Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP048000 Anaerocolumna sp. CBA3638 chromosome, complete genome 9 crisprs csa3,WYL,cas3,DEDDh,cas9 2 2 388 1

Results visualization

1. NZ_CP048000
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048000_1 1001882-1001963 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048000_2 1270220-1270414 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048000_3 1773983-1774121 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048000_4 2203833-2203943 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048000_5 2353627-2353768 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048000_6 2369513-2369619 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048000_7 2543788-2543921 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048000_8 2984772-2984899 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048000_9 3626485-3626604 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP048000_8 8.1|2984808|56|NZ_CP048000|CRISPRCasFinder 2984808-2984863 56 NZ_CP048000.1 1534245-1534300 0 1.0
NZ_CP048000_3 3.1|1774029|47|NZ_CP048000|CRISPRCasFinder 1774029-1774075 47 NZ_CP048000.1 311087-311133 1 0.979
NZ_CP048000_3 3.1|1774029|47|NZ_CP048000|CRISPRCasFinder 1774029-1774075 47 NZ_CP048000.1 1814895-1814941 1 0.979
NZ_CP048000_3 3.1|1774029|47|NZ_CP048000|CRISPRCasFinder 1774029-1774075 47 NZ_CP048000.1 4553920-4553966 1 0.979
NZ_CP048000_3 3.1|1774029|47|NZ_CP048000|CRISPRCasFinder 1774029-1774075 47 NZ_CP048000.1 1962588-1962634 1 0.979
NZ_CP048000_3 3.1|1774029|47|NZ_CP048000|CRISPRCasFinder 1774029-1774075 47 NZ_CP048000.1 1437964-1438010 2 0.957
NZ_CP048000_3 3.1|1774029|47|NZ_CP048000|CRISPRCasFinder 1774029-1774075 47 NZ_CP048000.1 2483394-2483440 2 0.957
NZ_CP048000_8 8.1|2984808|56|NZ_CP048000|CRISPRCasFinder 2984808-2984863 56 NZ_CP048000.1 2353609-2353664 2 0.964

1. spacer 8.1|2984808|56|NZ_CP048000|CRISPRCasFinder matches to position: 1534245-1534300, mismatch: 0, identity: 1.0

agaagaatagcaaaagcagctattcttcaggatttatgccaggaaagcatgggtgt	CRISPR spacer
agaagaatagcaaaagcagctattcttcaggatttatgccaggaaagcatgggtgt	Protospacer
********************************************************

2. spacer 3.1|1774029|47|NZ_CP048000|CRISPRCasFinder matches to position: 311087-311133, mismatch: 1, identity: 0.979

ctaacgcccatgctctttgggcataaatcgtgaagaatagcgtcttt	CRISPR spacer
ctaacgcccatgctctttgggcaaaaatcgtgaagaatagcgtcttt	Protospacer
*********************** ***********************

3. spacer 3.1|1774029|47|NZ_CP048000|CRISPRCasFinder matches to position: 1814895-1814941, mismatch: 1, identity: 0.979

ctaacgcccatgctctttgggcataaatcgtgaagaatagcgtcttt	CRISPR spacer
ctaacgcccatgctctttgggcaaaaatcgtgaagaatagcgtcttt	Protospacer
*********************** ***********************

4. spacer 3.1|1774029|47|NZ_CP048000|CRISPRCasFinder matches to position: 4553920-4553966, mismatch: 1, identity: 0.979

ctaacgcccatgctctttgggcataaatcgtgaagaatagcgtcttt	CRISPR spacer
ctaacgcccatgctctttgggcataaatcctgaagaatagcgtcttt	Protospacer
***************************** *****************

5. spacer 3.1|1774029|47|NZ_CP048000|CRISPRCasFinder matches to position: 1962588-1962634, mismatch: 1, identity: 0.979

ctaacgcccatgctctttgggcataaatcgtgaagaatagcgtcttt	CRISPR spacer
ctaacgcccatgctctttgggcaaaaatcgtgaagaatagcgtcttt	Protospacer
*********************** ***********************

6. spacer 3.1|1774029|47|NZ_CP048000|CRISPRCasFinder matches to position: 1437964-1438010, mismatch: 2, identity: 0.957

ctaacgcccatgctctttgggcataaatcgtgaagaatagcgtcttt	CRISPR spacer
ctaaagcccatgctctttgggcataaatcctgaagaatagcgtcttt	Protospacer
**** ************************ *****************

7. spacer 3.1|1774029|47|NZ_CP048000|CRISPRCasFinder matches to position: 2483394-2483440, mismatch: 2, identity: 0.957

ctaacgcccatgctctttgggcataaatcgtgaagaatagcgtcttt	CRISPR spacer
ctaacgcccatgccctttgggcaaaaatcgtgaagaatagcgtcttt	Protospacer
*************.********* ***********************

8. spacer 8.1|2984808|56|NZ_CP048000|CRISPRCasFinder matches to position: 2353609-2353664, mismatch: 2, identity: 0.964

agaagaatagcaaaagcagctattcttcaggatttatgccaggaaagcatgggtgt	CRISPR spacer
agaagaatagcaaaagcggctattcttcaggatttatgccaggaaagcatgggcgt	Protospacer
*****************.***********************************.**

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP048000_6 6.1|2369554|25|NZ_CP048000|CRISPRCasFinder 2369554-2369578 25 NZ_CP049251 Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed4, complete sequence 19547-19571 3 0.88
NZ_CP048000_1 1.1|1001910|26|NZ_CP048000|CRISPRCasFinder 1001910-1001935 26 MG250483 Aeromonas phage Ah1, complete genome 138571-138596 4 0.846

1. spacer 6.1|2369554|25|NZ_CP048000|CRISPRCasFinder matches to NZ_CP049251 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed4, complete sequence) position: , mismatch: 3, identity: 0.88

tgtgtgttcatgagaatgttctgtg	CRISPR spacer
tggatgttcatgagaatgttctgcg	Protospacer
** .*******************.*

2. spacer 1.1|1001910|26|NZ_CP048000|CRISPRCasFinder matches to MG250483 (Aeromonas phage Ah1, complete genome) position: , mismatch: 4, identity: 0.846

gagacatattgctcaattattaatct	CRISPR spacer
gagacatattgctctattattcacat	Protospacer
************** ****** *. *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 16750 10 Megavirus(100.0%) NA NA
DBSCAN-SWA_2 33367 : 35014 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_3 53178 : 54969 1 Klosneuvirus(100.0%) tRNA NA
DBSCAN-SWA_4 94888 : 97411 3 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_5 101445 : 101763 1 Streptomyces_phage(100.0%) NA NA
DBSCAN-SWA_6 105270 : 105471 1 Clostridium_virus(100.0%) NA NA
DBSCAN-SWA_7 143966 : 150427 6 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_8 166664 : 168236 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_9 173666 : 174665 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_10 178768 : 179077 1 Streptomyces_phage(100.0%) NA NA
DBSCAN-SWA_11 187682 : 188825 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_12 205107 : 207974 4 Trichoplusia_ni_ascovirus(50.0%) NA NA
DBSCAN-SWA_13 211141 : 215685 4 Clostridium_phage(33.33%) tRNA NA
DBSCAN-SWA_14 222909 : 223563 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_15 231346 : 232060 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_16 235640 : 238304 1 Klosneuvirus(100.0%) tRNA NA
DBSCAN-SWA_17 255440 : 256552 2 Marinitoga_camini_virus(50.0%) NA NA
DBSCAN-SWA_18 272792 : 276412 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_19 291209 : 292484 1 Powai_lake_megavirus(100.0%) NA NA
DBSCAN-SWA_20 307030 : 307543 1 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_21 326914 : 327807 2 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_22 360443 : 379883 13 Acanthocystis_turfacea_Chlorella_virus(14.29%) NA NA
DBSCAN-SWA_23 390218 : 397726 4 Catovirus(33.33%) NA NA
DBSCAN-SWA_24 408991 : 409690 1 Cafeteria_roenbergensis_virus(100.0%) NA NA
DBSCAN-SWA_25 420886 : 421579 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_26 425273 : 432849 7 Bacillus_phage(40.0%) NA NA
DBSCAN-SWA_27 436174 : 446530 9 uncultured_virus(33.33%) tRNA NA
DBSCAN-SWA_28 451774 : 453272 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_29 469339 : 469735 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_30 486506 : 487997 1 Tupanvirus(100.0%) tRNA NA
DBSCAN-SWA_31 518501 : 524822 6 Pandoravirus(33.33%) NA NA
DBSCAN-SWA_32 530863 : 531562 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_33 535993 : 536749 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_34 540208 : 540778 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_35 565675 : 566383 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_36 570764 : 573428 4 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_37 585442 : 587260 2 Paramecium_bursaria_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_38 593272 : 594775 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_39 613372 : 614107 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_40 629366 : 630269 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_41 638884 : 639088 1 Lake_Baikal_phage(100.0%) NA NA
DBSCAN-SWA_42 649495 : 661878 8 Bacillus_phage(40.0%) tRNA NA
DBSCAN-SWA_43 682207 : 685362 2 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_44 692323 : 693397 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_45 699427 : 706835 6 Staphylococcus_phage(25.0%) protease NA
DBSCAN-SWA_46 710271 : 710514 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_47 718513 : 720046 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_48 726642 : 727242 1 Cassava_brown_streak_virus(100.0%) NA NA
DBSCAN-SWA_49 742639 : 743662 1 Moraxella_phage(100.0%) tRNA NA
DBSCAN-SWA_50 781093 : 781534 1 Clostridium_phage(100.0%) NA NA
DBSCAN-SWA_51 793964 : 795565 2 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_52 803924 : 805433 2 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_53 812525 : 812870 1 Clostridium_phage(100.0%) NA NA
DBSCAN-SWA_54 819635 : 821085 2 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_55 832688 : 835561 3 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_56 840790 : 841618 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_57 853182 : 854293 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_58 858942 : 861393 2 Streptomyces_phage(50.0%) NA NA
DBSCAN-SWA_59 868763 : 870986 1 Virus_Rctr197k(100.0%) NA NA
DBSCAN-SWA_60 874747 : 890362 7 Vibrio_phage(40.0%) NA NA
DBSCAN-SWA_61 893531 : 894047 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_62 906073 : 918902 10 Indivirus(16.67%) NA NA
DBSCAN-SWA_63 924153 : 924414 1 Clostridium_phage(100.0%) NA NA
DBSCAN-SWA_64 928486 : 929419 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_65 948224 : 950205 2 Pandoravirus(50.0%) NA NA
DBSCAN-SWA_66 953289 : 954645 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_67 957765 : 959106 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_68 965855 : 968731 3 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_69 974269 : 982251 5 Hokovirus(50.0%) NA NA
DBSCAN-SWA_70 992794 : 1002707 10 Organic_Lake_phycodnavirus(25.0%) NA NA
DBSCAN-SWA_71 1019277 : 1022826 3 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_72 1032369 : 1033962 1 Diachasmimorpha_longicaudata_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_73 1037981 : 1041716 2 Anomala_cuprea_entomopoxvirus(50.0%) NA NA
DBSCAN-SWA_74 1055638 : 1065846 9 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_75 1076693 : 1077605 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_76 1087031 : 1088729 1 Orpheovirus(100.0%) tRNA NA
DBSCAN-SWA_77 1099906 : 1100959 1 Circoviridae_20_LDMD-2013(100.0%) NA NA
DBSCAN-SWA_78 1116458 : 1120409 3 Bacillus_virus(50.0%) protease NA
DBSCAN-SWA_79 1123859 : 1125428 1 Streptococcus_virus(100.0%) NA NA
DBSCAN-SWA_80 1133474 : 1135217 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_81 1147334 : 1148654 2 Mycobacterium_virus(50.0%) NA NA
DBSCAN-SWA_82 1182507 : 1197255 9 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_83 1207365 : 1211978 2 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_84 1228142 : 1230075 2 Mycobacterium_phage(50.0%) NA NA
DBSCAN-SWA_85 1237658 : 1239104 1 Stx2-converting_phage(100.0%) NA NA
DBSCAN-SWA_86 1255472 : 1259207 2 Streptomyces_phage(50.0%) NA NA
DBSCAN-SWA_87 1269586 : 1270183 1 Brevibacillus_phage(100.0%) NA NA
DBSCAN-SWA_88 1273907 : 1277736 5 Streptococcus_phage(33.33%) NA NA
DBSCAN-SWA_89 1292607 : 1296960 4 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_90 1302302 : 1305920 3 Hokovirus(50.0%) tRNA NA
DBSCAN-SWA_91 1313867 : 1322664 6 Escherichia_phage(20.0%) NA NA
DBSCAN-SWA_92 1328222 : 1328935 2 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_93 1338286 : 1345449 7 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_94 1348805 : 1353991 4 Tupanvirus(50.0%) tRNA NA
DBSCAN-SWA_95 1372186 : 1373644 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_96 1392249 : 1394223 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_97 1411153 : 1412545 1 Moumouvirus(100.0%) tRNA NA
DBSCAN-SWA_98 1427406 : 1428693 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_99 1438119 : 1440129 2 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_100 1446312 : 1446993 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_101 1452545 : 1454477 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_102 1467117 : 1469447 2 Pectobacterium_phage(50.0%) NA NA
DBSCAN-SWA_103 1485348 : 1491907 8 Staphylococcus_phage(33.33%) tRNA NA
DBSCAN-SWA_104 1497339 : 1501976 5 Only_Syngen_Nebraska_virus(25.0%) tRNA,protease NA
DBSCAN-SWA_105 1509298 : 1510033 1 Clostridium_phage(100.0%) NA NA
DBSCAN-SWA_106 1517383 : 1522220 3 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_107 1531915 : 1537950 5 Erysipelothrix_phage(33.33%) NA NA
DBSCAN-SWA_108 1544407 : 1546362 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_109 1553446 : 1565090 9 Streptococcus_phage(33.33%) NA NA
DBSCAN-SWA_110 1577214 : 1578864 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_111 1583101 : 1587109 4 uncultured_Caudovirales_phage(33.33%) NA NA
DBSCAN-SWA_112 1590212 : 1603119 10 Streptococcus_phage(40.0%) protease NA
DBSCAN-SWA_113 1630261 : 1632020 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_114 1635091 : 1635337 1 unidentified_phage(100.0%) NA NA
DBSCAN-SWA_115 1640203 : 1641091 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_116 1645466 : 1647743 2 Catovirus(50.0%) tRNA NA
DBSCAN-SWA_117 1657763 : 1671137 8 Planktothrix_phage(40.0%) NA NA
DBSCAN-SWA_118 1676247 : 1679031 2 Hokovirus(50.0%) integrase attL 1671695:1671708|attR 1681889:1681902
DBSCAN-SWA_119 1689398 : 1690178 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_120 1693516 : 1701849 4 Bacillus_virus(66.67%) NA NA
DBSCAN-SWA_121 1711699 : 1711921 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_122 1719602 : 1722372 2 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_123 1728458 : 1729718 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_124 1736445 : 1741833 7 Escherichia_phage(33.33%) NA NA
DBSCAN-SWA_125 1746539 : 1747706 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_126 1754524 : 1755541 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_127 1763459 : 1770811 3 Herpes_simplex_virus(33.33%) protease NA
DBSCAN-SWA_128 1776109 : 1787026 7 Thermobifida_phage(25.0%) NA NA
DBSCAN-SWA_129 1794557 : 1804268 10 Klosneuvirus(25.0%) tRNA,transposase NA
DBSCAN-SWA_130 1831717 : 1833794 2 Clostridium_phage(50.0%) protease NA
DBSCAN-SWA_131 1838164 : 1840222 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_132 1845865 : 1848040 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_133 1851973 : 1854204 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_134 1867220 : 1868030 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_135 1888232 : 1890188 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_136 1905413 : 1907546 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_137 1917465 : 1918389 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_138 1928112 : 1930734 1 Stenotrophomonas_phage(100.0%) NA NA
DBSCAN-SWA_139 1948166 : 1950733 3 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_140 1955878 : 1959498 4 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_141 1972935 : 1982664 6 Tupanvirus(25.0%) NA NA
DBSCAN-SWA_142 1987837 : 1994208 4 uncultured_Caudovirales_phage(33.33%) NA NA
DBSCAN-SWA_143 1997643 : 1999485 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_144 2038688 : 2039711 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_145 2050106 : 2050790 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_146 2076644 : 2078489 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_147 2098946 : 2100011 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_148 2106382 : 2107960 1 Orpheovirus(100.0%) NA NA
DBSCAN-SWA_149 2118028 : 2121011 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_150 2126713 : 2130260 4 Staphylococcus_phage(75.0%) NA NA
DBSCAN-SWA_151 2143103 : 2148901 6 Escherichia_phage(40.0%) NA NA
DBSCAN-SWA_152 2167565 : 2168849 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_153 2177758 : 2179156 1 Acanthamoeba_polyphaga_mimivirus(100.0%) tRNA NA
DBSCAN-SWA_154 2184870 : 2186586 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_155 2199940 : 2200756 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_156 2215572 : 2217536 2 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_157 2222300 : 2225229 2 Helicobacter_phage(50.0%) NA NA
DBSCAN-SWA_158 2228573 : 2234097 4 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_159 2237559 : 2237880 1 Brevibacillus_phage(100.0%) NA NA
DBSCAN-SWA_160 2243614 : 2246554 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_161 2250181 : 2250919 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_162 2258388 : 2261547 3 Catovirus(50.0%) NA NA
DBSCAN-SWA_163 2267639 : 2271176 4 Catovirus(50.0%) NA NA
DBSCAN-SWA_164 2275739 : 2280714 4 Brevibacillus_phage(33.33%) integrase attL 2275648:2275679|attR 2278930:2278961
DBSCAN-SWA_165 2291386 : 2294044 3 Micromonas_pusilla_virus(50.0%) NA NA
DBSCAN-SWA_166 2299130 : 2303116 4 Brazilian_cedratvirus(50.0%) NA NA
DBSCAN-SWA_167 2339310 : 2342400 1 Herpes_simplex_virus(100.0%) NA NA
DBSCAN-SWA_168 2347109 : 2352656 4 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_169 2362331 : 2367174 3 Catovirus(50.0%) NA NA
DBSCAN-SWA_170 2372936 : 2377893 4 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_171 2381376 : 2382009 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_172 2386447 : 2387506 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_173 2393224 : 2394403 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_174 2398749 : 2399769 1 Tupanvirus(100.0%) tRNA NA
DBSCAN-SWA_175 2413516 : 2416052 3 Tetraselmis_virus(33.33%) NA NA
DBSCAN-SWA_176 2442527 : 2446527 2 Bacillus_phage(50.0%) tRNA NA
DBSCAN-SWA_177 2450889 : 2460660 6 Orpheovirus(40.0%) tRNA NA
DBSCAN-SWA_178 2486512 : 2486713 1 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_179 2517508 : 2518342 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_180 2535942 : 2536323 1 Clostridium_phage(100.0%) NA NA
DBSCAN-SWA_181 2542693 : 2543488 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_182 2551367 : 2552708 1 Orpheovirus(100.0%) tRNA NA
DBSCAN-SWA_183 2567464 : 2568703 1 Aeromonas_phage(100.0%) NA NA
DBSCAN-SWA_184 2580569 : 2583215 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_185 2598976 : 2603463 4 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_186 2616841 : 2617987 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_187 2621470 : 2625569 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_188 2636469 : 2637030 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_189 2648595 : 2649537 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_190 2661980 : 2664332 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_191 2669730 : 2698282 39 Clostridium_phage(26.67%) integrase,portal,protease,capsid,terminase attL 2665554:2665569|attR 2682336:2682351
DBSCAN-SWA_192 2701593 : 2825846 110 Erysipelothrix_phage(58.7%) portal,protease,tail,head,transposase,capsid,terminase,holin NA
DBSCAN-SWA_193 2830981 : 2831770 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_194 2835663 : 2836413 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_195 2839473 : 2848763 7 Anomala_cuprea_entomopoxvirus(20.0%) NA NA
DBSCAN-SWA_196 2859437 : 2862062 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_197 2866570 : 2871412 3 Hokovirus(50.0%) NA NA
DBSCAN-SWA_198 2882658 : 2884251 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_199 2900302 : 2905454 4 Chrysochromulina_ericina_virus(50.0%) NA NA
DBSCAN-SWA_200 2914824 : 2919085 5 Tupanvirus(33.33%) coat NA
DBSCAN-SWA_201 2922805 : 2925832 3 Cedratvirus(50.0%) NA NA
DBSCAN-SWA_202 2944983 : 2950901 3 Stenotrophomonas_phage(50.0%) NA NA
DBSCAN-SWA_203 2958326 : 2959969 2 Anomala_cuprea_entomopoxvirus(50.0%) NA NA
DBSCAN-SWA_204 2965310 : 2966822 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_205 2976200 : 2976716 1 Actinomyces_phage(100.0%) NA NA
DBSCAN-SWA_206 2988160 : 2993462 3 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_207 2998202 : 3006978 6 Bacillus_phage(60.0%) NA NA
DBSCAN-SWA_208 3011856 : 3016902 4 Mycobacterium_phage(50.0%) NA NA
DBSCAN-SWA_209 3030641 : 3035167 3 Lactobacillus_phage(50.0%) NA NA
DBSCAN-SWA_210 3039552 : 3041034 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_211 3057651 : 3060907 3 Klosneuvirus(50.0%) tRNA NA
DBSCAN-SWA_212 3066565 : 3072132 5 Spodoptera_litura_nucleopolyhedrovirus(25.0%) NA NA
DBSCAN-SWA_213 3084573 : 3088201 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_214 3094388 : 3099347 5 Paramecium_bursaria_Chlorella_virus(66.67%) NA NA
DBSCAN-SWA_215 3103000 : 3104722 1 Ostreococcus_tauri_virus(100.0%) protease NA
DBSCAN-SWA_216 3110478 : 3119091 7 Planktothrix_phage(25.0%) NA NA
DBSCAN-SWA_217 3130492 : 3131299 1 Micromonas_sp._RCC1109_virus(100.0%) NA NA
DBSCAN-SWA_218 3152479 : 3153226 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_219 3178016 : 3179246 1 environmental_halophage(100.0%) NA NA
DBSCAN-SWA_220 3185391 : 3186066 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_221 3189211 : 3189976 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_222 3201422 : 3205432 3 Prochlorococcus_phage(66.67%) NA NA
DBSCAN-SWA_223 3211510 : 3212503 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_224 3220527 : 3222300 1 Tupanvirus(100.0%) tRNA NA
DBSCAN-SWA_225 3233967 : 3234654 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_226 3240794 : 3241652 1 Escherichia_phage(100.0%) tRNA NA
DBSCAN-SWA_227 3247844 : 3248858 1 Cafeteria_roenbergensis_virus(100.0%) NA NA
DBSCAN-SWA_228 3253176 : 3255300 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_229 3262993 : 3267175 3 Streptococcus_phage(66.67%) NA NA
DBSCAN-SWA_230 3293480 : 3294989 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_231 3303572 : 3304781 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_232 3310901 : 3313427 1 Bacteriophage(100.0%) NA NA
DBSCAN-SWA_233 3327180 : 3329894 3 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_234 3341638 : 3349161 5 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_235 3352960 : 3358521 4 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_236 3364679 : 3365861 1 Actinomyces_phage(100.0%) NA NA
DBSCAN-SWA_237 3382209 : 3382773 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_238 3390812 : 3392624 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_239 3396004 : 3402546 5 Hokovirus(33.33%) NA NA
DBSCAN-SWA_240 3411319 : 3412546 1 Phage_TP(100.0%) NA NA
DBSCAN-SWA_241 3419620 : 3420259 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_242 3439054 : 3440608 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_243 3443860 : 3452091 5 Vibrio_phage(20.0%) NA NA
DBSCAN-SWA_244 3455711 : 3456860 1 Oenococcus_phage(100.0%) NA NA
DBSCAN-SWA_245 3465462 : 3466395 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_246 3479816 : 3485601 5 Bacillus_phage(33.33%) integrase attL 3474041:3474054|attR 3485683:3485696
DBSCAN-SWA_247 3512201 : 3512639 1 Lake_Baikal_phage(100.0%) NA NA
DBSCAN-SWA_248 3525032 : 3526160 1 Organic_Lake_phycodnavirus(100.0%) holin NA
DBSCAN-SWA_249 3533612 : 3535255 2 Synechococcus_phage(50.0%) tRNA NA
DBSCAN-SWA_250 3539330 : 3541520 1 Cedratvirus(100.0%) NA NA
DBSCAN-SWA_251 3561027 : 3562651 2 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_252 3567530 : 3569594 1 Acanthamoeba_polyphaga_mimivirus(100.0%) NA NA
DBSCAN-SWA_253 3610913 : 3613577 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_254 3616843 : 3617641 1 Paenibacillus_phage(100.0%) NA NA
DBSCAN-SWA_255 3631619 : 3632177 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_256 3640245 : 3645348 3 Cafeteria_roenbergensis_virus(50.0%) NA NA
DBSCAN-SWA_257 3653792 : 3656458 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_258 3670870 : 3675436 4 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_259 3681129 : 3681954 1 Yellowstone_lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_260 3689521 : 3696117 4 Mycobacterium_phage(50.0%) tRNA NA
DBSCAN-SWA_261 3702868 : 3703789 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_262 3715621 : 3717196 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_263 3721939 : 3722779 1 Enterococcus_phage(100.0%) NA NA
DBSCAN-SWA_264 3727670 : 3731368 4 Pseudomonas_phage(50.0%) NA NA
DBSCAN-SWA_265 3736324 : 3737477 2 Prochlorococcus_phage(50.0%) NA NA
DBSCAN-SWA_266 3743736 : 3744792 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_267 3758607 : 3759360 1 Emiliania_huxleyi_virus(100.0%) NA NA
DBSCAN-SWA_268 3763946 : 3764960 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_269 3772387 : 3783700 8 Streptomyces_phage(16.67%) NA NA
DBSCAN-SWA_270 3794432 : 3795224 1 Enterococcus_phage(100.0%) NA NA
DBSCAN-SWA_271 3805941 : 3806862 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_272 3819974 : 3820445 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_273 3835747 : 3836074 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_274 3842119 : 3843508 1 Hepacivirus(100.0%) NA NA
DBSCAN-SWA_275 3852129 : 3854544 1 Staphylococcus_phage(100.0%) tRNA NA
DBSCAN-SWA_276 3859085 : 3862609 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_277 3869389 : 3871294 1 Tupanvirus(100.0%) tRNA NA
DBSCAN-SWA_278 3880934 : 3888995 5 Streptococcus_phage(33.33%) integrase attL 3871631:3871646|attR 3893405:3893420
DBSCAN-SWA_279 3900506 : 3901124 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_280 3916684 : 3923192 3 Pectobacterium_phage(50.0%) tRNA NA
DBSCAN-SWA_281 3935223 : 3936786 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_282 3940983 : 3945801 3 Clostridium_phage(50.0%) tRNA NA
DBSCAN-SWA_283 3970712 : 3975797 4 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_284 3990057 : 3991527 2 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_285 3995823 : 3996543 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_286 4005258 : 4006797 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_287 4011130 : 4025400 16 Grouper_iridovirus(12.5%) NA NA
DBSCAN-SWA_288 4031332 : 4037416 6 Streptococcus_phage(66.67%) NA NA
DBSCAN-SWA_289 4054178 : 4055567 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_290 4068698 : 4081440 8 Erwinia_phage(33.33%) tRNA NA
DBSCAN-SWA_291 4086490 : 4087189 1 Flavobacterium_phage(100.0%) NA NA
DBSCAN-SWA_292 4097633 : 4097876 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_293 4105309 : 4108326 3 Phage_TP(50.0%) NA NA
DBSCAN-SWA_294 4123378 : 4124113 1 Clostridioides_phage(100.0%) NA NA
DBSCAN-SWA_295 4129725 : 4131436 3 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_296 4134786 : 4138694 3 Agrobacterium_phage(50.0%) NA NA
DBSCAN-SWA_297 4160871 : 4161546 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_298 4165182 : 4166070 1 Bacillus_thuringiensis_phage(100.0%) NA NA
DBSCAN-SWA_299 4173554 : 4173911 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_300 4179102 : 4181043 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_301 4186200 : 4196638 9 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_302 4204785 : 4207725 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_303 4212414 : 4213173 1 Pandoravirus(100.0%) tRNA NA
DBSCAN-SWA_304 4220432 : 4222040 1 Micromonas_sp._RCC1109_virus(100.0%) NA NA
DBSCAN-SWA_305 4240534 : 4244939 2 Organic_Lake_phycodnavirus(50.0%) bacteriocin NA
DBSCAN-SWA_306 4253376 : 4254114 1 Clostridioides_phage(100.0%) NA NA
DBSCAN-SWA_307 4267320 : 4268277 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_308 4272972 : 4276945 4 Mycoplasma_phage(66.67%) NA NA
DBSCAN-SWA_309 4280019 : 4372000 79 Erysipelothrix_phage(48.84%) protease,tail,head,transposase,capsid,tRNA,terminase,holin NA
DBSCAN-SWA_310 4379372 : 4387406 6 Bacillus_phage(75.0%) NA NA
DBSCAN-SWA_311 4390461 : 4391643 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_312 4398049 : 4404907 7 Tetraselmis_virus(50.0%) NA NA
DBSCAN-SWA_313 4416131 : 4420158 4 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_314 4425018 : 4427160 1 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_315 4430793 : 4432809 1 Indivirus(100.0%) tRNA NA
DBSCAN-SWA_316 4439682 : 4440387 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_317 4449029 : 4449833 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_318 4453680 : 4463433 8 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_319 4467250 : 4473528 5 Clostridium_botulinum_C_phage(66.67%) NA NA
DBSCAN-SWA_320 4483952 : 4485161 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_321 4498560 : 4499433 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_322 4510889 : 4511906 1 uncultured_Mediterranean_phage(100.0%) protease NA
DBSCAN-SWA_323 4516568 : 4517120 1 Streptococcus_virus(100.0%) NA NA
DBSCAN-SWA_324 4520608 : 4521814 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_325 4527106 : 4531250 4 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_326 4540216 : 4540948 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_327 4546272 : 4548317 2 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_328 4555784 : 4558916 3 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_329 4565720 : 4570673 4 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_330 4587596 : 4588511 1 Moumouvirus(100.0%) NA NA
DBSCAN-SWA_331 4605420 : 4610541 1 Shigella_phage(100.0%) NA NA
DBSCAN-SWA_332 4626344 : 4632825 4 Oenococcus_phage(33.33%) NA NA
DBSCAN-SWA_333 4656579 : 4662659 6 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_334 4670380 : 4671544 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_335 4677581 : 4677794 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_336 4681634 : 4682663 1 Odonata-associated_circular_virus(100.0%) NA NA
DBSCAN-SWA_337 4687117 : 4687900 1 Cafeteria_roenbergensis_virus(100.0%) NA NA
DBSCAN-SWA_338 4702952 : 4711111 13 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_339 4728169 : 4728754 1 Streptococcus_phage(100.0%) integrase attL 4724718:4724733|attR 4730988:4731003
DBSCAN-SWA_340 4746762 : 4748559 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_341 4753203 : 4754061 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_342 4760412 : 4764192 1 Microbacterium_phage(100.0%) NA NA
DBSCAN-SWA_343 4779940 : 4781942 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_344 4787259 : 4789062 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_345 4799054 : 4801685 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_346 4806885 : 4816344 10 Halovirus(25.0%) NA NA
DBSCAN-SWA_347 4824415 : 4828170 3 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_348 4842001 : 4850163 4 Enterobacteria_phage(33.33%) NA NA
DBSCAN-SWA_349 4879267 : 4880302 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_350 4889213 : 4890023 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_351 4899714 : 4901511 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_352 4912652 : 4919525 6 Bacillus_phage(75.0%) NA NA
DBSCAN-SWA_353 4928631 : 4930170 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_354 4934625 : 4936140 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_355 4982312 : 4983428 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_356 4998788 : 4999532 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_357 5004247 : 5005723 1 Microcystis_phage(100.0%) NA NA
DBSCAN-SWA_358 5011841 : 5016416 2 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_359 5042862 : 5048120 6 Streptococcus_phage(33.33%) NA NA
DBSCAN-SWA_360 5068835 : 5070641 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_361 5077211 : 5079839 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_362 5085960 : 5086704 1 Enterococcus_phage(100.0%) NA NA
DBSCAN-SWA_363 5089740 : 5090439 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_364 5093731 : 5099231 5 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_365 5113933 : 5115742 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_366 5138604 : 5139615 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_367 5142728 : 5143733 1 Heterosigma_akashiwo_virus(100.0%) NA NA
DBSCAN-SWA_368 5154273 : 5157018 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_369 5170496 : 5172282 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_370 5182580 : 5183003 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_371 5192541 : 5194551 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_372 5198961 : 5200755 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_373 5204036 : 5207508 3 Trichoplusia_ni_ascovirus(50.0%) NA NA
DBSCAN-SWA_374 5213003 : 5214287 1 Turkeypox_virus(100.0%) NA NA
DBSCAN-SWA_375 5225960 : 5228989 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_376 5244151 : 5244781 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_377 5250890 : 5252741 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_378 5276544 : 5277399 1 Bordetella_phage(100.0%) NA NA
DBSCAN-SWA_379 5282456 : 5386496 100 Erysipelothrix_phage(65.31%) portal,protease,tail,head,transposase,capsid,tRNA,terminase,holin NA
DBSCAN-SWA_380 5389771 : 5398670 10 Streptococcus_phage(75.0%) NA NA
DBSCAN-SWA_381 5404074 : 5405691 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_382 5416029 : 5417739 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_383 5435215 : 5437529 2 Clostridioides_phage(50.0%) NA NA
DBSCAN-SWA_384 5441145 : 5443515 1 Tupanvirus(100.0%) tRNA NA
DBSCAN-SWA_385 5452719 : 5460159 9 Planktothrix_phage(25.0%) NA NA
DBSCAN-SWA_386 5463871 : 5464552 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_387 5472068 : 5472902 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_388 5476868 : 5478974 1 Tupanvirus(100.0%) NA NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_CP048000.1|WP_161837359.1|1533576_1534200_+|TetR/AcrR-family-transcriptional-regulator 1533576_1534200_+ 207 aa aa NA NA NA 1531915-1537950 yes