Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP048031 Shewanella sp. Arc9-LZ chromosome, complete genome 4 crisprs cas3,RT,DinG,DEDDh,csa3 1 0 4 0

Results visualization

1. NZ_CP048031
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048031_1 1361802-1361894 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048031_2 1482766-1482849 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048031_3 1605248-1605357 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048031_4 3506602-3506822 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP048031_4 4.2|3506702|21|NZ_CP048031|CRT 3506702-3506722 21 NZ_CP048031.1 3506581-3506601 2 0.905

1. spacer 4.2|3506702|21|NZ_CP048031|CRT matches to position: 3506581-3506601, mismatch: 2, identity: 0.905

tctaagctctaggtctttgca	CRISPR spacer
tctaagctctagggctatgca	Protospacer
************* ** ****

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1281020 : 1288516 7 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_2 1864603 : 1874451 9 Faustovirus(14.29%) NA NA
DBSCAN-SWA_3 1994930 : 2036380 54 Vibrio_phage(42.86%) terminase,protease,portal,integrase attL 1992550:1992565|attR 2024554:2024569
DBSCAN-SWA_4 2157578 : 2166534 10 uncultured_Caudovirales_phage(33.33%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage