Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP047699 Bacillus megaterium strain 5-3 chromosome, complete genome 5 crisprs DinG,csa3,cas3,WYL,DEDDh,cas14j 2 1 7 0

Results visualization

1. NZ_CP047699
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047699_1 394185-394344 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047699_2 977203-977298 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047699_3 1078657-1078737 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047699_4 1211649-1211858 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047699_5 1577408-1577490 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP047699_4 4.2|1211739|18|NZ_CP047699|CRT 1211739-1211756 18 NZ_CP047699.1 1414195-1414212 1 0.944
NZ_CP047699_4 4.2|1211739|18|NZ_CP047699|CRT 1211739-1211756 18 NZ_CP047699.1 1414270-1414287 1 0.944
NZ_CP047699_4 4.2|1211739|18|NZ_CP047699|CRT 1211739-1211756 18 NZ_CP047699.1 1414336-1414353 1 0.944
NZ_CP047699_4 4.1|1211679|30|NZ_CP047699|CRT 1211679-1211708 30 NZ_CP047699.1 1414324-1414353 2 0.933

1. spacer 4.2|1211739|18|NZ_CP047699|CRT matches to position: 1414195-1414212, mismatch: 1, identity: 0.944

gcgagtagaacggcgggt	CRISPR spacer
gcgagtagaacggcgagt	Protospacer
***************.**

2. spacer 4.2|1211739|18|NZ_CP047699|CRT matches to position: 1414270-1414287, mismatch: 1, identity: 0.944

gcgagtagaacggcgggt	CRISPR spacer
gcgagtagaacggcgagt	Protospacer
***************.**

3. spacer 4.2|1211739|18|NZ_CP047699|CRT matches to position: 1414336-1414353, mismatch: 1, identity: 0.944

gcgagtagaacggcgggt	CRISPR spacer
gcgagtagaacggcgagt	Protospacer
***************.**

4. spacer 4.1|1211679|30|NZ_CP047699|CRT matches to position: 1414324-1414353, mismatch: 2, identity: 0.933

gcgagtagaacggcgagtagaacggcgggt	CRISPR spacer
gcgggtagaacggcgagtagaacggcgagt	Protospacer
***.***********************.**

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP047699_4 4.1|1211679|30|NZ_CP047699|CRT 1211679-1211708 30 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 3184922-3184951 7 0.767
NZ_CP047699_4 4.1|1211679|30|NZ_CP047699|CRT 1211679-1211708 30 NZ_CP013558 Rhizobium phaseoli strain N841 plasmid pRphaN841a, complete sequence 9935-9964 7 0.767
NZ_CP047699_4 4.1|1211679|30|NZ_CP047699|CRT 1211679-1211708 30 NZ_CP013506 Rhizobium sp. N1341 plasmid pRspN1341a, complete sequence 10965-10994 7 0.767
NZ_CP047699_4 4.1|1211679|30|NZ_CP047699|CRT 1211679-1211708 30 NZ_CP013569 Rhizobium phaseoli strain N771 plasmid pRphaN771a, complete sequence 12419-12448 7 0.767
NZ_CP047699_4 4.1|1211679|30|NZ_CP047699|CRT 1211679-1211708 30 NZ_CP040760 Paracoccus sp. 2251 plasmid unnamed6, complete sequence 35558-35587 9 0.7

1. spacer 4.1|1211679|30|NZ_CP047699|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.767

gcgagtagaacggcgagtagaacggcgggt	CRISPR spacer
tggagaagcacggcgagtagaacggcgtca	Protospacer
  *** ** ******************   

2. spacer 4.1|1211679|30|NZ_CP047699|CRT matches to NZ_CP013558 (Rhizobium phaseoli strain N841 plasmid pRphaN841a, complete sequence) position: , mismatch: 7, identity: 0.767

gcgagtagaacggcgagtagaacggcgggt	CRISPR spacer
cggacgagaacggcgagaagatcggcgggc	Protospacer
  **  *********** *** *******.

3. spacer 4.1|1211679|30|NZ_CP047699|CRT matches to NZ_CP013506 (Rhizobium sp. N1341 plasmid pRspN1341a, complete sequence) position: , mismatch: 7, identity: 0.767

gcgagtagaacggcgagtagaacggcgggt	CRISPR spacer
cggacgagaacggcgagaagatcggcgggc	Protospacer
  **  *********** *** *******.

4. spacer 4.1|1211679|30|NZ_CP047699|CRT matches to NZ_CP013569 (Rhizobium phaseoli strain N771 plasmid pRphaN771a, complete sequence) position: , mismatch: 7, identity: 0.767

gcgagtagaacggcgagtagaacggcgggt	CRISPR spacer
cggacgagaacggcgagaagatcggcgggc	Protospacer
  **  *********** *** *******.

5. spacer 4.1|1211679|30|NZ_CP047699|CRT matches to NZ_CP040760 (Paracoccus sp. 2251 plasmid unnamed6, complete sequence) position: , mismatch: 9, identity: 0.7

gcgagtagaacggcgagtagaacggcgggt	CRISPR spacer
ttttaccgaacggctagtagaacggctggt	Protospacer
 .  .. ******* *********** ***

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 251657 : 259919 8 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_2 1996055 : 2013748 34 Bacillus_phage(52.94%) integrase attL 1995708:1995723|attR 2015675:2015690
DBSCAN-SWA_3 2018639 : 2046471 26 Bacillus_phage(80.0%) capsid,terminase NA
DBSCAN-SWA_4 2049922 : 2055068 9 Bacillus_phage(42.86%) NA NA
DBSCAN-SWA_5 2273236 : 2281448 7 Bacillus_virus(66.67%) NA NA
DBSCAN-SWA_6 4278730 : 4288030 8 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_7 5142230 : 5152697 8 Bacillus_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage