Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_AP021881 Sulfuriferula nivalis strain SGTM 0 crisprs DEDDh,WYL,DinG,csa3,cas3 0 0 18 0
NZ_AP021882 Sulfuriferula nivalis strain SGTM plasmid SGTM_pl1, complete sequence 0 crisprs NA 0 0 0 0
NZ_AP021883 Sulfuriferula nivalis strain SGTM plasmid SGTM_pl2, complete sequence 1 crisprs NA 0 1 0 0

Results visualization

1. NZ_AP021881
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 86609 : 143621 60 Thermus_phage(15.38%) transposase,protease,tRNA,integrase attL 138561:138579|attR 147264:147282
DBSCAN-SWA_2 354889 : 394281 53 Acidithiobacillus_phage(20.0%) transposase,integrase attL 355637:355696|attR 394282:395872
DBSCAN-SWA_3 476231 : 492749 19 Erwinia_phage(33.33%) transposase,protease,integrase attL 480001:480060|attR 491321:492911
DBSCAN-SWA_4 675748 : 684036 10 Staphylococcus_phage(33.33%) tRNA NA
DBSCAN-SWA_5 1044613 : 1089775 54 Thermus_phage(25.0%) transposase,tRNA,integrase attL 1057993:1058052|attR 1089776:1091199
DBSCAN-SWA_6 1164596 : 1197817 28 Thermus_phage(66.67%) transposase,integrase attL 1193141:1193200|attR 1197818:1199240
DBSCAN-SWA_7 1202120 : 1319975 113 uncultured_virus(35.29%) transposase,protease,tRNA,integrase attL 1196792:1196851|attR 1266377:1266566
DBSCAN-SWA_8 1323332 : 1368413 48 Thermus_phage(30.0%) transposase,protease,tRNA,integrase attL 1337265:1337324|attR 1362552:1363975
DBSCAN-SWA_9 1400926 : 1458397 54 uncultured_Caudovirales_phage(25.0%) transposase,integrase attL 1400104:1400163|attR 1455946:1458438
DBSCAN-SWA_10 1493372 : 1601203 47 Oenococcus_phage(20.0%) transposase,integrase attL 1586940:1586955|attR 1606816:1606831
DBSCAN-SWA_11 1623249 : 1646245 28 Thermus_phage(50.0%) transposase,integrase attL 1622938:1622997|attR 1646498:1647921
DBSCAN-SWA_12 1802174 : 1854956 49 uncultured_virus(37.5%) transposase,protease,tRNA,integrase attL 1818287:1818301|attR 1855760:1855774
DBSCAN-SWA_13 2278873 : 2340491 60 uncultured_Mediterranean_phage(23.08%) transposase,tRNA,integrase attL 2290853:2290912|attR 2341454:2342268
DBSCAN-SWA_14 2411982 : 2450181 35 Moraxella_phage(14.29%) transposase,tRNA,integrase attL 2412120:2412135|attR 2429262:2429277
DBSCAN-SWA_15 2459842 : 2501543 38 uncultured_Caudovirales_phage(33.33%) transposase,plate,integrase attL 2459377:2459391|attR 2507528:2507542
DBSCAN-SWA_16 2517664 : 2526078 8 Tupanvirus(33.33%) tRNA NA
DBSCAN-SWA_17 3073643 : 3149565 82 uncultured_virus(13.33%) transposase,integrase attL 3087855:3087870|attR 3120052:3120067
DBSCAN-SWA_18 3207085 : 3221290 18 Thermus_phage(50.0%) transposase,integrase attL 3210743:3210802|attR 3214253:3214442

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_AP021883
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP021883_1 19959-20051 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_AP021883_1 1.1|19987|37|NZ_AP021883|CRISPRCasFinder 19987-20023 37 NZ_AP021883 Sulfuriferula nivalis strain SGTM plasmid SGTM_pl2, complete sequence 19987-20023 0 1.0
NZ_AP021883_1 1.1|19987|37|NZ_AP021883|CRISPRCasFinder 19987-20023 37 NZ_AP021883 Sulfuriferula nivalis strain SGTM plasmid SGTM_pl2, complete sequence 20008-20044 7 0.811
NZ_AP021883_1 1.1|19987|37|NZ_AP021883|CRISPRCasFinder 19987-20023 37 NZ_AP021883 Sulfuriferula nivalis strain SGTM plasmid SGTM_pl2, complete sequence 20029-20065 8 0.784

1. spacer 1.1|19987|37|NZ_AP021883|CRISPRCasFinder matches to NZ_AP021883 (Sulfuriferula nivalis strain SGTM plasmid SGTM_pl2, complete sequence) position: , mismatch: 0, identity: 1.0 

gcgaagaccgtaaatcactccctttattcagtaaatc	CRISPR spacer
gcgaagaccgtaaatcactccctttattcagtaaatc	Protospacer
*************************************

2. spacer 1.1|19987|37|NZ_AP021883|CRISPRCasFinder matches to NZ_AP021883 (Sulfuriferula nivalis strain SGTM plasmid SGTM_pl2, complete sequence) position: , mismatch: 7, identity: 0.811 

gcgaagaccgtaaatcactccctttattcagtaaatc	CRISPR spacer
ctttattcagtaaatcactccctttattcagtaaatc	Protospacer
 .  *  * ****************************

3. spacer 1.1|19987|37|NZ_AP021883|CRISPRCasFinder matches to NZ_AP021883 (Sulfuriferula nivalis strain SGTM plasmid SGTM_pl2, complete sequence) position: , mismatch: 8, identity: 0.784 

gcgaagaccgtaaatcactccctttattcagtaaatc	CRISPR spacer
ctttattcagtaaatcactccctttattcagtaaatt	Protospacer
 .  *  * ***************************.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage