Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP035109 Acinetobacter pittii strain NQ-003 chromosome, complete genome 1 crisprs csa3,WYL,DEDDh,cas3 0 1 8 0

Results visualization

1. NZ_CP035109
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP035109_1 2852435-2852516 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP035109_1 1.1|2852458|36|NZ_CP035109|CRISPRCasFinder 2852458-2852493 36 NZ_CP012711 Psychrobacter urativorans strain R310.10B plasmid 5, complete sequence 43400-43435 3 0.917
NZ_CP035109_1 1.1|2852458|36|NZ_CP035109|CRISPRCasFinder 2852458-2852493 36 NZ_CP024448 Moraxella osloensis strain NP7 plasmid pNP7-5, complete sequence 20098-20133 4 0.889
NZ_CP035109_1 1.1|2852458|36|NZ_CP035109|CRISPRCasFinder 2852458-2852493 36 NZ_CP024446 Moraxella osloensis strain NP7 plasmid pNP7-3, complete sequence 63667-63702 5 0.861
NZ_CP035109_1 1.1|2852458|36|NZ_CP035109|CRISPRCasFinder 2852458-2852493 36 NZ_CP024445 Moraxella osloensis strain NP7 plasmid pNP7-2, complete sequence 29619-29654 6 0.833
NZ_CP035109_1 1.1|2852458|36|NZ_CP035109|CRISPRCasFinder 2852458-2852493 36 NZ_CP024186 Moraxella osloensis strain TT16 plasmid p1, complete sequence 95169-95204 6 0.833
NZ_CP035109_1 1.1|2852458|36|NZ_CP035109|CRISPRCasFinder 2852458-2852493 36 NZ_CP024186 Moraxella osloensis strain TT16 plasmid p1, complete sequence 29226-29261 6 0.833
NZ_CP035109_1 1.1|2852458|36|NZ_CP035109|CRISPRCasFinder 2852458-2852493 36 NZ_CP024177 Moraxella osloensis strain YHS plasmid pYHS1, complete sequence 95137-95172 6 0.833
NZ_CP035109_1 1.1|2852458|36|NZ_CP035109|CRISPRCasFinder 2852458-2852493 36 NZ_CP024177 Moraxella osloensis strain YHS plasmid pYHS1, complete sequence 29194-29229 6 0.833
NZ_CP035109_1 1.1|2852458|36|NZ_CP035109|CRISPRCasFinder 2852458-2852493 36 NZ_CP024186 Moraxella osloensis strain TT16 plasmid p1, complete sequence 25313-25348 8 0.778
NZ_CP035109_1 1.1|2852458|36|NZ_CP035109|CRISPRCasFinder 2852458-2852493 36 NZ_CP024177 Moraxella osloensis strain YHS plasmid pYHS1, complete sequence 25281-25316 8 0.778
NZ_CP035109_1 1.1|2852458|36|NZ_CP035109|CRISPRCasFinder 2852458-2852493 36 NZ_CP040258 Moraxella osloensis strain MOXF1 plasmid pMOXF1, complete sequence 46821-46856 8 0.778
NZ_CP035109_1 1.1|2852458|36|NZ_CP035109|CRISPRCasFinder 2852458-2852493 36 NZ_CP024446 Moraxella osloensis strain NP7 plasmid pNP7-3, complete sequence 38673-38708 9 0.75
NZ_CP035109_1 1.1|2852458|36|NZ_CP035109|CRISPRCasFinder 2852458-2852493 36 NZ_AP017383 Moraxella osloensis strain KMC41 plasmid pMOSL2, complete sequence 53808-53843 9 0.75
NZ_CP035109_1 1.1|2852458|36|NZ_CP035109|CRISPRCasFinder 2852458-2852493 36 NZ_CP024183 Moraxella osloensis strain KSH plasmid p3, complete sequence 11703-11738 9 0.75

1. spacer 1.1|2852458|36|NZ_CP035109|CRISPRCasFinder matches to NZ_CP012711 (Psychrobacter urativorans strain R310.10B plasmid 5, complete sequence) position: , mismatch: 3, identity: 0.917

acccgagcgcaagacgagagctgtgctcgagtggaa	CRISPR spacer
gcccgagcccaagacgagagctgtgctcgagtggga	Protospacer
.******* *************************.*

2. spacer 1.1|2852458|36|NZ_CP035109|CRISPRCasFinder matches to NZ_CP024448 (Moraxella osloensis strain NP7 plasmid pNP7-5, complete sequence) position: , mismatch: 4, identity: 0.889

acccgagcgcaagacgagagctgtgctcg-agtggaa	CRISPR spacer
gcccgagcgcaaggcgagagctatgctcgtagtgga-	Protospacer
.************.********.****** ****** 

3. spacer 1.1|2852458|36|NZ_CP035109|CRISPRCasFinder matches to NZ_CP024446 (Moraxella osloensis strain NP7 plasmid pNP7-3, complete sequence) position: , mismatch: 5, identity: 0.861

acccgagcgcaagacgagagctgtgctcgagtggaa	CRISPR spacer
gcccgagcgcaaggcgagagctatgctcgagtgggc	Protospacer
.************.********.***********. 

4. spacer 1.1|2852458|36|NZ_CP035109|CRISPRCasFinder matches to NZ_CP024445 (Moraxella osloensis strain NP7 plasmid pNP7-2, complete sequence) position: , mismatch: 6, identity: 0.833

acccgagcgcaagacgagagctgtgctcgagtggaa	CRISPR spacer
gcccgagtgcaaggcgagagctgtgctcgagtgatt	Protospacer
.******.*****.*******************.  

5. spacer 1.1|2852458|36|NZ_CP035109|CRISPRCasFinder matches to NZ_CP024186 (Moraxella osloensis strain TT16 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.833

acccgagcgcaagacgagagctgtgctcgagtggaa	CRISPR spacer
gcccgagtgcaaggcgagagctgtgctcgagtgatt	Protospacer
.******.*****.*******************.  

6. spacer 1.1|2852458|36|NZ_CP035109|CRISPRCasFinder matches to NZ_CP024186 (Moraxella osloensis strain TT16 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.833

acccgagcgcaagacgagagctgtgctcgagtggaa	CRISPR spacer
gcccgagcgcaaggcgagagctatgctcgagtaggc	Protospacer
.************.********.*********.*. 

7. spacer 1.1|2852458|36|NZ_CP035109|CRISPRCasFinder matches to NZ_CP024177 (Moraxella osloensis strain YHS plasmid pYHS1, complete sequence) position: , mismatch: 6, identity: 0.833

acccgagcgcaagacgagagctgtgctcgagtggaa	CRISPR spacer
gcccgagtgcaaggcgagagctgtgctcgagtgatt	Protospacer
.******.*****.*******************.  

8. spacer 1.1|2852458|36|NZ_CP035109|CRISPRCasFinder matches to NZ_CP024177 (Moraxella osloensis strain YHS plasmid pYHS1, complete sequence) position: , mismatch: 6, identity: 0.833

acccgagcgcaagacgagagctgtgctcgagtggaa	CRISPR spacer
gcccgagcgcaaggcgagagctatgctcgagtaggc	Protospacer
.************.********.*********.*. 

9. spacer 1.1|2852458|36|NZ_CP035109|CRISPRCasFinder matches to NZ_CP024186 (Moraxella osloensis strain TT16 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.778

acccgagcgcaagacgagagctgtgctcgagtggaa	CRISPR spacer
gccccgacgcaaggcgagagctatgctcgagtgggc	Protospacer
.*** ..******.********.***********. 

10. spacer 1.1|2852458|36|NZ_CP035109|CRISPRCasFinder matches to NZ_CP024177 (Moraxella osloensis strain YHS plasmid pYHS1, complete sequence) position: , mismatch: 8, identity: 0.778

acccgagcgcaagacgagagctgtgctcgagtggaa	CRISPR spacer
gccccgacgcaaggcgagagctatgctcgagtgggc	Protospacer
.*** ..******.********.***********. 

11. spacer 1.1|2852458|36|NZ_CP035109|CRISPRCasFinder matches to NZ_CP040258 (Moraxella osloensis strain MOXF1 plasmid pMOXF1, complete sequence) position: , mismatch: 8, identity: 0.778

acccgagcgcaagacgagagctgtgctcgagtggaa	CRISPR spacer
gccccgacgcaaggcgagagctatgctcgagtgggg	Protospacer
.*** ..******.********.***********..

12. spacer 1.1|2852458|36|NZ_CP035109|CRISPRCasFinder matches to NZ_CP024446 (Moraxella osloensis strain NP7 plasmid pNP7-3, complete sequence) position: , mismatch: 9, identity: 0.75

acccgagcgcaagacgagagctgtgctcgagtggaa	CRISPR spacer
gccccgacgcaaggcgagagctatgctcgagtgagc	Protospacer
.*** ..******.********.**********.. 

13. spacer 1.1|2852458|36|NZ_CP035109|CRISPRCasFinder matches to NZ_AP017383 (Moraxella osloensis strain KMC41 plasmid pMOSL2, complete sequence) position: , mismatch: 9, identity: 0.75

acccgagcgcaagacgagagctgtgctcgagtggaa	CRISPR spacer
gccgcgacgcaaggcgagagctatgctcgagtgggc	Protospacer
.**  ..******.********.***********. 

14. spacer 1.1|2852458|36|NZ_CP035109|CRISPRCasFinder matches to NZ_CP024183 (Moraxella osloensis strain KSH plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.75

acccgagcgcaagacgagagctgtgctcgagtggaa	CRISPR spacer
gccgcgacgcaaggcgagagctatgctcgagtgggc	Protospacer
.**  ..******.********.***********. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2159563 : 2183963 37 Acinetobacter_phage(70.0%) terminase,capsid NA
DBSCAN-SWA_2 2280837 : 2289161 9 Acinetobacter_phage(42.86%) transposase NA
DBSCAN-SWA_3 2499924 : 2531406 42 Pseudomonas_phage(41.67%) transposase,integrase,tail,head,plate attL 2491111:2491126|attR 2507642:2507657
DBSCAN-SWA_4 3209068 : 3258380 48 Bacteriophage(16.67%) holin,coat,transposase,protease,capsid NA
DBSCAN-SWA_5 3275875 : 3322143 43 Mannheimia_phage(28.57%) tRNA,coat,tail,plate NA
DBSCAN-SWA_6 3327991 : 3349650 30 Pseudomonas_phage(23.81%) transposase,head,integrase,capsid attL 3320584:3320599|attR 3346229:3346244
DBSCAN-SWA_7 3593623 : 3604727 12 Acinetobacter_phage(50.0%) integrase attL 3592017:3592030|attR 3599489:3599502
DBSCAN-SWA_8 3619892 : 3655195 45 Acinetobacter_phage(81.58%) terminase,capsid NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage