1. spacer 3.8|1269093|42|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.976
gctgtctgagtctgagtcgctgtctgagtcagaatcgctatc CRISPR spacer
gctgtctgagtctgagtcgctgtctgagtcagagtcgctatc Protospacer
*********************************.********
2. spacer 3.8|1269093|42|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.976
gctgtctgagtctgagtcgctgtctgagtcagaatcgctatc CRISPR spacer
gctgtctgagtctgagtcgctgtctgagtcagagtcgctatc Protospacer
*********************************.********
3. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 1, identity: 0.958
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtctgagtctgagtcgctatc Protospacer
.***********************
4. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 1, identity: 0.958
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtctgagtctgagtcgctatc Protospacer
.***********************
5. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 1, identity: 0.958
actgtctgagtctgagtcgctatc CRISPR spacer
actatctgagtctgagtcgctatc Protospacer
***.********************
6. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.958
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtctgagtctgagtcgctatc Protospacer
.***********************
7. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.958
actgtctgagtctgagtcgctatc CRISPR spacer
actatctgagtctgagtcgctatc Protospacer
***.********************
8. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.958
actgtctgagtctgagtcgctatc CRISPR spacer
actatctgagtctgagtcgctatc Protospacer
***.********************
9. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.958
actgtctgagtctgagtcgctatc CRISPR spacer
actatctgagtctgagtcgctatc Protospacer
***.********************
10. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 1, identity: 0.958
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtctgagtctgagtcgctatc Protospacer
.***********************
11. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 1, identity: 0.958
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtctgagtctgagtcgctatc Protospacer
.***********************
12. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 1, identity: 0.958
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtctgagtctgagtcgctatc Protospacer
.***********************
13. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.958
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtctgagtctgagtcgctatc Protospacer
.***********************
14. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.958
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtctgagtctgagtcgctatc Protospacer
.***********************
15. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.958
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtctgagtctgagtcgctatc Protospacer
.***********************
16. spacer 3.8|1269093|42|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.952
gctgtctgagtctgagtcgctgtctgagtcagaatcgctatc CRISPR spacer
gctgtctgagtcagagtcgctgtctgagtcagagtcgctatc Protospacer
************ ********************.********
17. spacer 3.8|1269093|42|NZ_CP047797|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 2, identity: 0.952
gctgtctgagtctgagtcgctgtctgagtcagaatcgctatc CRISPR spacer
gctgtctgagtctgagtcgctgtctgagtctgagtcgctatc Protospacer
****************************** **.********
18. spacer 3.8|1269093|42|NZ_CP047797|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.952
gctgtctgagtctgagtcgctgtctgagtcagaatcgctatc CRISPR spacer
gctgtctgagtctgagtcgctgtctgagtctgagtcgctatc Protospacer
****************************** **.********
19. spacer 3.8|1269093|42|NZ_CP047797|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 2, identity: 0.952
gctgtctgagtctgagtcgctgtctgagtcagaatcgctatc CRISPR spacer
gctgtctgagtctgagtcgctgtctgagtctgagtcgctatc Protospacer
****************************** **.********
20. spacer 3.11|1269273|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917
gctatctgaatccgagtcactgtc CRISPR spacer
gctatctgaatcagagtcgctgtc Protospacer
************ *****.*****
21. spacer 3.11|1269273|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917
gctatctgaatccgagtcactgtc CRISPR spacer
gctatctgaatcagagtcgctgtc Protospacer
************ *****.*****
22. spacer 3.11|1269273|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917
gctatctgaatccgagtcactgtc CRISPR spacer
gctatctgaatcagagtcgctgtc Protospacer
************ *****.*****
23. spacer 3.11|1269273|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917
gctatctgaatccgagtcactgtc CRISPR spacer
gctatctgaatcagagtcgctgtc Protospacer
************ *****.*****
24. spacer 3.11|1269273|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917
gctatctgaatccgagtcactgtc CRISPR spacer
gctatctgaatcagagtcgctgtc Protospacer
************ *****.*****
25. spacer 3.11|1269273|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917
gctatctgaatccgagtcactgtc CRISPR spacer
gctatctgaatcagagtcgctgtc Protospacer
************ *****.*****
26. spacer 3.11|1269273|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917
gctatctgaatccgagtcactgtc CRISPR spacer
gctatctgaatcagagtcgctgtc Protospacer
************ *****.*****
27. spacer 3.11|1269273|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917
gctatctgaatccgagtcactgtc CRISPR spacer
gctatctgaatcagagtcgctgtc Protospacer
************ *****.*****
28. spacer 3.11|1269273|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917
gctatctgaatccgagtcactgtc CRISPR spacer
gctatctgaatcagagtcgctgtc Protospacer
************ *****.*****
29. spacer 3.11|1269273|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917
gctatctgaatccgagtcactgtc CRISPR spacer
gctatctgaatcagagtcgctgtc Protospacer
************ *****.*****
30. spacer 3.11|1269273|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917
gctatctgaatccgagtcactgtc CRISPR spacer
gctatctgaatcagagtcgctgtc Protospacer
************ *****.*****
31. spacer 3.11|1269273|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917
gctatctgaatccgagtcactgtc CRISPR spacer
gctatctgaatcagagtcgctgtc Protospacer
************ *****.*****
32. spacer 3.11|1269273|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917
gctatctgaatccgagtcactgtc CRISPR spacer
gctatctgaatcagagtcgctgtc Protospacer
************ *****.*****
33. spacer 3.11|1269273|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917
gctatctgaatccgagtcactgtc CRISPR spacer
gctatctgaatcagagtcgctgtc Protospacer
************ *****.*****
34. spacer 3.11|1269273|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917
gctatctgaatccgagtcactgtc CRISPR spacer
gctatctgaatcagagtcgctgtc Protospacer
************ *****.*****
35. spacer 3.11|1269273|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917
gctatctgaatccgagtcactgtc CRISPR spacer
gctatctgaatcagagtcgctgtc Protospacer
************ *****.*****
36. spacer 3.11|1269273|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917
gctatctgaatccgagtcactgtc CRISPR spacer
gctatctgaatcagagtcgctgtc Protospacer
************ *****.*****
37. spacer 3.11|1269273|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917
gctatctgaatccgagtcactgtc CRISPR spacer
gctatctgaatcagagtcgctgtc Protospacer
************ *****.*****
38. spacer 3.11|1269273|24|NZ_CP047797|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.917
gctatctgaatccgagtcactgtc CRISPR spacer
gctatccgaatcggagtcactgtc Protospacer
******.***** ***********
39. spacer 3.11|1269273|24|NZ_CP047797|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.917
gctatctgaatccgagtcactgtc CRISPR spacer
gctgtccgaatccgagtcactgtc Protospacer
***.**.*****************
40. spacer 3.11|1269273|24|NZ_CP047797|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.917
gctatctgaatccgagtcactgtc CRISPR spacer
gctgtcagaatccgagtcactgtc Protospacer
***.** *****************
41. spacer 3.11|1269273|24|NZ_CP047797|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.917
gctatctgaatccgagtcactgtc CRISPR spacer
gctgtcggaatccgagtcactgtc Protospacer
***.** *****************
42. spacer 3.11|1269273|24|NZ_CP047797|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.917
gctatctgaatccgagtcactgtc CRISPR spacer
gctgtcggaatccgagtcactgtc Protospacer
***.** *****************
43. spacer 3.11|1269273|24|NZ_CP047797|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 2, identity: 0.917
gctatctgaatccgagtcactgtc CRISPR spacer
gctatctgaatctgagtcgctgtc Protospacer
************.*****.*****
44. spacer 3.11|1269273|24|NZ_CP047797|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 2, identity: 0.917
gctatctgaatccgagtcactgtc CRISPR spacer
gctatctgaatctgagtcgctgtc Protospacer
************.*****.*****
45. spacer 3.11|1269273|24|NZ_CP047797|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.917
gctatctgaatccgagtcactgtc CRISPR spacer
gctatctgaatctgagtcgctgtc Protospacer
************.*****.*****
46. spacer 3.11|1269273|24|NZ_CP047797|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.917
gctatctgaatccgagtcactgtc CRISPR spacer
gctgtcggaatccgagtcactgtc Protospacer
***.** *****************
47. spacer 3.11|1269273|24|NZ_CP047797|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.917
gctatctgaatccgagtcactgtc CRISPR spacer
gctgtcagaatccgagtcactgtc Protospacer
***.** *****************
48. spacer 3.11|1269273|24|NZ_CP047797|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.917
gctatctgaatccgagtcactgtc CRISPR spacer
gctgtcagaatccgagtcactgtc Protospacer
***.** *****************
49. spacer 3.11|1269273|24|NZ_CP047797|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.917
gctatctgaatccgagtcactgtc CRISPR spacer
gctgtcagaatccgagtcactgtc Protospacer
***.** *****************
50. spacer 3.11|1269273|24|NZ_CP047797|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.917
gctatctgaatccgagtcactgtc CRISPR spacer
gctgtcggaatccgagtcactgtc Protospacer
***.** *****************
51. spacer 3.11|1269273|24|NZ_CP047797|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.917
gctatctgaatccgagtcactgtc CRISPR spacer
gctgtcagaatccgagtcactgtc Protospacer
***.** *****************
52. spacer 3.11|1269273|24|NZ_CP047797|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 2, identity: 0.917
gctatctgaatccgagtcactgtc CRISPR spacer
gctatctgaatctgagtcgctgtc Protospacer
************.*****.*****
53. spacer 3.11|1269273|24|NZ_CP047797|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 2, identity: 0.917
gctatctgaatccgagtcactgtc CRISPR spacer
gctatctgaatctgagtcgctgtc Protospacer
************.*****.*****
54. spacer 3.11|1269273|24|NZ_CP047797|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 2, identity: 0.917
gctatctgaatccgagtcactgtc CRISPR spacer
gctatctgaatcggagtcgctgtc Protospacer
************ *****.*****
55. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 2, identity: 0.917
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtctgagtctgagtcgctgtc Protospacer
.********************.**
56. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 2, identity: 0.917
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtctgagtctgaatcgctatc Protospacer
.**************.********
57. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 2, identity: 0.917
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtctgagtctgagtcgctgtc Protospacer
.********************.**
58. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 2, identity: 0.917
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtctgagtctgagtcgctgtc Protospacer
.********************.**
59. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 2, identity: 0.917
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtctgagtctgagtcgctgtc Protospacer
.********************.**
60. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 2, identity: 0.917
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtctgagtctgagtcgctgtc Protospacer
.********************.**
61. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 2, identity: 0.917
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtctgaatctgagtcgctatc Protospacer
.********.**************
62. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 2, identity: 0.917
actgtctgagtctgagtcgctatc CRISPR spacer
actgtctgagtccgaatcgctatc Protospacer
************.**.********
63. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.917
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtctgagtctgagtcgctgtc Protospacer
.********************.**
64. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.917
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtctgagtctgaatcgctatc Protospacer
.**************.********
65. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.917
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtctgagtctgagtcgctgtc Protospacer
.********************.**
66. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.917
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtctgagtctgagtcgctgtc Protospacer
.********************.**
67. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.917
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtctgagtctgagtcgctacc Protospacer
.*********************.*
68. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.917
actgtctgagtctgagtcgctatc CRISPR spacer
actgtctgaatcggagtcgctatc Protospacer
*********.** ***********
69. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.917
actgtctgagtctgagtcgctatc CRISPR spacer
actgtctgaatcggagtcgctatc Protospacer
*********.** ***********
70. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.917
actgtctgagtctgagtcgctatc CRISPR spacer
actgtctgagtccgaatcgctatc Protospacer
************.**.********
71. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 2, identity: 0.917
actgtctgagtctgagtcgctatc CRISPR spacer
gctatctgagtctgagtcgctatc Protospacer
.**.********************
72. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 2, identity: 0.917
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtctgagtctgagtcgctgtc Protospacer
.********************.**
73. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 2, identity: 0.917
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtctgagtctgaatcgctatc Protospacer
.**************.********
74. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 2, identity: 0.917
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtctgagtctgaatcgctatc Protospacer
.**************.********
75. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 2, identity: 0.917
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtctgagtctgagtcgctgtc Protospacer
.********************.**
76. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 2, identity: 0.917
actgtctgagtctgagtcgctatc CRISPR spacer
actatctgagtctgaatcgctatc Protospacer
***.***********.********
77. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 2, identity: 0.917
actgtctgagtctgagtcgctatc CRISPR spacer
actgtctgagtccgaatcgctatc Protospacer
************.**.********
78. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 2, identity: 0.917
actgtctgagtctgagtcgctatc CRISPR spacer
actgtctgagtccgaatcgctatc Protospacer
************.**.********
79. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917
actgtctgagtctgagtcgctatc CRISPR spacer
gctatctgagtctgagtcgctatc Protospacer
.**.********************
80. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917
actgtctgagtctgagtcgctatc CRISPR spacer
gctatctgagtctgagtcgctatc Protospacer
.**.********************
81. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtctgagtcagagtcgctatc Protospacer
.*********** ***********
82. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtctgagtcagagtcgctatc Protospacer
.*********** ***********
83. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtctgagtcagagtcgctatc Protospacer
.*********** ***********
84. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtctgagtcagagtcgctatc Protospacer
.*********** ***********
85. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917
actgtctgagtctgagtcgctatc CRISPR spacer
gctatctgagtctgagtcgctatc Protospacer
.**.********************
86. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917
actgtctgagtctgagtcgctatc CRISPR spacer
gctatctgagtctgagtcgctatc Protospacer
.**.********************
87. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtctgagtcagagtcgctatc Protospacer
.*********** ***********
88. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtctgagtctgagtcgctgtc Protospacer
.********************.**
89. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtctgagtcagagtcgctatc Protospacer
.*********** ***********
90. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtctgagtcagagtcgctatc Protospacer
.*********** ***********
91. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917
actgtctgagtctgagtcgctatc CRISPR spacer
gctatctgagtctgagtcgctatc Protospacer
.**.********************
92. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtctgagtcagagtcgctatc Protospacer
.*********** ***********
93. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtctgagtcagagtcgctatc Protospacer
.*********** ***********
94. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtctgagtctgagtcgctgtc Protospacer
.********************.**
95. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtctgagtcagagtcgctatc Protospacer
.*********** ***********
96. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtctgagtcagagtcgctatc Protospacer
.*********** ***********
97. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtctgagtcagagtcgctatc Protospacer
.*********** ***********
98. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtctgagtctgagtcgctgtc Protospacer
.********************.**
99. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtctgagtcagagtcgctatc Protospacer
.*********** ***********
100. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtctgagtcagagtcgctatc Protospacer
.*********** ***********
101. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917
actgtctgagtctgagtcgctatc CRISPR spacer
gctatctgagtctgagtcgctatc Protospacer
.**.********************
102. spacer 3.13|1269381|24|NZ_CP047797|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.917
gctatctgagtcggaatcactatc CRISPR spacer
actatctgaatcggaatcactatc Protospacer
.********.**************
103. spacer 3.13|1269381|24|NZ_CP047797|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.917
gctatctgagtcggaatcactatc CRISPR spacer
actatctgaatcggaatcactatc Protospacer
.********.**************
104. spacer 3.13|1269381|24|NZ_CP047797|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.917
gctatctgagtcggaatcactatc CRISPR spacer
gctatctgagtctgaatcactgtc Protospacer
************ ********.**
105. spacer 3.13|1269381|24|NZ_CP047797|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.917
gctatctgagtcggaatcactatc CRISPR spacer
gctgtctgaatcggaatcactatc Protospacer
***.*****.**************
106. spacer 3.13|1269381|24|NZ_CP047797|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.917
gctatctgagtcggaatcactatc CRISPR spacer
gctatctgagtctgaatcactgtc Protospacer
************ ********.**
107. spacer 3.13|1269381|24|NZ_CP047797|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.917
gctatctgagtcggaatcactatc CRISPR spacer
gctgtctgaatcggaatcactatc Protospacer
***.*****.**************
108. spacer 3.13|1269381|24|NZ_CP047797|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.917
gctatctgagtcggaatcactatc CRISPR spacer
gctatctgagtctgaatcactgtc Protospacer
************ ********.**
109. spacer 3.13|1269381|24|NZ_CP047797|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 2, identity: 0.917
gctatctgagtcggaatcactatc CRISPR spacer
actatctgaatcggaatcactatc Protospacer
.********.**************
110. spacer 3.13|1269381|24|NZ_CP047797|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 2, identity: 0.917
gctatctgagtcggaatcactatc CRISPR spacer
gctgtctgaatcggaatcactatc Protospacer
***.*****.**************
111. spacer 3.13|1269381|24|NZ_CP047797|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 2, identity: 0.917
gctatctgagtcggaatcactatc CRISPR spacer
gctatctgagtctgaatcactgtc Protospacer
************ ********.**
112. spacer 3.13|1269381|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917
gctatctgagtcggaatcactatc CRISPR spacer
gctatctgagtctgaatcgctatc Protospacer
************ *****.*****
113. spacer 3.13|1269381|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917
gctatctgagtcggaatcactatc CRISPR spacer
gctatctgagtctgaatcgctatc Protospacer
************ *****.*****
114. spacer 3.13|1269381|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917
gctatctgagtcggaatcactatc CRISPR spacer
gctatctgagtctgaatcgctatc Protospacer
************ *****.*****
115. spacer 3.13|1269381|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917
gctatctgagtcggaatcactatc CRISPR spacer
gctatctgagtctgaatcgctatc Protospacer
************ *****.*****
116. spacer 3.13|1269381|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917
gctatctgagtcggaatcactatc CRISPR spacer
gctatctgagtctgaatcgctatc Protospacer
************ *****.*****
117. spacer 3.13|1269381|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917
gctatctgagtcggaatcactatc CRISPR spacer
gctatctgagtctgaatcgctatc Protospacer
************ *****.*****
118. spacer 3.13|1269381|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917
gctatctgagtcggaatcactatc CRISPR spacer
gctatctgagtctgaatcgctatc Protospacer
************ *****.*****
119. spacer 3.13|1269381|24|NZ_CP047797|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 2, identity: 0.917
gctatctgagtcggaatcactatc CRISPR spacer
gctgtctgaatcggaatcactatc Protospacer
***.*****.**************
120. spacer 3.13|1269381|24|NZ_CP047797|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 2, identity: 0.917
gctatctgagtcggaatcactatc CRISPR spacer
gctatctgagtctgaatcactgtc Protospacer
************ ********.**
121. spacer 3.11|1269273|24|NZ_CP047797|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.875
gctatctgaatccgagtcactgtc CRISPR spacer
actgtccgaatccgagtcactgtc Protospacer
.**.**.*****************
122. spacer 3.11|1269273|24|NZ_CP047797|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.875
gctatctgaatccgagtcactgtc CRISPR spacer
actgtccgaatccgagtcactgtc Protospacer
.**.**.*****************
123. spacer 3.11|1269273|24|NZ_CP047797|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.875
gctatctgaatccgagtcactgtc CRISPR spacer
actgtccgaatccgagtcactgtc Protospacer
.**.**.*****************
124. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 3, identity: 0.875
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtctgaatctgagtcgctgtc Protospacer
.********.***********.**
125. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 3, identity: 0.875
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtctgaatctgagtcgctgtc Protospacer
.********.***********.**
126. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 3, identity: 0.875
actgtctgagtctgagtcgctatc CRISPR spacer
gctatctgaatctgagtcgctatc Protospacer
.**.*****.**************
127. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
actgtctgagtctgagtcgctatc CRISPR spacer
gctatctgagtctgagtcgctgtc Protospacer
.**.*****************.**
128. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
actgtctgagtctgagtcgctatc CRISPR spacer
gctatctgagtctgagtcgctgtc Protospacer
.**.*****************.**
129. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtctgaatctgagtcgctgtc Protospacer
.********.***********.**
130. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 3, identity: 0.875
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtctgaatctgagtcgctgtc Protospacer
.********.***********.**
131. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 3, identity: 0.875
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtctgaatctgagtcgctgtc Protospacer
.********.***********.**
132. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875
actgtctgagtctgagtcgctatc CRISPR spacer
tgagtctgagtctgagtcgctatc Protospacer
*********************
133. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875
actgtctgagtctgagtcgctatc CRISPR spacer
tgagtctgagtctgagtcgctatc Protospacer
*********************
134. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875
actgtctgagtctgagtcgctatc CRISPR spacer
tgagtctgagtctgagtcgctatc Protospacer
*********************
135. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875
actgtctgagtctgagtcgctatc CRISPR spacer
tgagtctgagtctgagtcgctatc Protospacer
*********************
136. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875
actgtctgagtctgagtcgctatc CRISPR spacer
gctatctgagtcagagtcgctatc Protospacer
.**.******** ***********
137. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtctgagtcagagtcgctgtc Protospacer
.*********** ********.**
138. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtcagagtctgaatcgctatc Protospacer
.***** ********.********
139. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtctgaatcagagtcgctatc Protospacer
.********.** ***********
140. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtctgagtcagagtcgctgtc Protospacer
.*********** ********.**
141. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875
actgtctgagtctgagtcgctatc CRISPR spacer
gctatctgagtcagagtcgctatc Protospacer
.**.******** ***********
142. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtctgaatcagagtcgctatc Protospacer
.********.** ***********
143. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875
actgtctgagtctgagtcgctatc CRISPR spacer
gctatctgagtctgaatcgctatc Protospacer
.**.***********.********
144. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtctgagtcagagtcgctgtc Protospacer
.*********** ********.**
145. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtcagagtctgaatcgctatc Protospacer
.***** ********.********
146. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875
actgtctgagtctgagtcgctatc CRISPR spacer
gctatctgagtctgaatcgctatc Protospacer
.**.***********.********
147. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtcagagtctgaatcgctatc Protospacer
.***** ********.********
148. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875
actgtctgagtctgagtcgctatc CRISPR spacer
gctatctgagtctgaatcgctatc Protospacer
.**.***********.********
149. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875
actgtctgagtctgagtcgctatc CRISPR spacer
gctatctgagtctgaatcgctatc Protospacer
.**.***********.********
150. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtctgaatcagagtcgctatc Protospacer
.********.** ***********
151. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875
actgtctgagtctgagtcgctatc CRISPR spacer
gctatctgagtctgaatcgctatc Protospacer
.**.***********.********
152. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtcagagtctgaatcgctatc Protospacer
.***** ********.********
153. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtctgaatcagagtcgctatc Protospacer
.********.** ***********
154. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtctgaatcagagtcgctatc Protospacer
.********.** ***********
155. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtctgaatcagagtcgctatc Protospacer
.********.** ***********
156. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875
actgtctgagtctgagtcgctatc CRISPR spacer
gctatctgagtctgaatcgctatc Protospacer
.**.***********.********
157. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtcagagtctgaatcgctatc Protospacer
.***** ********.********
158. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875
actgtctgagtctgagtcgctatc CRISPR spacer
gctatctgagtctgaatcgctatc Protospacer
.**.***********.********
159. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtctgaatcagagtcgctatc Protospacer
.********.** ***********
160. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtctgagtctgaatcgctgtc Protospacer
.**************.*****.**
161. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.875
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtctgagtccgagtcgctgtc Protospacer
.***********.********.**
162. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.875
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtcggagtctgagtcgctgtc Protospacer
.***** **************.**
163. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.875
actgtctgagtctgagtcgctatc CRISPR spacer
gctgtcggagtctgagtcgctgtc Protospacer
.***** **************.**
164. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to DQ238866 (Environmental halophage 1 AAJ-2005, partial genome) position: , mismatch: 3, identity: 0.875
actgtctgagtctgagtcgctatc CRISPR spacer
actgtctgcgtctgagtcgttatt Protospacer
******** **********.***.
165. spacer 3.13|1269381|24|NZ_CP047797|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 3, identity: 0.875
gctatctgagtcggaatcactatc CRISPR spacer
actatctgagtctgaatcgctatc Protospacer
.*********** *****.*****
166. spacer 3.14|1269435|24|NZ_CP047797|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 3, identity: 0.875
gcttgctgaatctgaatcactcgc CRISPR spacer
acttgctgattctgaatcactcac Protospacer
.******** ************.*
167. spacer 3.14|1269435|24|NZ_CP047797|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 3, identity: 0.875
gcttgctgaatctgaatcactcgc CRISPR spacer
acttgctgattctgaatcactcac Protospacer
.******** ************.*
168. spacer 3.14|1269435|24|NZ_CP047797|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 3, identity: 0.875
gcttgctgaatctgaatcactcgc CRISPR spacer
acttgctgattctgaatcactcac Protospacer
.******** ************.*
169. spacer 3.14|1269435|24|NZ_CP047797|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 3, identity: 0.875
gcttgctgaatctgaatcactcgc CRISPR spacer
acttgctgattctgaatcactcac Protospacer
.******** ************.*
170. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833
actgtctgagtctgagtcgctatc CRISPR spacer
tgagtcagagtctgagtcgctatc Protospacer
*** *****************
171. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833
actgtctgagtctgagtcgctatc CRISPR spacer
tgagtcagagtctgagtcgctatc Protospacer
*** *****************
172. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833
actgtctgagtctgagtcgctatc CRISPR spacer
tgagtcagagtctgagtcgctatc Protospacer
*** *****************
173. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833
actgtctgagtctgagtcgctatc CRISPR spacer
tgagtcagagtctgagtcgctatc Protospacer
*** *****************
174. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833
actgtctgagtctgagtcgctatc CRISPR spacer
tgagtcagagtctgagtcgctatc Protospacer
*** *****************
175. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833
actgtctgagtctgagtcgctatc CRISPR spacer
tgagtcagagtctgagtcgctatc Protospacer
*** *****************
176. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833
actgtctgagtctgagtcgctatc CRISPR spacer
tgagtcagagtctgagtcgctatc Protospacer
*** *****************
177. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833
actgtctgagtctgagtcgctatc CRISPR spacer
tgagtctgagtctgaatcgctatc Protospacer
************.********
178. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833
actgtctgagtctgagtcgctatc CRISPR spacer
tgagtctgagtctgaatcgctatc Protospacer
************.********
179. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833
actgtctgagtctgagtcgctatc CRISPR spacer
tgagtctgagtctgaatcgctatc Protospacer
************.********
180. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833
actgtctgagtctgagtcgctatc CRISPR spacer
tgagtcagagtctgagtcgctatc Protospacer
*** *****************
181. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833
actgtctgagtctgagtcgctatc CRISPR spacer
tgagtctgagtctgaatcgctatc Protospacer
************.********
182. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833
actgtctgagtctgagtcgctatc CRISPR spacer
tgagtctgagtctgaatcgctatc Protospacer
************.********
183. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833
actgtctgagtctgagtcgctatc CRISPR spacer
tgagtcagagtctgagtcgctatc Protospacer
*** *****************
184. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833
actgtctgagtctgagtcgctatc CRISPR spacer
tgagtctgagtctgaatcgctatc Protospacer
************.********
185. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833
actgtctgagtctgagtcgctatc CRISPR spacer
tgagtctgagtctgaatcgctatc Protospacer
************.********
186. spacer 3.12|1269327|24|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833
actgtctgagtctgagtcgctatc CRISPR spacer
tgagtcagagtctgagtcgctatc Protospacer
*** *****************
187. spacer 3.5|1268847|42|NZ_CP047797|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 5, identity: 0.881
actcgctgaatctgagtcgctgtcggaatctgaatcactatc CRISPR spacer
gctatctgaatctgagtcgctgtctgaatctgaatcactgtc Protospacer
.** ******************* **************.**
188. spacer 3.5|1268847|42|NZ_CP047797|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.881
actcgctgaatctgagtcgctgtcggaatctgaatcactatc CRISPR spacer
gctatctgaatctgagtcgctgtctgaatctgaatcactgtc Protospacer
.** ******************* **************.**
189. spacer 3.5|1268847|42|NZ_CP047797|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 5, identity: 0.881
actcgctgaatctgagtcgctgtcggaatctgaatcactatc CRISPR spacer
gctatctgaatctgagtcgctgtctgaatctgaatcactgtc Protospacer
.** ******************* **************.**
190. spacer 3.5|1268847|42|NZ_CP047797|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 5, identity: 0.881
actcgctgaatctgagtcgctgtcggaatctgaatcactatc CRISPR spacer
gctatctgaatctgagtcgctgtctgaatctgaatcactgtc Protospacer
.** ******************* **************.**
191. spacer 4.1|1584030|28|NZ_CP047797|CRISPRCasFinder matches to NC_021536 (Synechococcus phage S-IOM18 genomic sequence) position: , mismatch: 5, identity: 0.821
tgcactttatcgtaagctgacttttcgt CRISPR spacer
taaattttatcgtaaggtgagttttcgt Protospacer
*. *.*********** *** *******
192. spacer 1.1|239371|28|NZ_CP047797|CRISPRCasFinder matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 6, identity: 0.786
tcccgccaacttgtacattattgaaagt CRISPR spacer
tcccgccaacttgtccataattgcatac Protospacer
************** *** **** * ..
193. spacer 3.8|1269093|42|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.857
gctgtctgagtctgagtcgctgtctgagtcagaatcgctatc CRISPR spacer
gctgtctgagtctgagtcgctgtctgagtctgagtcagagtc Protospacer
****************************** **.**. .**
194. spacer 3.9|1269165|30|NZ_CP047797|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
gctgtctgagtcggaatcgctcgctgagtc CRISPR spacer
gctgtctgagtctgaatcgctgtcgctgtc Protospacer
************ ******** * ***
195. spacer 4.1|1584030|28|NZ_CP047797|CRISPRCasFinder matches to LN846932 (Carnobacterium maltaromaticum strain LMA28 LMA_pa plamid, complete genome) position: , mismatch: 6, identity: 0.786
tgcactttatcgtaagctgacttttcgt CRISPR spacer
actaatttatcgtaatctgatttttcgt Protospacer
.* ********** ****.*******
196. spacer 1.1|239371|28|NZ_CP047797|CRISPRCasFinder matches to NC_014249 ('Nostoc azollae' 0708 plasmid pAzo01, complete sequence) position: , mismatch: 7, identity: 0.75
tcccgccaacttgtacattattgaaagt CRISPR spacer
cgactgtaacttgttcattattgaaagt Protospacer
. * .******* *************
197. spacer 1.1|239371|28|NZ_CP047797|CRISPRCasFinder matches to MT559527 (UNVERIFIED: Klebsiella phage vB_KpnP_cmc20192, complete genome) position: , mismatch: 7, identity: 0.75
tcccgccaacttgtacattattgaaagt CRISPR spacer
tcccgccagcttgtacgttattggcgca Protospacer
********.*******.******. .
198. spacer 1.1|239371|28|NZ_CP047797|CRISPRCasFinder matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 7, identity: 0.75
tcccgccaacttgtacattattgaaagt CRISPR spacer
tcccgccaacttgtccatgattgcgtac Protospacer
************** *** **** . ..
199. spacer 3.9|1269165|30|NZ_CP047797|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.767
gctgtctgagtcggaatcgctcgctgagtc CRISPR spacer
gctgtcggagtcggaatcgctgtcactatc Protospacer
****** ************** * .**
200. spacer 3.9|1269165|30|NZ_CP047797|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.767
gctgtctgagtcggaatcgctcgctgagtc CRISPR spacer
gctgtcggagtcggaatcgctgtcactatc Protospacer
****** ************** * .**
201. spacer 4.1|1584030|28|NZ_CP047797|CRISPRCasFinder matches to NZ_CP015319 (Mesorhizobium amorphae CCNWGS0123 plasmid pM0123a) position: , mismatch: 7, identity: 0.75
tgcactttatcgtaagctgacttttcgt CRISPR spacer
aaagctttttcgtaagctgacatttcga Protospacer
. .**** ************ *****
202. spacer 1.1|239371|28|NZ_CP047797|CRISPRCasFinder matches to NZ_CP009639 (Bacillus cereus 03BB108 plasmid pBFI_1, complete sequence) position: , mismatch: 8, identity: 0.714
tcccgccaacttgtacattattgaaagt CRISPR spacer
cggaaaaaaattgtacattattgaaagt Protospacer
. . ** ******************
203. spacer 1.1|239371|28|NZ_CP047797|CRISPRCasFinder matches to NZ_CP053963 (Bacillus cereus strain FDAARGOS_802 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.714
tcccgccaacttgtacattattgaaagt CRISPR spacer
cggaaaaaaattgtacattattgaaagt Protospacer
. . ** ******************
204. spacer 3.9|1269165|30|NZ_CP047797|CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.733
gctgtctgagtcggaatcgctcgctgagtc CRISPR spacer
agccactgagtcggcatcgctcgccgagtt Protospacer
. . ********* *********.****.
205. spacer 3.9|1269165|30|NZ_CP047797|CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 8, identity: 0.733
gctgtctgagtcggaatcgctcgctgagtc CRISPR spacer
agccactgagtcggcatcgctcgccgagtt Protospacer
. . ********* *********.****.
206. spacer 6.1|2105722|31|NZ_CP047797|CRISPRCasFinder matches to NZ_CP009619 (Vibrio coralliilyticus strain RE98 plasmid p380, complete sequence) position: , mismatch: 8, identity: 0.742
tttcgaaaagaaattctacaggcaatgcgag CRISPR spacer
ttgaaaaaagaaatgctacaggtaatgcagc Protospacer
** .********* *******.*****..