Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP047657 Paraglaciecola mesophila strain GPM4 plasmid unnamed 0 crisprs NA 0 0 0 0
NZ_CP047656 Paraglaciecola mesophila strain GPM4 chromosome, complete genome 3 crisprs DEDDh,csa3,cas3,DinG,Cas9_archaeal,RT,WYL 1 0 0 0

Results visualization

1. NZ_CP047656
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047656_1 1466209-1466284 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047656_2 1861564-1861693 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047656_3 3905998-3906119 Orphan NA
1 spacers
WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP047656_2 2.1|1861600|58|NZ_CP047656|CRISPRCasFinder 1861600-1861657 58 NZ_CP047656.1 1861758-1861815 0 1.0

1. spacer 2.1|1861600|58|NZ_CP047656|CRISPRCasFinder matches to position: 1861758-1861815, mismatch: 0, identity: 1.0

atgggtgtctcaataacgatttccaaaccatcttgttatggggtgtctcgataacgat	CRISPR spacer
atgggtgtctcaataacgatttccaaaccatcttgttatggggtgtctcgataacgat	Protospacer
**********************************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage