage(42.86%) NA NA
DBSCAN-SWA_3 3450978 : 3485892 39 uncultured_Caudovirales_phage(14.29%) integrase,portal,tail,capsid,terminase,protease,head attL 3443523:3443539|attR 3481609:3481625
DBSCAN-SWA_4 4152055 : 4161263 7 Tupanvirus(33.33%) NA NA
DBSCAN-SWA_5 4374254 : 4398447 29 Pseudomonas_phage(25.0%) terminase,tail,coat NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage