Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_AP022314 Mycobacterium xenopi strain JCM 15661 3 crisprs DEDDh,RT,cas3,c2c9_V-U4,csa3,casR,DinG,cas4,WYL 0 1 6 0

Results visualization

1. NZ_AP022314
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP022314_1 2002678-2002775 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP022314_2 3270151-3270231 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP022314_3 4466613-4466695 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_AP022314_3 3.1|4466638|33|NZ_AP022314|CRISPRCasFinder 4466638-4466670 33 NZ_CP040819 Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence 121438-121470 7 0.788

1. spacer 3.1|4466638|33|NZ_AP022314|CRISPRCasFinder matches to NZ_CP040819 (Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence) position: , mismatch: 7, identity: 0.788

ggcccgattggcccgctcctcctcatcgcgctc	CRISPR spacer
ggaggcattggcccgctccgcctcgtcgcgcgc	Protospacer
**    ************* ****.****** *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 80701 : 170594 59 Tupanvirus(46.67%) transposase,protease,tRNA NA
DBSCAN-SWA_2 1633771 : 1702757 53 Pseudomonas_phage(11.11%) transposase,protease NA
DBSCAN-SWA_3 1978081 : 2032552 59 Mycobacterium_phage(55.88%) integrase,capsid,tail,portal,tRNA,terminase attL 1985847:1985880|attR 2032953:2032986
DBSCAN-SWA_4 2262311 : 2268693 8 Burkholderia_virus(33.33%) transposase,integrase attL 2261493:2261508|attR 2267742:2267757
DBSCAN-SWA_5 3072970 : 3081673 7 Mycobacterium_phage(33.33%) NA NA
DBSCAN-SWA_6 4520075 : 4576938 53 Gordonia_phage(42.86%) integrase,transposase attL 4556806:4556843|attR 4570918:4570955
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage