Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP017146 Marisediminicola antarctica strain ZS314 chromosome, complete genome 13 crisprs csa3,cas3,RT,DEDDh,WYL 2 5 2 0

Results visualization

1. NZ_CP017146
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017146_1 440363-440428 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017146_2 544677-544774 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017146_3 665085-665278 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017146_4 754653-754759 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017146_5 819069-819177 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017146_6 843055-843175 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017146_7 866072-866228 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017146_8 986672-986748 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017146_9 1054422-1054537 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017146_10 1209340-1209499 Orphan NA
2 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017146_11 1795070-1795184 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017146_12 1856581-1856662 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017146_13 3050515-3050623 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP017146_10 10.2|1209443|32|NZ_CP017146|CRISPRCasFinder 1209443-1209474 32 NZ_CP017146.1 1209481-1209512 0 1.0
NZ_CP017146_6 6.2|843128|20|NZ_CP017146|CRISPRCasFinder 843128-843147 20 NZ_CP017146.1 843164-843183 1 0.95

1. spacer 10.2|1209443|32|NZ_CP017146|CRISPRCasFinder matches to position: 1209481-1209512, mismatch: 0, identity: 1.0

atagcgcgttgtgcccgcgatagcgcgttgtg	CRISPR spacer
atagcgcgttgtgcccgcgatagcgcgttgtg	Protospacer
********************************

2. spacer 6.2|843128|20|NZ_CP017146|CRISPRCasFinder matches to position: 843164-843183, mismatch: 1, identity: 0.95

tcctggagccgatcctggag	CRISPR spacer
tcctgcagccgatcctggag	Protospacer
***** **************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP011665 Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence 136888-136909 0 1.0
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP024248 Escherichia coli O27:H7 strain B4103-1 plasmid unnamed3, complete sequence 108717-108738 0 1.0
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP011665 Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence 136879-136900 1 0.955
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NC_047783 Klebsiella phage vB_KpnP_KpV48, complete genome 15317-15338 1 0.955
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 MN694571 Marine virus AFVG_250M1012, complete genome 21793-21814 1 0.955
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 MN694571 Marine virus AFVG_250M1012, complete genome 21802-21823 1 0.955
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NC_049478 Arthrobacter phage Mufasa8, complete genome 6091-6112 1 0.955
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NC_025025 Mycobacterium tuberculosis H37Rv plasmid pTYGi9, complete sequence 4587-4608 1 0.955
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 824585-824606 1 0.955
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NC_010879 Burkholderia glumae strain BGR1 plasmid pBGF2, complete sequence 10782-10803 1 0.955
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 KR063279 Gordonia phage GMA3, complete genome 52423-52444 1 0.955
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 MG592428 Vibrio phage 1.046.O._10N.286.52.E3, partial genome 44405-44426 1 0.955
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NC_031109 Gordonia phage Jumbo, complete genome 54644-54665 1 0.955
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP027299 Streptomyces sp. SGAir0924 plasmid unnamed_5 40119-40140 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 MG592428 Vibrio phage 1.046.O._10N.286.52.E3, partial genome 44396-44417 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 MG592428 Vibrio phage 1.046.O._10N.286.52.E3, partial genome 44435-44456 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NC_031109 Gordonia phage Jumbo, complete genome 54635-54656 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 107500-107521 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 883639-883660 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 503897-503918 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 1558314-1558335 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 1401335-1401356 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 419565-419586 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP025613 Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence 854375-854396 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_AP022571 Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence 93790-93811 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 1615162-1615183 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1486673-1486694 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 131490-131511 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 1659347-1659368 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP028965 Burkholderia sp. IDO3 plasmid p1, complete sequence 184373-184394 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NC_010802 Burkholderia multivorans ATCC 17616 plasmid pTGL1, complete sequence 100243-100264 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP042167 Burkholderia contaminans strain ZCC plasmid unnamed1, complete sequence 196516-196537 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 551409-551430 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP023408 Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence 363925-363946 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 1598050-1598071 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 1577903-1577924 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 1549352-1549373 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 1549352-1549373 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 KX856662 Klebsiella phage KP-Rio/2015, complete genome 15831-15852 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 KP708985 Klebsiella phage vB_KpnP_SU503, complete genome 16214-16235 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NC_028664 Klebsiella phage vB_Kp2, complete genome 15663-15684 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 MT701589 Klebsiella phage Pone, complete genome 15087-15108 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 MT682065 Klebsiella virus KpV2883, complete genome 14462-14483 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 MT360680 Klebsiella virus 2019KP1, complete genome 4975-4996 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 MN380459 Klebsiella phage vB_KpnP_fHeKpn01, complete genome 15775-15796 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 KX211991 Klebsiella phage vB_KpnP_KpV475, complete genome 14469-14490 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 GQ413938 Klebsiella phage KP34, complete genome 15789-15810 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NC_010070 Burkholderia multivorans ATCC 17616 plasmid pBMUL01, complete sequence 13222-13243 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 573922-573943 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP010024 Paraburkholderia fungorum strain ATCC BAA-463 plasmid pBIL, complete sequence 165666-165687 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 386525-386546 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 563222-563243 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 514450-514471 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 686737-686758 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 563536-563557 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NC_012528 Deinococcus deserti VCD115 plasmid 3, complete sequence 291694-291715 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 459486-459507 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NC_014838 Pantoea sp. At-9b plasmid pPAT9B01, complete sequence 700896-700917 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 1113543-1113564 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 518722-518743 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 618050-618071 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 386538-386559 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 686715-686736 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 679372-679393 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 143494-143515 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 171846-171867 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 686745-686766 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 895019-895040 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 522538-522559 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 1518640-1518661 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 758069-758090 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 519985-520006 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 528837-528858 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 531456-531477 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 515917-515938 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 416618-416639 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP028810 Burkholderia contaminans strain SK875 plasmid p875, complete sequence 9337-9358 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 459486-459507 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 466725-466746 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 466715-466736 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 515010-515031 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 533737-533758 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 386338-386359 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 459498-459519 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 459518-459539 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 459485-459506 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 521441-521462 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 515640-515661 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 520002-520023 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 533737-533758 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 542667-542688 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 525143-525164 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 533735-533756 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 386334-386355 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 618080-618101 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 513041-513062 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 542667-542688 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 525143-525164 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 705888-705909 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 533737-533758 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 542667-542688 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 672606-672627 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 573965-573986 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 513045-513066 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 542671-542692 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 525143-525164 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 525143-525164 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 525143-525164 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 533737-533758 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 533737-533758 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 513045-513066 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 531439-531460 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 573965-573986 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 531392-531413 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 565822-565843 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 523216-523237 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 523654-523675 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 533737-533758 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 513045-513066 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 542667-542688 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 612978-612999 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 533734-533755 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 513045-513066 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 513045-513066 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 533737-533758 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 525145-525166 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 533737-533758 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 533737-533758 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 573956-573977 2 0.909
NZ_CP017146_4 4.2|754715|22|NZ_CP017146|CRISPRCasFinder 754715-754736 22 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 425985-426006 3 0.864
NZ_CP017146_7 7.1|866103|32|NZ_CP017146|CRISPRCasFinder 866103-866134 32 MN855865 Myoviridae sp. isolate 346, complete genome 3251-3282 6 0.812
NZ_CP017146_12 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder 1856607-1856636 30 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 14906-14935 6 0.8
NZ_CP017146_12 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder 1856607-1856636 30 NZ_CP017759 Cupriavidus necator strain NH9 plasmid pENH92, complete sequence 293072-293101 6 0.8
NZ_CP017146_12 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder 1856607-1856636 30 NZ_CP020716 Cnuibacter physcomitrellae strain XA(T) plasmid unnamed1, complete sequence 26564-26593 6 0.8
NZ_CP017146_8 8.1|986696|29|NZ_CP017146|CRISPRCasFinder 986696-986724 29 NZ_CP046256 Sphingobium sp. CAP-1 plasmid p3, complete sequence 64159-64187 7 0.759
NZ_CP017146_8 8.1|986696|29|NZ_CP017146|CRISPRCasFinder 986696-986724 29 NZ_CP022748 Sphingobium hydrophobicum strain C1 plasmid p2, complete sequence 179402-179430 7 0.759
NZ_CP017146_12 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder 1856607-1856636 30 NZ_CP015867 Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence 162795-162824 7 0.767
NZ_CP017146_12 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder 1856607-1856636 30 NZ_CP047053 Clavibacter michiganensis subsp. michiganensis strain MSF322 plasmid pMSF1, complete sequence 13732-13761 7 0.767
NZ_CP017146_12 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder 1856607-1856636 30 NZ_CP010698 Phaeobacter inhibens strain P24 plasmid pP24_b, complete sequence 83077-83106 7 0.767
NZ_CP017146_12 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder 1856607-1856636 30 MK460245 Streptomyces phage BartholomewSD, complete genome 22990-23019 7 0.767
NZ_CP017146_12 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder 1856607-1856636 30 MN234208 Streptomyces phage Alvy, complete genome 22990-23019 7 0.767
NZ_CP017146_7 7.1|866103|32|NZ_CP017146|CRISPRCasFinder 866103-866134 32 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 74458-74489 8 0.75
NZ_CP017146_7 7.1|866103|32|NZ_CP017146|CRISPRCasFinder 866103-866134 32 NZ_LT703507 Mycobacterium chimaera strain Mycobacterium chimaera MC045 isolate Mycobacterium chimaera plasmid 3 91769-91800 8 0.75
NZ_CP017146_7 7.1|866103|32|NZ_CP017146|CRISPRCasFinder 866103-866134 32 NZ_LT703509 Mycobacterium chimaera strain Mycobacterium chimaera MC045 isolate Mycobacterium chimaera plasmid 5 19200-19231 8 0.75
NZ_CP017146_7 7.1|866103|32|NZ_CP017146|CRISPRCasFinder 866103-866134 32 NZ_CP015273 Mycobacterium chimaera strain ZUERICH-1 plasmid unnamed 1, complete sequence 90622-90653 8 0.75
NZ_CP017146_7 7.1|866103|32|NZ_CP017146|CRISPRCasFinder 866103-866134 32 NZ_CP015274 Mycobacterium chimaera strain ZUERICH-1 plasmid unnamed 2, complete sequence 35349-35380 8 0.75
NZ_CP017146_7 7.1|866103|32|NZ_CP017146|CRISPRCasFinder 866103-866134 32 NZ_CP019223 Mycobacterium chimaera strain CDC 2015-22-71 plasmid pDHQP20152271_2, complete sequence 270-301 8 0.75
NZ_CP017146_7 7.1|866103|32|NZ_CP017146|CRISPRCasFinder 866103-866134 32 NZ_CP019224 Mycobacterium chimaera strain CDC 2015-22-71 plasmid pDHQP20152271_1, complete sequence 71138-71169 8 0.75
NZ_CP017146_7 7.1|866103|32|NZ_CP017146|CRISPRCasFinder 866103-866134 32 NZ_CP045964 Mycobacterium chimaera strain AUSMDU00007395 plasmid pAUSMDU00007395_01, complete sequence 81865-81896 8 0.75
NZ_CP017146_7 7.1|866103|32|NZ_CP017146|CRISPRCasFinder 866103-866134 32 NZ_CP045965 Mycobacterium chimaera strain AUSMDU00007395 plasmid pAUSMDU00007395_02, complete sequence 26610-26641 8 0.75
NZ_CP017146_10 10.2|1209443|32|NZ_CP017146|CRISPRCasFinder 1209443-1209474 32 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 81192-81223 8 0.75
NZ_CP017146_10 10.2|1209443|32|NZ_CP017146|CRISPRCasFinder 1209443-1209474 32 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 79347-79378 8 0.75
NZ_CP017146_10 10.2|1209443|32|NZ_CP017146|CRISPRCasFinder 1209443-1209474 32 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 108883-108914 8 0.75
NZ_CP017146_10 10.2|1209443|32|NZ_CP017146|CRISPRCasFinder 1209443-1209474 32 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 81226-81257 8 0.75
NZ_CP017146_10 10.2|1209443|32|NZ_CP017146|CRISPRCasFinder 1209443-1209474 32 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 108883-108914 8 0.75
NZ_CP017146_10 10.2|1209443|32|NZ_CP017146|CRISPRCasFinder 1209443-1209474 32 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 81913-81944 8 0.75
NZ_CP017146_10 10.2|1209443|32|NZ_CP017146|CRISPRCasFinder 1209443-1209474 32 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 81913-81944 8 0.75
NZ_CP017146_10 10.2|1209443|32|NZ_CP017146|CRISPRCasFinder 1209443-1209474 32 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 108893-108924 8 0.75
NZ_CP017146_10 10.2|1209443|32|NZ_CP017146|CRISPRCasFinder 1209443-1209474 32 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 108912-108943 8 0.75
NZ_CP017146_10 10.2|1209443|32|NZ_CP017146|CRISPRCasFinder 1209443-1209474 32 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 108883-108914 8 0.75
NZ_CP017146_10 10.2|1209443|32|NZ_CP017146|CRISPRCasFinder 1209443-1209474 32 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 81204-81235 8 0.75
NZ_CP017146_10 10.2|1209443|32|NZ_CP017146|CRISPRCasFinder 1209443-1209474 32 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 81204-81235 8 0.75
NZ_CP017146_10 10.2|1209443|32|NZ_CP017146|CRISPRCasFinder 1209443-1209474 32 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 81202-81233 8 0.75
NZ_CP017146_12 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder 1856607-1856636 30 NZ_LR134459 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence 146625-146654 8 0.733
NZ_CP017146_12 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder 1856607-1856636 30 NZ_CP015738 Shinella sp. HZN7 plasmid pShin-02, complete sequence 404224-404253 8 0.733
NZ_CP017146_12 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder 1856607-1856636 30 NZ_CP034351 Streptomyces sp. W1SF4 plasmid p1, complete sequence 425295-425324 8 0.733
NZ_CP017146_12 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder 1856607-1856636 30 NZ_CP019037 Massilia putida strain 6NM-7 plasmid unnamed2, complete sequence 226610-226639 8 0.733
NZ_CP017146_12 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder 1856607-1856636 30 NC_019849 Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence 532008-532037 9 0.7
NZ_CP017146_12 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder 1856607-1856636 30 NC_017326 Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence 520783-520812 9 0.7
NZ_CP017146_12 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder 1856607-1856636 30 NC_017323 Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence 114633-114662 9 0.7
NZ_CP017146_12 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder 1856607-1856636 30 NZ_CP009146 Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence 525684-525713 9 0.7
NZ_CP017146_12 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder 1856607-1856636 30 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 518427-518456 9 0.7
NZ_CP017146_12 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder 1856607-1856636 30 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 1185332-1185361 9 0.7
NZ_CP017146_12 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder 1856607-1856636 30 NZ_CP021820 Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence 874116-874145 9 0.7
NZ_CP017146_12 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder 1856607-1856636 30 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 778782-778811 9 0.7
NZ_CP017146_12 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder 1856607-1856636 30 NZ_CP021814 Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence 404465-404494 9 0.7
NZ_CP017146_12 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder 1856607-1856636 30 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 1307220-1307249 9 0.7
NZ_CP017146_12 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder 1856607-1856636 30 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 671385-671414 9 0.7
NZ_CP017146_12 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder 1856607-1856636 30 NZ_CP026527 Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence 542221-542250 9 0.7
NZ_CP017146_12 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder 1856607-1856636 30 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 1201204-1201233 9 0.7
NZ_CP017146_12 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder 1856607-1856636 30 NZ_CP019586 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence 1171697-1171726 9 0.7
NZ_CP017146_12 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder 1856607-1856636 30 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 1267427-1267456 9 0.7
NZ_CP017146_12 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder 1856607-1856636 30 NZ_CP021828 Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence 774142-774171 9 0.7
NZ_CP017146_12 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder 1856607-1856636 30 NZ_CP021823 Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence 889895-889924 9 0.7
NZ_CP017146_12 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder 1856607-1856636 30 NZ_CP021795 Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence 411511-411540 9 0.7
NZ_CP017146_12 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder 1856607-1856636 30 NZ_CP021806 Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence 489232-489261 9 0.7
NZ_CP017146_12 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder 1856607-1856636 30 NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 1341944-1341973 9 0.7
NZ_CP017146_12 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder 1856607-1856636 30 NZ_CP019487 Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence 1114244-1114273 9 0.7
NZ_CP017146_12 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder 1856607-1856636 30 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 1201210-1201239 9 0.7
NZ_CP017146_12 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder 1856607-1856636 30 NZ_LR723678 Arsenite-oxidising bacterium NT-25 plasmid 2 165934-165963 9 0.7
NZ_CP017146_12 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder 1856607-1856636 30 NZ_CP029357 Azospirillum sp. CFH 70021 plasmid unnamed2 637504-637533 9 0.7
NZ_CP017146_12 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder 1856607-1856636 30 NZ_FO082821 Rhizobium sp. NT-26 plasmid NT26_p1, complete sequence 247155-247184 9 0.7
NZ_CP017146_12 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder 1856607-1856636 30 MN850628 Escherichia phage bob, complete genome 16719-16748 9 0.7
NZ_CP017146_12 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder 1856607-1856636 30 MN850629 Escherichia phage mckay, complete genome 21477-21506 9 0.7
NZ_CP017146_12 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder 1856607-1856636 30 NZ_CP032676 Rhodococcus rhodochrous strain ATCC BAA870 plasmid pNit, complete sequence 298072-298101 9 0.7
NZ_CP017146_12 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder 1856607-1856636 30 NC_004808 Streptomyces rochei plasmid pSLA2-L DNA, complete sequence 110030-110059 9 0.7
NZ_CP017146_12 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder 1856607-1856636 30 NC_012223 Enterobacteria phage SSL2009a, complete genome 14946-14975 9 0.7
NZ_CP017146_12 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder 1856607-1856636 30 FJ750948 Enterobacteria phage SSL-2009a, complete genome 14946-14975 9 0.7
NZ_CP017146_7 7.1|866103|32|NZ_CP017146|CRISPRCasFinder 866103-866134 32 NZ_CP014169 Sphingomonas panacis strain DCY99 plasmid unnamed, complete sequence 198997-199028 10 0.688

1. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP011665 (Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgccggtgctgccggtgctgc	Protospacer
**********************

2. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP024248 (Escherichia coli O27:H7 strain B4103-1 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgccggtgctgccggtgctgc	Protospacer
**********************

3. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP011665 (Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence) position: , mismatch: 1, identity: 0.955

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgccggtgctgccggtactgc	Protospacer
*****************.****

4. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NC_047783 (Klebsiella phage vB_KpnP_KpV48, complete genome) position: , mismatch: 1, identity: 0.955

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgccggtgctgctggtgctgc	Protospacer
*************.********

5. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to MN694571 (Marine virus AFVG_250M1012, complete genome) position: , mismatch: 1, identity: 0.955

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgccggtgctgcccgtgctgc	Protospacer
************** *******

6. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to MN694571 (Marine virus AFVG_250M1012, complete genome) position: , mismatch: 1, identity: 0.955

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgcccgtgctgccggtgctgc	Protospacer
***** ****************

7. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NC_049478 (Arthrobacter phage Mufasa8, complete genome) position: , mismatch: 1, identity: 0.955

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgccggtgctgccggtgcggc	Protospacer
******************* **

8. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NC_025025 (Mycobacterium tuberculosis H37Rv plasmid pTYGi9, complete sequence) position: , mismatch: 1, identity: 0.955

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgccggtgccgccggtgctgc	Protospacer
**********.***********

9. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.955

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgccggtgccgccggtgctgc	Protospacer
**********.***********

10. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NC_010879 (Burkholderia glumae strain BGR1 plasmid pBGF2, complete sequence) position: , mismatch: 1, identity: 0.955

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgccggtgctggcggtgctgc	Protospacer
************ *********

11. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to KR063279 (Gordonia phage GMA3, complete genome) position: , mismatch: 1, identity: 0.955

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgccggtgcttccggtgctgc	Protospacer
*********** **********

12. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to MG592428 (Vibrio phage 1.046.O._10N.286.52.E3, partial genome) position: , mismatch: 1, identity: 0.955

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgccggtgctgcgggtgctgc	Protospacer
************* ********

13. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NC_031109 (Gordonia phage Jumbo, complete genome) position: , mismatch: 1, identity: 0.955

ctgccggtgctgccggtgctgc	CRISPR spacer
ccgccggtgctgccggtgctgc	Protospacer
*.********************

14. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP027299 (Streptomyces sp. SGAir0924 plasmid unnamed_5) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
gggccggtgctgccggtgctgc	Protospacer
  ********************

15. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to MG592428 (Vibrio phage 1.046.O._10N.286.52.E3, partial genome) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
cgcccggtgctgccggtgctgc	Protospacer
*  *******************

16. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to MG592428 (Vibrio phage 1.046.O._10N.286.52.E3, partial genome) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
cgcccggtgctgccggtgctgc	Protospacer
*  *******************

17. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NC_031109 (Gordonia phage Jumbo, complete genome) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ttgccggtgccgccggtgctgc	Protospacer
.*********.***********

18. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

19. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
gtgccggtgcagccggtgctgc	Protospacer
 ********* ***********

20. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

21. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

22. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

23. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

24. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP025613 (Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ttgccggtgctgctggtgctgc	Protospacer
.************.********

25. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_AP022571 (Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
gtgccggtgctgccggtgttgc	Protospacer
 *****************.***

26. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

27. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

28. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

29. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

30. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP028965 (Burkholderia sp. IDO3 plasmid p1, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

31. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NC_010802 (Burkholderia multivorans ATCC 17616 plasmid pTGL1, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

32. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP042167 (Burkholderia contaminans strain ZCC plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

33. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

34. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
gtgccggtgctgacggtgctgc	Protospacer
 *********** *********

35. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

36. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

37. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

38. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

39. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to KX856662 (Klebsiella phage KP-Rio/2015, complete genome) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
caaccggtgctgccggtgctgc	Protospacer
* .*******************

40. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to KP708985 (Klebsiella phage vB_KpnP_SU503, complete genome) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
caaccggtgctgccggtgctgc	Protospacer
* .*******************

41. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NC_028664 (Klebsiella phage vB_Kp2, complete genome) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
caaccggtgctgccggtgctgc	Protospacer
* .*******************

42. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to MT701589 (Klebsiella phage Pone, complete genome) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
caaccggtgctgccggtgctgc	Protospacer
* .*******************

43. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to MT682065 (Klebsiella virus KpV2883, complete genome) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
caaccggtgctgccggtgctgc	Protospacer
* .*******************

44. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to MT360680 (Klebsiella virus 2019KP1, complete genome) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
caaccggtgctgccggtgctgc	Protospacer
* .*******************

45. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to MN380459 (Klebsiella phage vB_KpnP_fHeKpn01, complete genome) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
caaccggtgctgccggtgctgc	Protospacer
* .*******************

46. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to KX211991 (Klebsiella phage vB_KpnP_KpV475, complete genome) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
caaccggtgctgccggtgctgc	Protospacer
* .*******************

47. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to GQ413938 (Klebsiella phage KP34, complete genome) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
caaccggtgctgccggtgctgc	Protospacer
* .*******************

48. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NC_010070 (Burkholderia multivorans ATCC 17616 plasmid pBMUL01, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

49. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

50. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP010024 (Paraburkholderia fungorum strain ATCC BAA-463 plasmid pBIL, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgccggtgctgccggagctga	Protospacer
**************** **** 

51. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

52. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

53. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

54. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

55. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

56. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NC_012528 (Deinococcus deserti VCD115 plasmid 3, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgacggtgctgccggtgctga	Protospacer
*** ***************** 

57. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

58. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NC_014838 (Pantoea sp. At-9b plasmid pPAT9B01, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

59. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

60. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

61. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

62. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

63. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

64. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

65. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
gtgccggtggtgccggtgctgc	Protospacer
 ******** ************

66. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

67. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

68. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

69. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

70. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

71. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

72. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

73. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

74. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

75. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

76. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

77. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP028810 (Burkholderia contaminans strain SK875 plasmid p875, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

78. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

79. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

80. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

81. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

82. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

83. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

84. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

85. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

86. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

87. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

88. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

89. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

90. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

91. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

92. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

93. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

94. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

95. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

96. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

97. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

98. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

99. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

100. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

101. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

102. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

103. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

104. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

105. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

106. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

107. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

108. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

109. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

110. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

111. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

112. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

113. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

114. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

115. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

116. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

117. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

118. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

119. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

120. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

121. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

122. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

123. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

124. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

125. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

126. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

127. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

128. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

129. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

ctgccggtgctgccggtgctgc	CRISPR spacer
ctgctggtgctgccggtgctgt	Protospacer
****.****************.

130. spacer 4.2|754715|22|NZ_CP017146|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 3, identity: 0.864

ctgccggtgctgccggtgctgc	CRISPR spacer
gcgccggtgctgccggtgctgg	Protospacer
 .******************* 

131. spacer 7.1|866103|32|NZ_CP017146|CRISPRCasFinder matches to MN855865 (Myoviridae sp. isolate 346, complete genome) position: , mismatch: 6, identity: 0.812

gcgccagcggtcgctgaccgtcgacg-agcact	CRISPR spacer
gcgccggcggtcgctggccgtcgatactgcac-	Protospacer
*****.**********.*******..  **** 

132. spacer 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 6, identity: 0.8

tggccgcgaggtcgggatggtcggcgtagc	CRISPR spacer
aagccgcgagctcgggatgctcggcggcgc	Protospacer
 .******** ******** ******  **

133. spacer 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder matches to NZ_CP017759 (Cupriavidus necator strain NH9 plasmid pENH92, complete sequence) position: , mismatch: 6, identity: 0.8

tggccgcgaggtcgggatggtcggcgtagc	CRISPR spacer
tgtccgcgagggcgggatggtcggtttgga	Protospacer
** ******** ************. *.* 

134. spacer 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder matches to NZ_CP020716 (Cnuibacter physcomitrellae strain XA(T) plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

tggcc--gcgaggtcgggatggtcggcgtagc	CRISPR spacer
--accaggcagggtcgggctggtcggcgtagc	Protospacer
  .**  **..******* *************

135. spacer 8.1|986696|29|NZ_CP017146|CRISPRCasFinder matches to NZ_CP046256 (Sphingobium sp. CAP-1 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.759

gagtaacgcgcttgcgcgggctgcggatg	CRISPR spacer
gcgggcgccgcttgcgcggtctgcggatg	Protospacer
* * .   *********** *********

136. spacer 8.1|986696|29|NZ_CP017146|CRISPRCasFinder matches to NZ_CP022748 (Sphingobium hydrophobicum strain C1 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.759

gagtaacgcgcttgcgcgggctgcggatg	CRISPR spacer
gcgggcgccgcttgcgcggtctgcggatg	Protospacer
* * .   *********** *********

137. spacer 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 7, identity: 0.767

tggccgcgaggtcgggatggtcggcgtagc-	CRISPR spacer
gcgccgcgaggtcggggtggtc-gtacagcg	Protospacer
  **************.***** *...*** 

138. spacer 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder matches to NZ_CP047053 (Clavibacter michiganensis subsp. michiganensis strain MSF322 plasmid pMSF1, complete sequence) position: , mismatch: 7, identity: 0.767

tggccgcgaggtcgggatggtcggcgtagc	CRISPR spacer
gggccgcaaggtcgcgatggtcggtgacgg	Protospacer
 ******.****** *********.*  * 

139. spacer 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder matches to NZ_CP010698 (Phaeobacter inhibens strain P24 plasmid pP24_b, complete sequence) position: , mismatch: 7, identity: 0.767

tggccgcgaggtcgggatggtcggcgtagc	CRISPR spacer
tgacatcgaggtcggcatggtcggcgtcaa	Protospacer
**.*  ********* *********** . 

140. spacer 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder matches to MK460245 (Streptomyces phage BartholomewSD, complete genome) position: , mismatch: 7, identity: 0.767

tggccgcgaggtcgggatggtcggcgtagc	CRISPR spacer
cggccgcgacctcgggatggtcggtgccga	Protospacer
.********  *************.*. * 

141. spacer 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder matches to MN234208 (Streptomyces phage Alvy, complete genome) position: , mismatch: 7, identity: 0.767

tggccgcgaggtcgggatggtcggcgtagc	CRISPR spacer
cggccgcgacctcgggatggtcggtgccga	Protospacer
.********  *************.*. * 

142. spacer 7.1|866103|32|NZ_CP017146|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 8, identity: 0.75

gcgccagcggtcgctgaccgtcgacgagcact	CRISPR spacer
ccgccagcggacgctgaccgtctacctggtcg	Protospacer
 ********* *********** **  *  * 

143. spacer 7.1|866103|32|NZ_CP017146|CRISPRCasFinder matches to NZ_LT703507 (Mycobacterium chimaera strain Mycobacterium chimaera MC045 isolate Mycobacterium chimaera plasmid 3) position: , mismatch: 8, identity: 0.75

gcgccagcggtcgctgaccgtcgacgagcact	CRISPR spacer
gcagcagcggtcgctgcccgtcgccgatggcg	Protospacer
**. ************ ****** ***  .* 

144. spacer 7.1|866103|32|NZ_CP017146|CRISPRCasFinder matches to NZ_LT703509 (Mycobacterium chimaera strain Mycobacterium chimaera MC045 isolate Mycobacterium chimaera plasmid 5) position: , mismatch: 8, identity: 0.75

gcgccagcggtcgctgaccgtcgacgagcact	CRISPR spacer
gcagcagcggtcgctgcccgtcgccgatggcg	Protospacer
**. ************ ****** ***  .* 

145. spacer 7.1|866103|32|NZ_CP017146|CRISPRCasFinder matches to NZ_CP015273 (Mycobacterium chimaera strain ZUERICH-1 plasmid unnamed 1, complete sequence) position: , mismatch: 8, identity: 0.75

gcgccagcggtcgctgaccgtcgacgagcact	CRISPR spacer
gcagcagcggtcgctgcccgtcgccgatggcg	Protospacer
**. ************ ****** ***  .* 

146. spacer 7.1|866103|32|NZ_CP017146|CRISPRCasFinder matches to NZ_CP015274 (Mycobacterium chimaera strain ZUERICH-1 plasmid unnamed 2, complete sequence) position: , mismatch: 8, identity: 0.75

gcgccagcggtcgctgaccgtcgacgagcact	CRISPR spacer
gcagcagcggtcgctgcccgtcgccgatggcg	Protospacer
**. ************ ****** ***  .* 

147. spacer 7.1|866103|32|NZ_CP017146|CRISPRCasFinder matches to NZ_CP019223 (Mycobacterium chimaera strain CDC 2015-22-71 plasmid pDHQP20152271_2, complete sequence) position: , mismatch: 8, identity: 0.75

gcgccagcggtcgctgaccgtcgacgagcact	CRISPR spacer
gcagcagcggtcgctgcccgtcgccgatggcg	Protospacer
**. ************ ****** ***  .* 

148. spacer 7.1|866103|32|NZ_CP017146|CRISPRCasFinder matches to NZ_CP019224 (Mycobacterium chimaera strain CDC 2015-22-71 plasmid pDHQP20152271_1, complete sequence) position: , mismatch: 8, identity: 0.75

gcgccagcggtcgctgaccgtcgacgagcact	CRISPR spacer
gcagcagcggtcgctgcccgtcgccgatggcg	Protospacer
**. ************ ****** ***  .* 

149. spacer 7.1|866103|32|NZ_CP017146|CRISPRCasFinder matches to NZ_CP045964 (Mycobacterium chimaera strain AUSMDU00007395 plasmid pAUSMDU00007395_01, complete sequence) position: , mismatch: 8, identity: 0.75

gcgccagcggtcgctgaccgtcgacgagcact	CRISPR spacer
gcagcagcggtcgctgcccgtcgccgatggcg	Protospacer
**. ************ ****** ***  .* 

150. spacer 7.1|866103|32|NZ_CP017146|CRISPRCasFinder matches to NZ_CP045965 (Mycobacterium chimaera strain AUSMDU00007395 plasmid pAUSMDU00007395_02, complete sequence) position: , mismatch: 8, identity: 0.75

gcgccagcggtcgctgaccgtcgacgagcact	CRISPR spacer
gcagcagcggtcgctgcccgtcgccgatggcg	Protospacer
**. ************ ****** ***  .* 

151. spacer 10.2|1209443|32|NZ_CP017146|CRISPRCasFinder matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

atagcgcgttgtgcccgcgatagcgcgttgtg	CRISPR spacer
agcgcgcgttgtgcctgcgacagcgcggccgg	Protospacer
*  ************.****.****** .  *

152. spacer 10.2|1209443|32|NZ_CP017146|CRISPRCasFinder matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 8, identity: 0.75

atagcgcgttgtgcccgcgatagcgcgttgtg	CRISPR spacer
agcgcgcgttgtgcctgcgacagcgcggccgg	Protospacer
*  ************.****.****** .  *

153. spacer 10.2|1209443|32|NZ_CP017146|CRISPRCasFinder matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

atagcgcgttgtgcccgcgatagcgcgttgtg	CRISPR spacer
agcgcgcgttgtgcctgcgacagcgcggccgg	Protospacer
*  ************.****.****** .  *

154. spacer 10.2|1209443|32|NZ_CP017146|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

atagcgcgttgtgcccgcgatagcgcgttgtg	CRISPR spacer
agcgcgcgttgtgcctgcgacagcgcggccgg	Protospacer
*  ************.****.****** .  *

155. spacer 10.2|1209443|32|NZ_CP017146|CRISPRCasFinder matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 8, identity: 0.75

atagcgcgttgtgcccgcgatagcgcgttgtg	CRISPR spacer
agcgcgcgttgtgcctgcgacagcgcggccgg	Protospacer
*  ************.****.****** .  *

156. spacer 10.2|1209443|32|NZ_CP017146|CRISPRCasFinder matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

atagcgcgttgtgcccgcgatagcgcgttgtg	CRISPR spacer
agcgcgcgttgtgcctgcgacagcgcggccgg	Protospacer
*  ************.****.****** .  *

157. spacer 10.2|1209443|32|NZ_CP017146|CRISPRCasFinder matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

atagcgcgttgtgcccgcgatagcgcgttgtg	CRISPR spacer
agcgcgcgttgtgcctgcgacagcgcggccgg	Protospacer
*  ************.****.****** .  *

158. spacer 10.2|1209443|32|NZ_CP017146|CRISPRCasFinder matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

atagcgcgttgtgcccgcgatagcgcgttgtg	CRISPR spacer
agcgcgcgttgtgcctgcgacagcgcggccgg	Protospacer
*  ************.****.****** .  *

159. spacer 10.2|1209443|32|NZ_CP017146|CRISPRCasFinder matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

atagcgcgttgtgcccgcgatagcgcgttgtg	CRISPR spacer
agcgcgcgttgtgcctgcgacagcgcggccgg	Protospacer
*  ************.****.****** .  *

160. spacer 10.2|1209443|32|NZ_CP017146|CRISPRCasFinder matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

atagcgcgttgtgcccgcgatagcgcgttgtg	CRISPR spacer
agcgcgcgttgtgcctgcgacagcgcggccgg	Protospacer
*  ************.****.****** .  *

161. spacer 10.2|1209443|32|NZ_CP017146|CRISPRCasFinder matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

atagcgcgttgtgcccgcgatagcgcgttgtg	CRISPR spacer
agcgcgcgttgtgcctgcgacagcgcggccgg	Protospacer
*  ************.****.****** .  *

162. spacer 10.2|1209443|32|NZ_CP017146|CRISPRCasFinder matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

atagcgcgttgtgcccgcgatagcgcgttgtg	CRISPR spacer
agcgcgcgttgtgcctgcgacagcgcggccgg	Protospacer
*  ************.****.****** .  *

163. spacer 10.2|1209443|32|NZ_CP017146|CRISPRCasFinder matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

atagcgcgttgtgcccgcgatagcgcgttgtg	CRISPR spacer
agcgcgcgttgtgcctgcgacagcgcggccgg	Protospacer
*  ************.****.****** .  *

164. spacer 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder matches to NZ_LR134459 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence) position: , mismatch: 8, identity: 0.733

tggccgcgaggtcgggatggtcggcgtagc	CRISPR spacer
ccgcgtcgaggtcggcatggtcggcgtcaa	Protospacer
. **  ********* *********** . 

165. spacer 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder matches to NZ_CP015738 (Shinella sp. HZN7 plasmid pShin-02, complete sequence) position: , mismatch: 8, identity: 0.733

tggccgcgaggtcgggatggtcggcgtagc	CRISPR spacer
tggccgcgccgtcgggatggtcgagccgga	Protospacer
********  *************.  ..* 

166. spacer 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder matches to NZ_CP034351 (Streptomyces sp. W1SF4 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.733

tggccgcgaggtcgggatggtcggcgtagc	CRISPR spacer
tgcccgcgaggccgggatggtcgaggagct	Protospacer
** ********.***********. * . .

167. spacer 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder matches to NZ_CP019037 (Massilia putida strain 6NM-7 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.733

tggccgcgaggtcgggatggtcggcgtagc	CRISPR spacer
agcccgcgaggtcggcatagtcggcggtcg	Protospacer
 * ************ **.*******    

168. spacer 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 9, identity: 0.7

tggccgcgaggtcgggatggtcggcgtagc	CRISPR spacer
cccaggcgaggtcgggatgggcggcgtcct	Protospacer
.    *************** ******  .

169. spacer 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 9, identity: 0.7

tggccgcgaggtcgggatggtcggcgtagc	CRISPR spacer
cccaggcgaggtcgggatgggcggcgtcct	Protospacer
.    *************** ******  .

170. spacer 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 9, identity: 0.7

tggccgcgaggtcgggatggtcggcgtagc	CRISPR spacer
cccaggcgaggtcgggatgggcggcgtcct	Protospacer
.    *************** ******  .

171. spacer 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.7

tggccgcgaggtcgggatggtcggcgtagc	CRISPR spacer
cccaggcgaggtcgggatgggcggcgtcct	Protospacer
.    *************** ******  .

172. spacer 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 9, identity: 0.7

tggccgcgaggtcgggatggtcggcgtagc	CRISPR spacer
cccaggcgaggtcgggatgggcggcgtcct	Protospacer
.    *************** ******  .

173. spacer 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.7

tggccgcgaggtcgggatggtcggcgtagc	CRISPR spacer
cccaggcgaggtcgggatgggcggcgtcct	Protospacer
.    *************** ******  .

174. spacer 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.7

tggccgcgaggtcgggatggtcggcgtagc	CRISPR spacer
cccaggcgaggtcgggatgggcggcgtcct	Protospacer
.    *************** ******  .

175. spacer 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.7

tggccgcgaggtcgggatggtcggcgtagc	CRISPR spacer
cccaggcgaggtcgggatgggcggcgtcct	Protospacer
.    *************** ******  .

176. spacer 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.7

tggccgcgaggtcgggatggtcggcgtagc	CRISPR spacer
cccaggcgaggtcgggatgggcggcgtcct	Protospacer
.    *************** ******  .

177. spacer 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.7

tggccgcgaggtcgggatggtcggcgtagc	CRISPR spacer
cccaggcgaggtcgggatgggcggcgtcct	Protospacer
.    *************** ******  .

178. spacer 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.7

tggccgcgaggtcgggatggtcggcgtagc	CRISPR spacer
cccaggcgaggtcgggatgggcggcgtcct	Protospacer
.    *************** ******  .

179. spacer 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.7

tggccgcgaggtcgggatggtcggcgtagc	CRISPR spacer
cccaggcgaggtcgggatgggcggcgtcct	Protospacer
.    *************** ******  .

180. spacer 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.7

tggccgcgaggtcgggatggtcggcgtagc	CRISPR spacer
cccaggcgaggtcgggatgggcggcgtcct	Protospacer
.    *************** ******  .

181. spacer 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.7

tggccgcgaggtcgggatggtcggcgtagc	CRISPR spacer
cccaggcgaggtcgggatgggcggcgtcct	Protospacer
.    *************** ******  .

182. spacer 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.7

tggccgcgaggtcgggatggtcggcgtagc	CRISPR spacer
cccaggcgaggtcgggatgggcggcgtcct	Protospacer
.    *************** ******  .

183. spacer 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.7

tggccgcgaggtcgggatggtcggcgtagc	CRISPR spacer
cccaggcgaggtcgggatgggcggcgtcct	Protospacer
.    *************** ******  .

184. spacer 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.7

tggccgcgaggtcgggatggtcggcgtagc	CRISPR spacer
cccaggcgaggtcgggatgggcggcgtcct	Protospacer
.    *************** ******  .

185. spacer 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.7

tggccgcgaggtcgggatggtcggcgtagc	CRISPR spacer
cccaggcgaggtcgggatgggcggcgtcct	Protospacer
.    *************** ******  .

186. spacer 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.7

tggccgcgaggtcgggatggtcggcgtagc	CRISPR spacer
cccaggcgaggtcgggatgggcggcgtcct	Protospacer
.    *************** ******  .

187. spacer 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.7

tggccgcgaggtcgggatggtcggcgtagc	CRISPR spacer
cccaggcgaggtcgggatgggcggcgtcct	Protospacer
.    *************** ******  .

188. spacer 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 9, identity: 0.7

tggccgcgaggtcgggatggtcggcgtagc	CRISPR spacer
cccaggcgaggtcgggatgggcggcgtcct	Protospacer
.    *************** ******  .

189. spacer 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.7

tggccgcgaggtcgggatggtcggcgtagc	CRISPR spacer
cccaggcgaggtcgggatgggcggcgtcct	Protospacer
.    *************** ******  .

190. spacer 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder matches to NZ_LR723678 (Arsenite-oxidising bacterium NT-25 plasmid 2) position: , mismatch: 9, identity: 0.7

tggccgcgaggtcgggatggtcggcgtagc	CRISPR spacer
gaagctcgaggccgggatggtcggcgtcaa	Protospacer
 .. * *****.*************** . 

191. spacer 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 9, identity: 0.7

tggccgcgaggtcgggatggtcggcgtagc	CRISPR spacer
ggagatcgaggtcggcatggtcggcgtcaa	Protospacer
 *.   ********* *********** . 

192. spacer 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder matches to NZ_FO082821 (Rhizobium sp. NT-26 plasmid NT26_p1, complete sequence) position: , mismatch: 9, identity: 0.7

tggccgcgaggtcgggatggtcggcgtagc	CRISPR spacer
gaagctcgaggccgggatggtcggcgtcaa	Protospacer
 .. * *****.*************** . 

193. spacer 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder matches to MN850628 (Escherichia phage bob, complete genome) position: , mismatch: 9, identity: 0.7

tggccgcgaggtcgggatggtcggcgtagc	CRISPR spacer
cttgagcgaggtcgggaaggtccgcgtatt	Protospacer
.    ************ **** ***** .

194. spacer 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder matches to MN850629 (Escherichia phage mckay, complete genome) position: , mismatch: 9, identity: 0.7

tggccgcgaggtcgggatggtcggcgtagc	CRISPR spacer
cttgagcgaggtcgggaaggtccgcgtatt	Protospacer
.    ************ **** ***** .

195. spacer 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder matches to NZ_CP032676 (Rhodococcus rhodochrous strain ATCC BAA870 plasmid pNit, complete sequence) position: , mismatch: 9, identity: 0.7

tggccgcgaggtcgggatggtcggcgtagc	CRISPR spacer
cgaagtcgaggtcggtatggtcggcgtcaa	Protospacer
.*.   ********* *********** . 

196. spacer 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder matches to NC_004808 (Streptomyces rochei plasmid pSLA2-L DNA, complete sequence) position: , mismatch: 9, identity: 0.7

tggccgcgaggtcgggatggtcggcgtagc	CRISPR spacer
gcagcgcgaggtcggggtgctcggcgttct	Protospacer
  . ************.** *******  .

197. spacer 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder matches to NC_012223 (Enterobacteria phage SSL2009a, complete genome) position: , mismatch: 9, identity: 0.7

tggccgcgaggtcgggatggtcggcgtagc	CRISPR spacer
cttgagcgaggtcgggaaggtccgcgtatt	Protospacer
.    ************ **** ***** .

198. spacer 12.1|1856607|30|NZ_CP017146|CRISPRCasFinder matches to FJ750948 (Enterobacteria phage SSL-2009a, complete genome) position: , mismatch: 9, identity: 0.7

tggccgcgaggtcgggatggtcggcgtagc	CRISPR spacer
cttgagcgaggtcgggaaggtccgcgtatt	Protospacer
.    ************ **** ***** .

199. spacer 7.1|866103|32|NZ_CP017146|CRISPRCasFinder matches to NZ_CP014169 (Sphingomonas panacis strain DCY99 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gcgccagcggtcgctgaccgtcgacgagcact	CRISPR spacer
gcgccagcggccgctgagcgtcggccgaattg	Protospacer
**********.****** *****.* ..  . 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 797018 : 804399 7 Listeria_phage(16.67%) tRNA NA
DBSCAN-SWA_2 1857011 : 1932211 58 Bacillus_virus(16.67%) integrase,transposase,protease,tRNA attL 1921613:1921648|attR 1933130:1933165
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage