Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP047921 Candidatus Saccharibacteria bacterium FS05P-B chromosome, complete genome 1 crisprs NA 0 1 1 0

Results visualization

1. NZ_CP047921
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047921_1 736053-736265 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP047921_1 1.2|736218|33|NZ_CP047921|PILER-CR 736218-736250 33 NZ_KR052811 Lactobacillus crispatus strain L6 plasmid pLc17, complete sequence 7120-7152 7 0.788
NZ_CP047921_1 1.2|736218|33|NZ_CP047921|PILER-CR 736218-736250 33 NC_015598 Lactobacillus kefiranofaciens ZW3 plasmid pWW1, complete sequence 33093-33125 7 0.788
NZ_CP047921_1 1.2|736218|33|NZ_CP047921|PILER-CR 736218-736250 33 NZ_CP026504 Lactobacillus crispatus strain AB70 plasmid pLcAB70, complete sequence 10124-10156 7 0.788

1. spacer 1.2|736218|33|NZ_CP047921|PILER-CR matches to NZ_KR052811 (Lactobacillus crispatus strain L6 plasmid pLc17, complete sequence) position: , mismatch: 7, identity: 0.788

aattaccagcatcgatgagtttgtgggcaattt	CRISPR spacer
tgctaccagcattgatgagtttgtgggtgagtt	Protospacer
 ..*********.**************..* **

2. spacer 1.2|736218|33|NZ_CP047921|PILER-CR matches to NC_015598 (Lactobacillus kefiranofaciens ZW3 plasmid pWW1, complete sequence) position: , mismatch: 7, identity: 0.788

aattaccagcatcgatgagtttgtgggcaattt	CRISPR spacer
tgctaccagcattgatgagtttgtgggtgagtt	Protospacer
 ..*********.**************..* **

3. spacer 1.2|736218|33|NZ_CP047921|PILER-CR matches to NZ_CP026504 (Lactobacillus crispatus strain AB70 plasmid pLcAB70, complete sequence) position: , mismatch: 7, identity: 0.788

aattaccagcatcgatgagtttgtgggcaattt	CRISPR spacer
tgctaccagcattgatgagtttgtgggtgagtt	Protospacer
 ..*********.**************..* **

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 440992 : 456947 11 Aureococcus_anophage(12.5%) protease,tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage