Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP046620 Rhodobacteraceae bacterium 9Alg 56 chromosome, complete genome 3 crisprs csa3,RT,WYL,DEDDh,cas3 0 2 290 0

Results visualization

1. NZ_CP046620
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP046620_1 439900-440060 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP046620_2 440131-440318 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP046620_3 440497-440575 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP046620_1 1.1|439925|29|NZ_CP046620|CRISPRCasFinder 439925-439953 29 NZ_CP012399 Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence 614755-614783 5 0.828
NZ_CP046620_1 1.1|439925|29|NZ_CP046620|CRISPRCasFinder 439925-439953 29 NC_010625 Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence 1646227-1646255 5 0.828
NZ_CP046620_1 1.1|439925|29|NZ_CP046620|CRISPRCasFinder 439925-439953 29 NZ_CP018229 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence 535364-535392 6 0.793
NZ_CP046620_1 1.1|439925|29|NZ_CP046620|CRISPRCasFinder 439925-439953 29 JQ680351 Unidentified phage clone 1013_scaffold1563 genomic sequence 19378-19406 6 0.793
NZ_CP046620_3 3.1|440522|29|NZ_CP046620|CRISPRCasFinder 440522-440550 29 NZ_LN907829 Erwinia gerundensis isolate E_g_EM595 plasmid pEM02, complete sequence 49647-49675 6 0.793
NZ_CP046620_1 1.1|439925|29|NZ_CP046620|CRISPRCasFinder 439925-439953 29 NZ_LN907828 Erwinia gerundensis isolate E_g_EM595 plasmid pEM01, complete sequence 233495-233523 7 0.759
NZ_CP046620_1 1.1|439925|29|NZ_CP046620|CRISPRCasFinder 439925-439953 29 NZ_CP010410 Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence 402086-402114 7 0.759
NZ_CP046620_1 1.1|439925|29|NZ_CP046620|CRISPRCasFinder 439925-439953 29 NZ_CP045377 Sulfitobacter sp. THAF37 plasmid pTHAF37_e, complete sequence 93041-93069 7 0.759
NZ_CP046620_1 1.1|439925|29|NZ_CP046620|CRISPRCasFinder 439925-439953 29 MT770738 Rhizobium phage B1VFA, complete genome 76321-76349 7 0.759
NZ_CP046620_1 1.1|439925|29|NZ_CP046620|CRISPRCasFinder 439925-439953 29 KX752698 Mycobacterium phage Tonenili, complete genome 47564-47592 7 0.759

1. spacer 1.1|439925|29|NZ_CP046620|CRISPRCasFinder matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 5, identity: 0.828

atatccgcaccggtgccgccgttgagcac	CRISPR spacer
gtgtcgtcaccgttgccgccgttgagcac	Protospacer
.*.**  ***** ****************

2. spacer 1.1|439925|29|NZ_CP046620|CRISPRCasFinder matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 5, identity: 0.828

-atatccgcaccggtgccgccgttgagcac	CRISPR spacer
cgcatctg-accggtgcggccgttgagcac	Protospacer
 ..***.* ******** ************

3. spacer 1.1|439925|29|NZ_CP046620|CRISPRCasFinder matches to NZ_CP018229 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.793

atatccgcaccggtgccgccgttgagcac	CRISPR spacer
gtgtccgcacccgtgccgccgtcgagcgt	Protospacer
.*.******** **********.****..

4. spacer 1.1|439925|29|NZ_CP046620|CRISPRCasFinder matches to JQ680351 (Unidentified phage clone 1013_scaffold1563 genomic sequence) position: , mismatch: 6, identity: 0.793

atatccgcaccggtgccgccgttgagcac-	CRISPR spacer
gtattcgcaccggtgccgtcgttg-tcata	Protospacer
.***.*************.*****  **. 

5. spacer 3.1|440522|29|NZ_CP046620|CRISPRCasFinder matches to NZ_LN907829 (Erwinia gerundensis isolate E_g_EM595 plasmid pEM02, complete sequence) position: , mismatch: 6, identity: 0.793

atatccgcaccctgggcaccattgatgaa	CRISPR spacer
cggtccgccgcctgggcaccattgatgac	Protospacer
  .*****  ****************** 

6. spacer 1.1|439925|29|NZ_CP046620|CRISPRCasFinder matches to NZ_LN907828 (Erwinia gerundensis isolate E_g_EM595 plasmid pEM01, complete sequence) position: , mismatch: 7, identity: 0.759

atatccgcaccggtgccgccgttgagcac	CRISPR spacer
ttcagcgcaccggtgccgccggtgagcgt	Protospacer
 *   **************** *****..

7. spacer 1.1|439925|29|NZ_CP046620|CRISPRCasFinder matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.759

atatccgcaccggtgccgccgttgagcac	CRISPR spacer
gaggccgcgccggggccgccgttgagcgc	Protospacer
. . ****.**** *************.*

8. spacer 1.1|439925|29|NZ_CP046620|CRISPRCasFinder matches to NZ_CP045377 (Sulfitobacter sp. THAF37 plasmid pTHAF37_e, complete sequence) position: , mismatch: 7, identity: 0.759

atatccgcaccggtgccgccgttgagcac	CRISPR spacer
gcatctgcaccggtgccgccgttctggag	Protospacer
..***.*****************  * * 

9. spacer 1.1|439925|29|NZ_CP046620|CRISPRCasFinder matches to MT770738 (Rhizobium phage B1VFA, complete genome) position: , mismatch: 7, identity: 0.759

atatccgcaccggtgccgccgttgagcac	CRISPR spacer
agatccgcaccggtgtcgccgttcttgaa	Protospacer
* *************.*******    * 

10. spacer 1.1|439925|29|NZ_CP046620|CRISPRCasFinder matches to KX752698 (Mycobacterium phage Tonenili, complete genome) position: , mismatch: 7, identity: 0.759

atatccgcaccggtgccgccgttgagcac	CRISPR spacer
ccgcccgcaccggcgccgccgttgaccgc	Protospacer
 ...*********.*********** *.*

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 9511 11 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_2 29622 : 30891 3 Tetraselmis_virus(50.0%) NA NA
DBSCAN-SWA_3 34287 : 36579 3 Orpheovirus(50.0%) protease NA
DBSCAN-SWA_4 43290 : 44828 2 Only_Syngen_Nebraska_virus(50.0%) NA NA
DBSCAN-SWA_5 61566 : 67785 6 Hokovirus(33.33%) NA NA
DBSCAN-SWA_6 80722 : 81943 1 Ochrobactrum_phage(100.0%) NA NA
DBSCAN-SWA_7 93462 : 94488 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_8 106876 : 107863 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_9 112779 : 116112 5 Caulobacter_phage(33.33%) NA NA
DBSCAN-SWA_10 119640 : 124074 5 Mollivirus(33.33%) protease NA
DBSCAN-SWA_11 127664 : 131521 3 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_12 148024 : 149329 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_13 153122 : 157612 4 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_14 169920 : 171714 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_15 175943 : 176471 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_16 197528 : 198302 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_17 205475 : 207782 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_18 215986 : 217707 2 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_19 222452 : 223568 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_20 227092 : 231178 2 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_21 234512 : 235406 1 Salicola_phage(100.0%) NA NA
DBSCAN-SWA_22 247364 : 248954 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_23 254865 : 256572 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_24 261215 : 262949 1 Streptococcus_virus(100.0%) NA NA
DBSCAN-SWA_25 274611 : 275673 1 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_26 286174 : 288598 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_27 296776 : 299107 2 Oenococcus_phage(50.0%) NA NA
DBSCAN-SWA_28 311322 : 312699 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_29 330093 : 331287 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_30 336351 : 341617 6 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_31 349083 : 350658 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_32 356774 : 358035 2 Moraxella_phage(50.0%) NA NA
DBSCAN-SWA_33 399532 : 405893 6 Acinetobacter_phage(33.33%) NA NA
DBSCAN-SWA_34 417998 : 419411 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_35 429282 : 432596 4 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_36 445050 : 458997 5 Paenibacillus_phage(33.33%) NA NA
DBSCAN-SWA_37 462219 : 462972 1 Diadromus_pulchellus_ascovirus(100.0%) NA NA
DBSCAN-SWA_38 471957 : 482427 8 Streptococcus_phage(33.33%) NA NA
DBSCAN-SWA_39 496955 : 498527 1 Eptesipox_virus(100.0%) NA NA
DBSCAN-SWA_40 513497 : 519114 5 Mycoplasma_phage(66.67%) NA NA
DBSCAN-SWA_41 523816 : 524461 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_42 530229 : 533645 3 Agrobacterium_phage(50.0%) tRNA NA
DBSCAN-SWA_43 537022 : 540195 3 Ruegeria_phage(50.0%) NA NA
DBSCAN-SWA_44 563861 : 565622 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_45 608094 : 608763 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_46 615948 : 620379 4 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_47 639893 : 642329 3 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_48 655011 : 660317 4 Pneumococcus_phage(50.0%) tRNA NA
DBSCAN-SWA_49 664239 : 670703 5 Stenotrophomonas_phage(33.33%) NA NA
DBSCAN-SWA_50 674811 : 675717 1 Loktanella_phage(100.0%) NA NA
DBSCAN-SWA_51 683310 : 689804 5 Bacillus_virus(33.33%) NA NA
DBSCAN-SWA_52 701888 : 703097 1 Orpheovirus(100.0%) NA NA
DBSCAN-SWA_53 718863 : 722325 4 Acanthocystis_turfacea_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_54 759689 : 760661 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_55 765302 : 767077 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_56 773048 : 774937 2 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_57 780603 : 784241 4 Bacillus_virus(33.33%) NA NA
DBSCAN-SWA_58 788272 : 789784 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_59 811464 : 812850 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_60 838190 : 839819 1 Marinitoga_camini_virus(100.0%) NA NA
DBSCAN-SWA_61 846943 : 847570 1 Halocynthia_phage(100.0%) NA NA
DBSCAN-SWA_62 855783 : 864131 7 Bordetella_phage(20.0%) integrase attL 862063:862077|attR 868625:868639
DBSCAN-SWA_63 880131 : 881715 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_64 890314 : 890926 1 Emiliania_huxleyi_virus(100.0%) NA NA
DBSCAN-SWA_65 900379 : 901537 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_66 906676 : 908940 3 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_67 914267 : 979300 66 Paracoccus_phage(18.18%) head,protease,tail,portal,tRNA,capsid NA
DBSCAN-SWA_68 991663 : 993835 1 Microbacterium_phage(100.0%) NA NA
DBSCAN-SWA_69 1004545 : 1005922 1 Orpheovirus(100.0%) NA NA
DBSCAN-SWA_70 1010617 : 1015755 5 Brazilian_cedratvirus(25.0%) NA NA
DBSCAN-SWA_71 1044124 : 1049770 4 Chrysochromulina_ericina_virus(50.0%) NA NA
DBSCAN-SWA_72 1054089 : 1058134 6 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_73 1062541 : 1063714 1 Brevibacillus_phage(100.0%) NA NA
DBSCAN-SWA_74 1068639 : 1069965 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_75 1077415 : 1081260 3 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_76 1084836 : 1085385 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_77 1101826 : 1107191 5 Tupanvirus(25.0%) protease NA
DBSCAN-SWA_78 1115779 : 1119517 4 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_79 1125328 : 1126042 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_80 1137398 : 1138130 1 Flavobacterium_phage(100.0%) NA NA
DBSCAN-SWA_81 1153735 : 1158661 6 Acinetobacter_phage(75.0%) NA NA
DBSCAN-SWA_82 1163873 : 1166352 2 Bodo_saltans_virus(50.0%) NA NA
DBSCAN-SWA_83 1173799 : 1176485 2 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_84 1187141 : 1198334 11 uncultured_Mediterranean_phage(50.0%) tRNA NA
DBSCAN-SWA_85 1207137 : 1209225 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_86 1226754 : 1228903 2 Trichoplusia_ni_ascovirus(50.0%) NA NA
DBSCAN-SWA_87 1238322 : 1240518 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_88 1246505 : 1247726 1 environmental_halophage(100.0%) NA NA
DBSCAN-SWA_89 1251043 : 1251799 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_90 1269840 : 1277976 7 Mollivirus(33.33%) NA NA
DBSCAN-SWA_91 1282784 : 1283525 1 Powai_lake_megavirus(100.0%) NA NA
DBSCAN-SWA_92 1301892 : 1307463 4 Bacillus_phage(66.67%) tRNA NA
DBSCAN-SWA_93 1312108 : 1319619 7 Klosneuvirus(25.0%) integrase attL 1318224:1318240|attR 1324235:1324251
DBSCAN-SWA_94 1324840 : 1326626 2 Stx2-converting_phage(50.0%) NA NA
DBSCAN-SWA_95 1339028 : 1353898 15 Bacillus_virus(14.29%) protease NA
DBSCAN-SWA_96 1370417 : 1372823 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_97 1376219 : 1378781 2 uncultured_Mediterranean_phage(50.0%) tRNA NA
DBSCAN-SWA_98 1388837 : 1389374 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_99 1407450 : 1415665 6 Yellowstone_lake_phycodnavirus(50.0%) NA NA
DBSCAN-SWA_100 1433656 : 1434778 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_101 1439794 : 1441072 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_102 1444491 : 1446048 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_103 1450414 : 1451770 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_104 1461608 : 1464610 2 Pandoravirus(50.0%) NA NA
DBSCAN-SWA_105 1482005 : 1482833 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_106 1491669 : 1492218 1 Rhizobium_phage(100.0%) NA NA
DBSCAN-SWA_107 1510157 : 1514250 4 Flavobacterium_phage(33.33%) NA NA
DBSCAN-SWA_108 1525340 : 1526987 1 Only_Syngen_Nebraska_virus(100.0%) NA NA
DBSCAN-SWA_109 1538829 : 1543593 5 Rhodococcus_phage(33.33%) NA NA
DBSCAN-SWA_110 1550466 : 1551933 1 Acanthamoeba_polyphaga_mimivirus(100.0%) tRNA NA
DBSCAN-SWA_111 1558409 : 1559916 2 Mycobacterium_phage(50.0%) NA NA
DBSCAN-SWA_112 1568898 : 1570719 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_113 1578048 : 1579575 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_114 1596290 : 1597061 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_115 1603568 : 1615776 13 Pithovirus(20.0%) NA NA
DBSCAN-SWA_116 1621624 : 1622698 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_117 1627030 : 1627837 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_118 1641478 : 1642498 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_119 1646610 : 1647891 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_120 1656946 : 1659521 4 Mycobacterium_phage(50.0%) NA NA
DBSCAN-SWA_121 1663265 : 1664813 1 Klebsiella_phage(100.0%) NA NA
DBSCAN-SWA_122 1671573 : 1673955 2 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_123 1686203 : 1710683 21 Streptococcus_phage(14.29%) integrase,holin attL 1683394:1683408|attR 1692778:1692792
DBSCAN-SWA_124 1717607 : 1718375 1 Dickeya_phage(100.0%) NA NA
DBSCAN-SWA_125 1724522 : 1725506 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_126 1738980 : 1742832 3 Catovirus(50.0%) NA NA
DBSCAN-SWA_127 1753474 : 1755250 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_128 1781604 : 1784777 2 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_129 1788613 : 1790221 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_130 1797307 : 1798411 1 uncultured_phage(100.0%) NA NA
DBSCAN-SWA_131 1811194 : 1811848 1 Cowpox_virus(100.0%) NA NA
DBSCAN-SWA_132 1834481 : 1838732 4 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_133 1853937 : 1858695 3 Ostreococcus_tauri_virus(50.0%) NA NA
DBSCAN-SWA_134 1869495 : 1870927 2 Indivirus(50.0%) NA NA
DBSCAN-SWA_135 1877456 : 1879508 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_136 1888399 : 1889236 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_137 1905936 : 1911011 4 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_138 1914847 : 1915441 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_139 1926648 : 1929000 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_140 1935792 : 1938762 4 uncultured_marine_virus(25.0%) terminase NA
DBSCAN-SWA_141 1944488 : 1944941 1 Acidithiobacillus_phage(100.0%) NA NA
DBSCAN-SWA_142 1953469 : 1954510 1 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_143 1957860 : 1965659 6 Orpheovirus(33.33%) NA NA
DBSCAN-SWA_144 1972552 : 1975653 3 Morganella_phage(50.0%) NA NA
DBSCAN-SWA_145 1982665 : 1999320 15 Bacillus_virus(14.29%) protease,tRNA NA
DBSCAN-SWA_146 2003026 : 2007854 5 Indivirus(33.33%) NA NA
DBSCAN-SWA_147 2015121 : 2016060 1 Only_Syngen_Nebraska_virus(100.0%) NA NA
DBSCAN-SWA_148 2023443 : 2029126 6 Klosneuvirus(66.67%) NA NA
DBSCAN-SWA_149 2049834 : 2051325 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_150 2060200 : 2061082 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_151 2090995 : 2097564 6 Staphylococcus_phage(33.33%) tRNA NA
DBSCAN-SWA_152 2104614 : 2105910 1 Aeromonas_phage(100.0%) NA NA
DBSCAN-SWA_153 2109482 : 2110337 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_154 2119709 : 2127811 7 Salicola_phage(33.33%) NA NA
DBSCAN-SWA_155 2131586 : 2132288 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_156 2159730 : 2164301 3 Klosneuvirus(50.0%) tRNA NA
DBSCAN-SWA_157 2188664 : 2189396 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_158 2198599 : 2199295 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_159 2204151 : 2206558 2 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_160 2214020 : 2214551 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_161 2218893 : 2220156 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_162 2230885 : 2232344 2 Cedratvirus(100.0%) NA NA
DBSCAN-SWA_163 2241464 : 2242283 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_164 2245778 : 2248301 1 Loktanella_phage(100.0%) NA NA
DBSCAN-SWA_165 2253425 : 2255591 2 Catovirus(50.0%) tRNA NA
DBSCAN-SWA_166 2258689 : 2268619 5 Acinetobacter_phage(60.0%) NA NA
DBSCAN-SWA_167 2317453 : 2332228 10 Vibrio_phage(25.0%) holin NA
DBSCAN-SWA_168 2340919 : 2342095 1 Golden_Marseillevirus(100.0%) NA NA
DBSCAN-SWA_169 2347415 : 2349128 1 Megavirus(100.0%) tRNA NA
DBSCAN-SWA_170 2352691 : 2353876 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_171 2357936 : 2358581 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_172 2362481 : 2363327 1 Perigonia_lusca_single_nucleopolyhedrovirus(100.0%) NA NA
DBSCAN-SWA_173 2377038 : 2377734 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_174 2400656 : 2401484 1 Escherichia_phage(100.0%) tRNA NA
DBSCAN-SWA_175 2412621 : 2419444 6 Klosneuvirus(33.33%) NA NA
DBSCAN-SWA_176 2433026 : 2447477 10 Bacillus_virus(20.0%) NA NA
DBSCAN-SWA_177 2459425 : 2465669 6 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_178 2469350 : 2471340 2 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_179 2475249 : 2477810 3 Indivirus(50.0%) NA NA
DBSCAN-SWA_180 2484673 : 2486179 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_181 2495011 : 2498594 4 Brazilian_marseillevirus(33.33%) NA NA
DBSCAN-SWA_182 2506894 : 2507794 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_183 2514095 : 2515196 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_184 2518277 : 2519327 1 Tupanvirus(100.0%) tRNA NA
DBSCAN-SWA_185 2530754 : 2531570 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_186 2539640 : 2548001 8 Wolbachia_phage(33.33%) NA NA
DBSCAN-SWA_187 2560673 : 2561444 1 Streptomyces_phage(100.0%) NA NA
DBSCAN-SWA_188 2585485 : 2586734 3 Streptomyces_phage(50.0%) NA NA
DBSCAN-SWA_189 2596697 : 2597513 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_190 2600936 : 2603196 3 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_191 2611873 : 2613130 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_192 2630545 : 2631019 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_193 2634233 : 2636171 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_194 2647896 : 2648409 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_195 2663811 : 2665296 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_196 2671254 : 2672322 1 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_197 2675630 : 2676518 1 Stenotrophomonas_phage(100.0%) NA NA
DBSCAN-SWA_198 2683419 : 2683902 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_199 2692657 : 2695630 1 Klosneuvirus(100.0%) tRNA NA
DBSCAN-SWA_200 2716512 : 2719122 1 Cronobacter_phage(100.0%) NA NA
DBSCAN-SWA_201 2733466 : 2739422 5 Brazilian_cedratvirus(33.33%) NA NA
DBSCAN-SWA_202 2743084 : 2745383 3 Agrobacterium_phage(50.0%) protease NA
DBSCAN-SWA_203 2765866 : 2767204 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_204 2785104 : 2788032 3 Erythrobacter_phage(33.33%) tRNA NA
DBSCAN-SWA_205 2797358 : 2797640 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_206 2806340 : 2808702 2 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_207 2815718 : 2816429 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_208 2822529 : 2829513 5 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_209 2835112 : 2836939 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_210 2846656 : 2847670 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_211 2857180 : 2863306 4 Agrobacterium_phage(33.33%) protease NA
DBSCAN-SWA_212 2871775 : 2878275 5 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_213 2882120 : 2882921 1 Grouper_iridovirus(100.0%) NA NA
DBSCAN-SWA_214 2889620 : 2891144 1 Alphaproteobacteria_virus(100.0%) NA NA
DBSCAN-SWA_215 2908785 : 2909112 1 Roseobacter_phage(100.0%) NA NA
DBSCAN-SWA_216 2913615 : 2914497 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_217 2920438 : 2921827 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_218 2932792 : 2934316 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_219 2941452 : 2942820 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_220 2945910 : 2947772 2 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_221 2962707 : 2964825 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_222 2971679 : 2973221 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_223 2998629 : 3001236 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_224 3006234 : 3009635 4 Synechococcus_phage(50.0%) tRNA NA
DBSCAN-SWA_225 3026924 : 3037069 9 Bacillus_virus(20.0%) NA NA
DBSCAN-SWA_226 3043393 : 3046174 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_227 3051295 : 3052942 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_228 3060994 : 3061660 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_229 3071506 : 3072598 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_230 3092544 : 3093207 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_231 3113149 : 3117149 2 Aeromonas_phage(50.0%) NA NA
DBSCAN-SWA_232 3124300 : 3125644 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_233 3129857 : 3136192 7 Indivirus(33.33%) NA NA
DBSCAN-SWA_234 3149052 : 3149781 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_235 3164953 : 3166066 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_236 3191681 : 3195905 3 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_237 3209244 : 3211545 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_238 3217931 : 3273130 49 Enterobacteria_phage(18.18%) protease,plate NA
DBSCAN-SWA_239 3278446 : 3279136 1 Bradyrhizobium_phage(100.0%) NA NA
DBSCAN-SWA_240 3288121 : 3307430 16 Natrialba_phage(14.29%) tRNA NA
DBSCAN-SWA_241 3315921 : 3316722 1 Sinorhizobium_phage(100.0%) NA NA
DBSCAN-SWA_242 3330611 : 3337569 7 uncultured_virus(20.0%) NA NA
DBSCAN-SWA_243 3341303 : 3348758 7 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_244 3354114 : 3355557 1 environmental_Halophage(100.0%) NA NA
DBSCAN-SWA_245 3376039 : 3378592 1 Streptomyces_phage(100.0%) plate NA
DBSCAN-SWA_246 3386913 : 3388803 1 Acidianus_tailed_spindle_virus(100.0%) NA NA
DBSCAN-SWA_247 3392104 : 3393673 1 Bacillus_phage(100.0%) tail NA
DBSCAN-SWA_248 3412203 : 3416727 3 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_249 3421269 : 3434266 13 Diadromus_pulchellus_ascovirus(20.0%) NA NA
DBSCAN-SWA_250 3439662 : 3445457 4 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_251 3452946 : 3453579 1 Clostridium_phage(100.0%) integrase attL 3439351:3439365|attR 3457355:3457369
DBSCAN-SWA_252 3465901 : 3471349 5 Chrysanthemum_virus(33.33%) NA NA
DBSCAN-SWA_253 3474391 : 3482243 7 Cronobacter_phage(33.33%) tRNA NA
DBSCAN-SWA_254 3488298 : 3489423 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_255 3497666 : 3498752 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_256 3502721 : 3503507 1 Acanthocystis_turfacea_chlorella_virus(100.0%) NA NA
DBSCAN-SWA_257 3508227 : 3511534 3 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_258 3518439 : 3524930 5 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_259 3545688 : 3547125 2 Brazilian_cedratvirus(50.0%) NA NA
DBSCAN-SWA_260 3566040 : 3567953 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_261 3573406 : 3576991 5 Brazilian_cedratvirus(33.33%) NA NA
DBSCAN-SWA_262 3583726 : 3585400 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_263 3614251 : 3614611 1 Bacillus_thuringiensis_phage(100.0%) NA NA
DBSCAN-SWA_264 3632546 : 3633623 1 Moraxella_phage(100.0%) tRNA NA
DBSCAN-SWA_265 3639943 : 3641889 2 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_266 3652448 : 3652706 1 Rhizobium_phage(100.0%) NA NA
DBSCAN-SWA_267 3683406 : 3684468 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_268 3695279 : 3701074 6 Catovirus(33.33%) NA NA
DBSCAN-SWA_269 3705175 : 3706111 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_270 3712458 : 3713619 1 Roseobacter_phage(100.0%) tRNA NA
DBSCAN-SWA_271 3716718 : 3724096 4 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_272 3732596 : 3733292 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_273 3783238 : 3784042 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_274 3807562 : 3808240 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_275 3811951 : 3817307 7 Salmonella_phage(40.0%) tRNA NA
DBSCAN-SWA_276 3821680 : 3823822 1 Aggregatibacter_phage(100.0%) NA NA
DBSCAN-SWA_277 3827403 : 3828087 1 Dishui_lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_278 3831541 : 3834289 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_279 3838955 : 3840372 2 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_280 3846082 : 3848719 2 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_281 3862908 : 3863967 1 Acanthamoeba_polyphaga_mimivirus(100.0%) NA NA
DBSCAN-SWA_282 3873151 : 3877547 3 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_283 3888573 : 3889689 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_284 3910428 : 3911886 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_285 3920044 : 3921701 2 uncultured_virus(50.0%) NA NA
DBSCAN-SWA_286 3938271 : 3938973 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_287 3942033 : 3942990 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_288 3950603 : 3955057 3 Pseudomonas_phage(50.0%) NA NA
DBSCAN-SWA_289 3961301 : 3962333 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_290 3972088 : 3975695 3 Bathycoccus_sp._RCC1105_virus(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage