Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP034934 Shigella dysenteriae strain 79-8006 plasmid p79-8006, complete sequence 0 crisprs RT 0 0 1 0
NZ_CP034935 Shigella dysenteriae strain 79-8006 chromosome, complete genome 3 crisprs DinG,cas3,DEDDh,WYL,c2c9_V-U4,c2c8_V-U2,csa3,cas6e,cas5,cse2gr11,cas2 0 3 223 0

Results visualization

1. NZ_CP034934
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 4 : 92909 64 Stx2-converting_phage(42.11%) transposase,tRNA,protease NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP034935
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP034935_1 444304-444427 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP034935_2 1932985-1933100 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP034935_3 2015415-2015563 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP034935_2 2.1|1933016|54|NZ_CP034935|CRISPRCasFinder 1933016-1933069 54 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 165411-165464 1 0.981
NZ_CP034935_1 1.1|444347|38|NZ_CP034935|CRISPRCasFinder 444347-444384 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
NZ_CP034935_3 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder 2015463-2015515 53 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 4158-4210 5 0.906
NZ_CP034935_3 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder 2015463-2015515 53 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 4157-4209 5 0.906
NZ_CP034935_3 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder 2015463-2015515 53 NZ_CP044308 Escherichia coli strain C27A plasmid pC27A-3, complete sequence 115798-115850 5 0.906
NZ_CP034935_3 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder 2015463-2015515 53 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 4157-4209 5 0.906
NZ_CP034935_3 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder 2015463-2015515 53 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 4157-4209 5 0.906
NZ_CP034935_3 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder 2015463-2015515 53 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229187-229239 8 0.849
NZ_CP034935_3 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder 2015463-2015515 53 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229288-229340 8 0.849
NZ_CP034935_3 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder 2015463-2015515 53 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239681-239733 8 0.849
NZ_CP034935_3 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder 2015463-2015515 53 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239782-239834 8 0.849
NZ_CP034935_3 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder 2015463-2015515 53 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230593-230645 8 0.849
NZ_CP034935_3 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder 2015463-2015515 53 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230694-230746 8 0.849
NZ_CP034935_3 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder 2015463-2015515 53 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211563-211615 8 0.849
NZ_CP034935_3 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder 2015463-2015515 53 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211664-211716 8 0.849
NZ_CP034935_3 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder 2015463-2015515 53 NZ_CP044147 Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2 7435-7487 9 0.83
NZ_CP034935_3 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder 2015463-2015515 53 CP044351 Escherichia coli strain 194195 plasmid p194195_1, complete sequence 84259-84311 9 0.83
NZ_CP034935_3 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder 2015463-2015515 53 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229389-229441 9 0.83
NZ_CP034935_3 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder 2015463-2015515 53 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239883-239935 9 0.83
NZ_CP034935_3 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder 2015463-2015515 53 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230795-230847 9 0.83
NZ_CP034935_3 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder 2015463-2015515 53 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211765-211817 9 0.83
NZ_CP034935_3 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder 2015463-2015515 53 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229086-229138 10 0.811
NZ_CP034935_3 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder 2015463-2015515 53 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 194192-194244 10 0.811
NZ_CP034935_3 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder 2015463-2015515 53 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239580-239632 10 0.811
NZ_CP034935_3 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder 2015463-2015515 53 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 204686-204738 10 0.811
NZ_CP034935_3 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder 2015463-2015515 53 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230492-230544 10 0.811
NZ_CP034935_3 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder 2015463-2015515 53 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 195520-195572 10 0.811
NZ_CP034935_3 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder 2015463-2015515 53 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211462-211514 10 0.811
NZ_CP034935_3 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder 2015463-2015515 53 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 176475-176527 10 0.811
NZ_CP034935_3 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder 2015463-2015515 53 NZ_AP023207 Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence 31292-31344 10 0.811
NZ_CP034935_3 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder 2015463-2015515 53 NZ_CP010208 Escherichia coli strain M11 plasmid B, complete sequence 27384-27436 11 0.792
NZ_CP034935_3 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder 2015463-2015515 53 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 87-139 11 0.792
NZ_CP034935_3 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder 2015463-2015515 53 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 86-138 11 0.792
NZ_CP034935_3 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder 2015463-2015515 53 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 86-138 11 0.792
NZ_CP034935_3 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder 2015463-2015515 53 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 86-138 11 0.792
NZ_CP034935_3 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder 2015463-2015515 53 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 40384-40436 11 0.792
NZ_CP034935_3 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder 2015463-2015515 53 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 397091-397143 11 0.792
NZ_CP034935_3 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder 2015463-2015515 53 NZ_AP023207 Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence 27987-28039 11 0.792
NZ_CP034935_3 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder 2015463-2015515 53 NZ_CP044307 Escherichia coli strain C27A plasmid pC27A-2, complete sequence 18288-18340 11 0.792
NZ_CP034935_2 2.1|1933016|54|NZ_CP034935|CRISPRCasFinder 1933016-1933069 54 NZ_CP048385 Citrobacter freundii strain 62 plasmid p6_C, complete sequence 72431-72484 12 0.778
NZ_CP034935_3 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder 2015463-2015515 53 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 82835-82887 12 0.774
NZ_CP034935_3 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder 2015463-2015515 53 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 386501-386553 12 0.774
NZ_CP034935_3 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder 2015463-2015515 53 MT230312 Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence 106-158 12 0.774
NZ_CP034935_3 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder 2015463-2015515 53 MG065691 UNVERIFIED: Campylobacter phage A11a, complete genome 33062-33114 12 0.774
NZ_CP034935_3 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder 2015463-2015515 53 MG065686 UNVERIFIED: Campylobacter phage A18a, complete genome 141009-141061 12 0.774
NZ_CP034935_3 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder 2015463-2015515 53 NZ_CP010208 Escherichia coli strain M11 plasmid B, complete sequence 27483-27535 13 0.755
NZ_CP034935_3 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder 2015463-2015515 53 NZ_CP044147 Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2 6687-6739 13 0.755
NZ_CP034935_3 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder 2015463-2015515 53 CP044351 Escherichia coli strain 194195 plasmid p194195_1, complete sequence 83533-83585 13 0.755
NZ_CP034935_3 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder 2015463-2015515 53 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 3315-3367 13 0.755
NZ_CP034935_3 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder 2015463-2015515 53 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 3314-3366 13 0.755
NZ_CP034935_3 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder 2015463-2015515 53 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 3314-3366 13 0.755
NZ_CP034935_3 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder 2015463-2015515 53 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 3314-3366 13 0.755
NZ_CP034935_3 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder 2015463-2015515 53 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 170852-170904 13 0.755
NZ_CP034935_3 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder 2015463-2015515 53 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 313585-313637 13 0.755

1. spacer 2.1|1933016|54|NZ_CP034935|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 1, identity: 0.981 

tggcctacacgctgcgattttgtaggccggataagcaaagcgcatccggcattc	CRISPR spacer
tggcctacacgctgcgattttgtaggccggataagcaaagcgcatccggcattg	Protospacer
*****************************************************

2. spacer 1.1|444347|38|NZ_CP034935|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947 

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

3. spacer 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 5, identity: 0.906 

aactgccggatgcggcgtgaacgccttatccggcctacggttc-ggcacaaacc	CRISPR spacer
aactgccggatgcggcgtgaacgccttatccgtcctaccgttcaggcacaagt-	Protospacer
******************************** ***** **** *******..

4. spacer 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 5, identity: 0.906 

aactgccggatgcggcgtgaacgccttatccggcctacggttc-ggcacaaacc	CRISPR spacer
aactgccggatgcggcgtgaacgccttatccgtcctaccgttcaggcacaagt-	Protospacer
******************************** ***** **** *******..

5. spacer 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder matches to NZ_CP044308 (Escherichia coli strain C27A plasmid pC27A-3, complete sequence) position: , mismatch: 5, identity: 0.906 

aactgccggatgcggcgtgaacgccttatccggcctacggttc-ggcacaaacc	CRISPR spacer
aactgccggatgcggcgtgaacgccttatccgtcctaccgttcaggcacaagt-	Protospacer
******************************** ***** **** *******..

6. spacer 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 5, identity: 0.906 

aactgccggatgcggcgtgaacgccttatccggcctacggttc-ggcacaaacc	CRISPR spacer
aactgccggatgcggcgtgaacgccttatccgtcctaccgttcaggcacaagt-	Protospacer
******************************** ***** **** *******..

7. spacer 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 5, identity: 0.906 

aactgccggatgcggcgtgaacgccttatccggcctacggttc-ggcacaaacc	CRISPR spacer
aactgccggatgcggcgtgaacgccttatccgtcctaccgttcaggcacaagt-	Protospacer
******************************** ***** **** *******..

8. spacer 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 8, identity: 0.849 

aactgccggatgcggcgtgaacgccttatccggcctacggttcg-gcacaaacc	CRISPR spacer
gactgccggatgcggcgtgaacgccttatccggcctacggatggcgcgggaat-	Protospacer
.*************************************** * * **. .**.

9. spacer 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 8, identity: 0.849 

aactgccggatgcggcgtgaacgccttatccggcctacggttcggcacaaacc-	CRISPR spacer
gactgccggatgcggcgtgaacgccttatccggcctacgggt-ggcgcgagaat	Protospacer
.*************************************** * ***.*.*.

10. spacer 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 8, identity: 0.849 

aactgccggatgcggcgtgaacgccttatccggcctacggttcg-gcacaaacc	CRISPR spacer
gactgccggatgcggcgtgaacgccttatccggcctacggatggcgcgggaat-	Protospacer
.*************************************** * * **. .**.

11. spacer 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 8, identity: 0.849 

aactgccggatgcggcgtgaacgccttatccggcctacggttcggcacaaacc-	CRISPR spacer
gactgccggatgcggcgtgaacgccttatccggcctacgggt-ggcgcgagaat	Protospacer
.*************************************** * ***.*.*.

12. spacer 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 8, identity: 0.849 

aactgccggatgcggcgtgaacgccttatccggcctacggttcg-gcacaaacc	CRISPR spacer
gactgccggatgcggcgtgaacgccttatccggcctacggatggcgcgggaat-	Protospacer
.*************************************** * * **. .**.

13. spacer 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 8, identity: 0.849 

aactgccggatgcggcgtgaacgccttatccggcctacggttcggcacaaacc-	CRISPR spacer
gactgccggatgcggcgtgaacgccttatccggcctacgggt-ggcgcgagaat	Protospacer
.*************************************** * ***.*.*.

14. spacer 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 8, identity: 0.849 

aactgccggatgcggcgtgaacgccttatccggcctacggttcg-gcacaaacc	CRISPR spacer
gactgccggatgcggcgtgaacgccttatccggcctacggatggcgcgggaat-	Protospacer
.*************************************** * * **. .**.

15. spacer 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 8, identity: 0.849 

aactgccggatgcggcgtgaacgccttatccggcctacggttcggcacaaacc-	CRISPR spacer
gactgccggatgcggcgtgaacgccttatccggcctacgggt-ggcgcgagaat	Protospacer
.*************************************** * ***.*.*.

16. spacer 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder matches to NZ_CP044147 (Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2) position: , mismatch: 9, identity: 0.83 

aactgccggatgcggcgtgaacgccttatccggcctacggttcggcacaaacc	CRISPR spacer
aattgccggatgcggcgtgaacgccttatccggcctacggttgagtgcagttt	Protospacer
**.*************************************** .*..**. ..

17. spacer 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder matches to CP044351 (Escherichia coli strain 194195 plasmid p194195_1, complete sequence) position: , mismatch: 9, identity: 0.83 

aactgccggatgcggcgtgaacgccttatccggcctacggttcggcacaaacc	CRISPR spacer
aattgccggatgcggcgtgaacgccttatccggcctacggttgagtgcagttt	Protospacer
**.*************************************** .*..**. ..

18. spacer 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 9, identity: 0.83 

aactgccggatgcggcgtgaacgccttatccggcctacggttcg-gcacaaacc	CRISPR spacer
gactgccggatgcggcgtaaacgccttatccggcctacggatggcgcgggaat-	Protospacer
.*****************.********************* * * **. .**.

19. spacer 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 9, identity: 0.83 

aactgccggatgcggcgtgaacgccttatccggcctacggttcg-gcacaaacc	CRISPR spacer
gactgccggatgcggcgtaaacgccttatccggcctacggatggcgcgggaat-	Protospacer
.*****************.********************* * * **. .**.

20. spacer 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 9, identity: 0.83 

aactgccggatgcggcgtgaacgccttatccggcctacggttcg-gcacaaacc	CRISPR spacer
gactgccggatgcggcgtaaacgccttatccggcctacggatggcgcgggaat-	Protospacer
.*****************.********************* * * **. .**.

21. spacer 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 9, identity: 0.83 

aactgccggatgcggcgtgaacgccttatccggcctacggttcg-gcacaaacc	CRISPR spacer
gactgccggatgcggcgtaaacgccttatccggcctacggatggcgcgggaat-	Protospacer
.*****************.********************* * * **. .**.

22. spacer 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 10, identity: 0.811 

aactgccggatgcggcgtgaacgccttatccggcctacggttcggcacaaacc	CRISPR spacer
gactgccggatgcggcgtgaacgccttatccggcctacggatggcgtgagaat	Protospacer
.*************************************** * *    *.* .

23. spacer 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 10, identity: 0.811 

aactgccggatgcggcgtgaacgccttatccggcctacggttcggcacaaacc-	CRISPR spacer
cactgccggatgcggcgtggacgccttatccggcctacgagt-ggcgcgagaat	Protospacer
 ******************.*******************. * ***.*.*.

24. spacer 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 10, identity: 0.811 

aactgccggatgcggcgtgaacgccttatccggcctacggttcggcacaaacc	CRISPR spacer
gactgccggatgcggcgtgaacgccttatccggcctacggatggcgtgagaat	Protospacer
.*************************************** * *    *.* .

25. spacer 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 10, identity: 0.811 

aactgccggatgcggcgtgaacgccttatccggcctacggttcggcacaaacc-	CRISPR spacer
cactgccggatgcggcgtggacgccttatccggcctacgagt-ggcgcgagaat	Protospacer
 ******************.*******************. * ***.*.*.

26. spacer 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 10, identity: 0.811 

aactgccggatgcggcgtgaacgccttatccggcctacggttcggcacaaacc	CRISPR spacer
gactgccggatgcggcgtgaacgccttatccggcctacggatggcgtgagaat	Protospacer
.*************************************** * *    *.* .

27. spacer 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 10, identity: 0.811 

aactgccggatgcggcgtgaacgccttatccggcctacggttcggcacaaacc-	CRISPR spacer
cactgccggatgcggcgtggacgccttatccggcctacgagt-ggcgcgagaat	Protospacer
 ******************.*******************. * ***.*.*.

28. spacer 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 10, identity: 0.811 

aactgccggatgcggcgtgaacgccttatccggcctacggttcggcacaaacc	CRISPR spacer
gactgccggatgcggcgtgaacgccttatccggcctacggatggcgtgagaat	Protospacer
.*************************************** * *    *.* .

29. spacer 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 10, identity: 0.811 

aactgccggatgcggcgtgaacgccttatccggcctacggttcggcacaaacc-	CRISPR spacer
cactgccggatgcggcgtggacgccttatccggcctacgagt-ggcgcgagaat	Protospacer
 ******************.*******************. * ***.*.*.

30. spacer 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder matches to NZ_AP023207 (Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence) position: , mismatch: 10, identity: 0.811 

aactgccggatgcggcgtgaacgccttatccggcctacggttcggcacaaacc-	CRISPR spacer
aaatgccggatgcggcgtaaacgccttatccggcctac-atttggcaacggctg	Protospacer
** ***************.******************* .**.****  ..*.

31. spacer 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder matches to NZ_CP010208 (Escherichia coli strain M11 plasmid B, complete sequence) position: , mismatch: 11, identity: 0.792 

aactgccggatgcggcgtgaacgccttatccggcctacggttcggcacaaacc	CRISPR spacer
aaccgccggatgcggcgtgaacgccttatccggcctacgggtgagtgcggttt	Protospacer
***.************************************ * .*..*.. ..

32. spacer 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 11, identity: 0.792 

aactgccggatgcggcgtgaacgccttatccggcctacggttcg-gcacaaacc	CRISPR spacer
tcaggtcggatgcggcgtgaacgcattattcggcctacggttcgcgtacagat-	Protospacer
    *.****************** ****.************** *.***.*.

33. spacer 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 11, identity: 0.792 

aactgccggatgcggcgtgaacgccttatccggcctacggttcg-gcacaaacc	CRISPR spacer
tcaggtcggatgcggcgtgaacgcattattcggcctacggttcgcgtacagat-	Protospacer
    *.****************** ****.************** *.***.*.

34. spacer 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 11, identity: 0.792 

aactgccggatgcggcgtgaacgccttatccggcctacggttcg-gcacaaacc	CRISPR spacer
tcaggtcggatgcggcgtgaacgcattattcggcctacggttcgcgtacagat-	Protospacer
    *.****************** ****.************** *.***.*.

35. spacer 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 11, identity: 0.792 

aactgccggatgcggcgtgaacgccttatccggcctacggttcg-gcacaaacc	CRISPR spacer
tcaggtcggatgcggcgtgaacgcattattcggcctacggttcgcgtacagat-	Protospacer
    *.****************** ****.************** *.***.*.

36. spacer 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 11, identity: 0.792 

aactgccggatgcggcgtgaacgccttatccggcctacggttcggcacaaacc	CRISPR spacer
ttttgccggatgcggcgtaaacgccttatccggcctacggtttggtgcgagtg	Protospacer
  .***************.***********************.**..*.*..

37. spacer 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 11, identity: 0.792 

aactgccggatgcggcgtgaacgccttatccggcctacggttcggcacaaacc----	CRISPR spacer
aattgccggatgcggcgtaaacgccttatccggcctaca----tggataaatcattg	Protospacer
**.***************.*******************.     * *.***.*

38. spacer 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder matches to NZ_AP023207 (Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence) position: , mismatch: 11, identity: 0.792 

aactgccggatgcggcgtgaacgccttatccggcctacggttcggcacaaacc-------	CRISPR spacer
aaatgccggatgcggcgtgaacgccttatccggcctacg--------cacactatatcag	Protospacer
** ************************************        ** **.

39. spacer 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder matches to NZ_CP044307 (Escherichia coli strain C27A plasmid pC27A-2, complete sequence) position: , mismatch: 11, identity: 0.792 

aactgccggatgcggcgtgaacgccttatccggcctacggttcg-gcacaaacc	CRISPR spacer
tcaggtcggatgcggcgtgaacgcattattcggcctacggttcgcgtacagat-	Protospacer
    *.****************** ****.************** *.***.*.

40. spacer 2.1|1933016|54|NZ_CP034935|CRISPRCasFinder matches to NZ_CP048385 (Citrobacter freundii strain 62 plasmid p6_C, complete sequence) position: , mismatch: 12, identity: 0.778 

tggcctacacgct-----gcgattttgtaggccggataagcaaagcgcatccggcattc	CRISPR spacer
-----tacaaattaattcgcggtattgtaggccggataagcaaagcgcatccggcagta	Protospacer
     **** ..*     ***.* ******************************** *

41. spacer 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 12, identity: 0.774 

aactgccggatgcggcgtgaacgccttatccggcctacggttcggcacaaacc	CRISPR spacer
aaatgccggatgcggcgtgaacgccttatccggcctacaaaccaagaaatttc	Protospacer
** ***********************************.. .*.. * *  .*

42. spacer 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 12, identity: 0.774 

aactgccggatgcggcgtgaacgccttatccggcctacggttcggcacaaacc-------	CRISPR spacer
aagtgccggatgcggcgtaaacgccttatccggcctacg-------ccagacttacttaa	Protospacer
** ***************.********************        **.**.

43. spacer 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder matches to MT230312 (Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence) position: , mismatch: 12, identity: 0.774 

aactgccggatgcggcgtgaacgccttatccggcctacggttcggcacaaacc	CRISPR spacer
gatcgccggatgcggcgtgaacgccttatccgtcctacggttctgtgctcggg	Protospacer
.*..**************************** ********** *..*  .

44. spacer 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder matches to MG065691 (UNVERIFIED: Campylobacter phage A11a, complete genome) position: , mismatch: 12, identity: 0.774 

aactgccggatgcggcgtgaacgccttatccggcctacggttcggcacaaacc-------	CRISPR spacer
ctttgccggatgcggcgtgaacgcctgatccggcctacggt-------aagcctgattag	Protospacer
  .*********************** **************       **.**

45. spacer 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder matches to MG065686 (UNVERIFIED: Campylobacter phage A18a, complete genome) position: , mismatch: 12, identity: 0.774 

aactgccggatgcggcgtgaacgccttatccggcctacggttcggcacaaacc-------	CRISPR spacer
ctttgccggatgcggcgtgaacgcctgatccggcctacggt-------aagcctgattag	Protospacer
  .*********************** **************       **.**

46. spacer 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder matches to NZ_CP010208 (Escherichia coli strain M11 plasmid B, complete sequence) position: , mismatch: 13, identity: 0.755 

aactgccggatgcggcgtgaacgccttatccggcctacggttcggcacaaacc-------	CRISPR spacer
aaccgccagatgcggcgtgaacgccttatccggcctaca---------aaatcgtctctt	Protospacer
***.***.******************************.         ***.*

47. spacer 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder matches to NZ_CP044147 (Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2) position: , mismatch: 13, identity: 0.755 

aactgccggatgcggcgtgaacgccttatccggcctacggttcggcacaaacc-------	CRISPR spacer
aactgccggatgcggcgtgaatgccttatccgtcctaca---------aaatcgtctctt	Protospacer
*********************.********** *****.         ***.*

48. spacer 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder matches to CP044351 (Escherichia coli strain 194195 plasmid p194195_1, complete sequence) position: , mismatch: 13, identity: 0.755 

aactgccggatgcggcgtgaacgccttatccggcctacggttcggcacaaacc-------	CRISPR spacer
aactgccggatgcggcgtgaatgccttatccgtcctaca---------aaatcgtctctt	Protospacer
*********************.********** *****.         ***.*

49. spacer 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 13, identity: 0.755 

aactgccggatgcggcgtgaacgccttatccggcctacggttcggcacaaacc-------	CRISPR spacer
aactgccggatgcggcgtaaacgccttatccgtcctaca---------aaatcgtctctt	Protospacer
******************.************* *****.         ***.*

50. spacer 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 13, identity: 0.755 

aactgccggatgcggcgtgaacgccttatccggcctacggttcggcacaaacc-------	CRISPR spacer
aactgccggatgcggcgtaaacgccttatccgtcctaca---------aaatcgtctctt	Protospacer
******************.************* *****.         ***.*

51. spacer 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 13, identity: 0.755 

aactgccggatgcggcgtgaacgccttatccggcctacggttcggcacaaacc-------	CRISPR spacer
aactgccggatgcggcgtaaacgccttatccgtcctaca---------aaatcgtctctt	Protospacer
******************.************* *****.         ***.*

52. spacer 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 13, identity: 0.755 

aactgccggatgcggcgtgaacgccttatccggcctacggttcggcacaaacc-------	CRISPR spacer
aactgccggatgcggcgtaaacgccttatccgtcctaca---------aaatcgtctctt	Protospacer
******************.************* *****.         ***.*

53. spacer 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 13, identity: 0.755 

aactgccggatgcggcgtgaacgccttatccggcctacgg---------ttcggcacaaa	CRISPR spacer
cactgtcggatgcggcgtgaacgccttatccgacctacgggtagtgcgttttg-------	Protospacer
 ****.**************************.*******         **.*

54. spacer 3.1|2015463|53|NZ_CP034935|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 13, identity: 0.755 

aactgccggatgcggcgtgaacgccttatccggcctacggttcggcacaaacc	CRISPR spacer
aaatgccggatgcggcgtaaacgccttatccggcctacaaaatcgtgctaatt	Protospacer
** ***************.*******************..  . *..* **..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 145817 124 Escherichia_phage(25.71%) head,tRNA,lysis,tail,holin,terminase,transposase,integrase attL 54015:54031|attR 147294:147310
DBSCAN-SWA_2 153313 : 196381 44 Stx2-converting_phage(27.27%) tRNA,protease,transposase NA
DBSCAN-SWA_3 201714 : 202998 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_4 206316 : 207171 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_5 210414 : 211056 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_6 215982 : 365814 114 Enterobacteria_phage(26.0%) tail,tRNA,transposase NA
DBSCAN-SWA_7 371550 : 372540 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_8 376898 : 378127 1 Shigella_phage(100.0%) transposase NA
DBSCAN-SWA_9 383926 : 388772 3 Stx2-converting_phage(66.67%) NA NA
DBSCAN-SWA_10 394581 : 411704 17 Salmonella_phage(22.22%) integrase,transposase attL 387931:387955|attR 424318:424342
DBSCAN-SWA_11 431135 : 436219 5 Lake_Baikal_phage(33.33%) NA NA
DBSCAN-SWA_12 447626 : 456418 9 Orpheovirus(20.0%) NA NA
DBSCAN-SWA_13 464953 : 466452 2 Indivirus(50.0%) NA NA
DBSCAN-SWA_14 473361 : 474636 1 Cronobacter_phage(100.0%) tRNA NA
DBSCAN-SWA_15 496632 : 498444 1 Vaccinia_virus(100.0%) NA NA
DBSCAN-SWA_16 509958 : 511260 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_17 534040 : 535212 1 Shigella_phage(100.0%) transposase NA
DBSCAN-SWA_18 546339 : 553275 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_19 559932 : 562167 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_20 565795 : 566866 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_21 571296 : 571581 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_22 577592 : 581443 2 Enterobacteria_phage(50.0%) transposase NA
DBSCAN-SWA_23 589714 : 595028 4 Stx2-converting_phage(75.0%) transposase NA
DBSCAN-SWA_24 603538 : 606789 4 Streptococcus_phage(33.33%) transposase NA
DBSCAN-SWA_25 621049 : 622315 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_26 635229 : 640887 4 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_27 649479 : 650070 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_28 656499 : 726940 82 Escherichia_phage(39.34%) head,lysis,tail,portal,holin,terminase,transposase,integrase,protease,capsid attL 693249:693263|attR 734099:734113
DBSCAN-SWA_29 734873 : 736888 2 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_30 748537 : 758420 10 Citrobacter_phage(25.0%) NA NA
DBSCAN-SWA_31 769676 : 860404 89 Stx2-converting_phage(28.12%) tRNA,lysis,holin,integrase,transposase attL 832587:832604|attR 860158:860175
DBSCAN-SWA_32 867691 : 867949 1 Erwinia_phage(100.0%) NA NA
DBSCAN-SWA_33 880207 : 881850 2 Streptococcus_virus(50.0%) NA NA
DBSCAN-SWA_34 885122 : 886304 2 Ralstonia_phage(50.0%) NA NA
DBSCAN-SWA_35 916931 : 917177 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_36 921618 : 925279 2 Acinetobacter_phage(50.0%) transposase NA
DBSCAN-SWA_37 936800 : 939343 3 Red_sea_bream_iridovirus(50.0%) transposase NA
DBSCAN-SWA_38 949159 : 949948 1 Cronobacter_phage(100.0%) NA NA
DBSCAN-SWA_39 961599 : 966391 2 Shigella_phage(50.0%) transposase NA
DBSCAN-SWA_40 971224 : 974752 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_41 977960 : 978173 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_42 997438 : 998098 1 uncultured_Caudovirales_phage(100.0%) protease NA
DBSCAN-SWA_43 1002331 : 1004386 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_44 1016985 : 1018893 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_45 1032531 : 1042691 7 Acinetobacter_phage(25.0%) tRNA NA
DBSCAN-SWA_46 1059597 : 1064138 3 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_47 1069224 : 1070313 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_48 1074411 : 1077626 2 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_49 1081089 : 1202015 112 Salmonella_phage(33.85%) tRNA,lysis,tail,terminase,transposase,integrase,protease,capsid attL 1121122:1121138|attR 1182343:1182359
DBSCAN-SWA_50 1216773 : 1217942 1 Shigella_phage(100.0%) transposase NA
DBSCAN-SWA_51 1223355 : 1225227 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_52 1228442 : 1236784 6 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_53 1241781 : 1331220 87 Stx2-converting_phage(20.0%) tail,holin,transposase NA
DBSCAN-SWA_54 1369309 : 1370101 1 Kaumoebavirus(100.0%) NA NA
DBSCAN-SWA_55 1373479 : 1379150 5 Acinetobacter_phage(33.33%) NA NA
DBSCAN-SWA_56 1386201 : 1392153 3 Paramecium_bursaria_Chlorella_virus(33.33%) NA NA
DBSCAN-SWA_57 1405322 : 1409136 2 Escherichia_phage(50.0%) tRNA NA
DBSCAN-SWA_58 1413901 : 1415566 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_59 1419702 : 1420743 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_60 1428639 : 1435294 4 Planktothrix_phage(33.33%) transposase NA
DBSCAN-SWA_61 1439777 : 1442360 1 Staphylococcus_phage(100.0%) tRNA NA
DBSCAN-SWA_62 1449368 : 1451808 2 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_63 1456623 : 1457271 2 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_64 1466621 : 1542892 54 Shigella_phage(13.33%) tRNA,transposase NA
DBSCAN-SWA_65 1547583 : 1620786 58 Stx2-converting_phage(30.43%) tRNA,protease,transposase NA
DBSCAN-SWA_66 1624411 : 1760259 116 Bacillus_phage(19.44%) tRNA,protease,integrase,transposase attL 1692339:1692398|attR 1749019:1750470
DBSCAN-SWA_67 1765602 : 1769800 4 Bradyrhizobium_phage(33.33%) NA NA
DBSCAN-SWA_68 1779740 : 1780772 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_69 1793775 : 1797891 2 Saccharomonospora_phage(50.0%) NA NA
DBSCAN-SWA_70 1806719 : 1807478 1 Flavobacterium_phage(100.0%) NA NA
DBSCAN-SWA_71 1820076 : 1821501 1 uncultured_Mediterranean_phage(100.0%) protease NA
DBSCAN-SWA_72 1826206 : 1826551 1 Lake_Baikal_phage(100.0%) NA NA
DBSCAN-SWA_73 1832462 : 1833260 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_74 1838443 : 1845249 6 Acanthamoeba_polyphaga_mimivirus(50.0%) tRNA NA
DBSCAN-SWA_75 1848425 : 1852646 4 Shigella_phage(50.0%) transposase NA
DBSCAN-SWA_76 1855908 : 1862376 4 Anomala_cuprea_entomopoxvirus(33.33%) NA NA
DBSCAN-SWA_77 1869917 : 1871342 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_78 1879969 : 1880521 1 Sphingobium_phage(100.0%) NA NA
DBSCAN-SWA_79 1885516 : 1886560 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_80 1912540 : 1914265 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_81 1926873 : 1927572 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_82 1933934 : 1939356 2 Yellowstone_lake_phycodnavirus(50.0%) NA NA
DBSCAN-SWA_83 1947100 : 1948500 2 Microcystis_phage(50.0%) NA NA
DBSCAN-SWA_84 1956549 : 1957698 1 Halovirus(100.0%) NA NA
DBSCAN-SWA_85 1962085 : 1975405 10 Tupanvirus(16.67%) tRNA,transposase NA
DBSCAN-SWA_86 1979153 : 1980107 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_87 1991820 : 1993934 2 Ectocarpus_siliculosus_virus(50.0%) NA NA
DBSCAN-SWA_88 1997217 : 2002572 3 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_89 2009315 : 2013173 3 Geobacillus_virus(50.0%) transposase NA
DBSCAN-SWA_90 2017567 : 2020443 3 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_91 2028337 : 2029617 2 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_92 2032843 : 2033866 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_93 2037320 : 2038976 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_94 2055345 : 2104349 35 Stx2-converting_phage(30.77%) transposase NA
DBSCAN-SWA_95 2107948 : 2119928 8 Enterobacteria_phage(20.0%) tRNA,integrase attL 2094035:2094049|attR 2115640:2115654
DBSCAN-SWA_96 2130362 : 2136477 6 Paramecium_bursaria_Chlorella_virus(66.67%) NA NA
DBSCAN-SWA_97 2140097 : 2142799 2 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_98 2147042 : 2148041 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_99 2152999 : 2153530 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_100 2195838 : 2395701 156 Stx2-converting_phage(26.67%) tRNA,protease,transposase NA
DBSCAN-SWA_101 2438664 : 2440254 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_102 2445621 : 2447385 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_103 2456602 : 2464931 2 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_104 2469048 : 2472101 2 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_105 2499454 : 2506701 5 Serratia_phage(33.33%) NA NA
DBSCAN-SWA_106 2529253 : 2533757 5 Erwinia_phage(50.0%) NA NA
DBSCAN-SWA_107 2547341 : 2552201 4 Feldmannia_irregularis_virus(33.33%) NA NA
DBSCAN-SWA_108 2568476 : 2571527 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_109 2575040 : 2576196 1 Acinetobacter_phage(100.0%) transposase NA
DBSCAN-SWA_110 2583709 : 2589814 6 Shigella_phage(25.0%) transposase NA
DBSCAN-SWA_111 2593697 : 2596168 2 Ectocarpus_siliculosus_virus(50.0%) NA NA
DBSCAN-SWA_112 2600245 : 2603032 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_113 2616722 : 2617337 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_114 2625782 : 2629069 4 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_115 2633993 : 2635222 1 Shigella_phage(100.0%) transposase NA
DBSCAN-SWA_116 2644933 : 2646763 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_117 2657568 : 2661427 3 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_118 2681425 : 2687569 6 Enterobacteria_phage(40.0%) NA NA
DBSCAN-SWA_119 2691611 : 2698622 5 Indivirus(25.0%) transposase NA
DBSCAN-SWA_120 2706774 : 2708421 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_121 2731123 : 2732116 1 Heterosigma_akashiwo_virus(100.0%) NA NA
DBSCAN-SWA_122 2744067 : 2766403 17 Stx2-converting_phage(33.33%) transposase NA
DBSCAN-SWA_123 2777375 : 2784744 8 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_124 2789921 : 2790875 2 Cyanophage(50.0%) NA NA
DBSCAN-SWA_125 2797249 : 2803964 9 Escherichia_phage(50.0%) transposase NA
DBSCAN-SWA_126 2821102 : 2822494 1 environmental_Halophage(100.0%) NA NA
DBSCAN-SWA_127 2826795 : 2833546 5 Bordetella_phage(33.33%) NA NA
DBSCAN-SWA_128 2836723 : 2837983 1 Morganella_phage(100.0%) integrase attL 2825608:2825621|attR 2842098:2842111
DBSCAN-SWA_129 2841326 : 2845889 7 Xanthomonas_phage(25.0%) NA NA
DBSCAN-SWA_130 2853327 : 2855421 2 Archaeal_BJ1_virus(50.0%) NA NA
DBSCAN-SWA_131 2858837 : 2868344 9 Synechococcus_phage(16.67%) NA NA
DBSCAN-SWA_132 2877723 : 2882829 2 Shigella_phage(100.0%) transposase NA
DBSCAN-SWA_133 2898774 : 2900619 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_134 2930590 : 3007154 58 Shigella_phage(20.0%) tRNA,transposase NA
DBSCAN-SWA_135 3010498 : 3012541 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_136 3022445 : 3028342 6 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_137 3036229 : 3040361 4 Dickeya_phage(50.0%) NA NA
DBSCAN-SWA_138 3043373 : 3046192 3 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_139 3051925 : 3053408 2 Anomala_cuprea_entomopoxvirus(50.0%) NA NA
DBSCAN-SWA_140 3056950 : 3058761 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_141 3080806 : 3086106 4 Stx2-converting_phage(50.0%) transposase NA
DBSCAN-SWA_142 3097954 : 3099181 1 Ralstonia_phage(100.0%) NA NA
DBSCAN-SWA_143 3103560 : 3105954 1 Iris_mild_mosaic_virus(100.0%) NA NA
DBSCAN-SWA_144 3111923 : 3112802 1 Sodalis_phage(100.0%) NA NA
DBSCAN-SWA_145 3119365 : 3126584 5 Bacillus_phage(50.0%) transposase NA
DBSCAN-SWA_146 3141451 : 3142288 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_147 3168642 : 3179519 10 Acinetobacter_phage(20.0%) transposase NA
DBSCAN-SWA_148 3185089 : 3190663 7 uncultured_Caudovirales_phage(33.33%) NA NA
DBSCAN-SWA_149 3211558 : 3213030 2 Prochlorococcus_phage(50.0%) tRNA NA
DBSCAN-SWA_150 3223442 : 3227575 3 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_151 3234079 : 3234964 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_152 3240301 : 3241132 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_153 3246206 : 3256118 11 Shigella_phage(20.0%) transposase NA
DBSCAN-SWA_154 3261930 : 3263820 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_155 3269301 : 3336428 63 Stx2-converting_phage(14.29%) protease,transposase NA
DBSCAN-SWA_156 3344173 : 3345401 1 Shigella_phage(100.0%) transposase NA
DBSCAN-SWA_157 3355680 : 3356724 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_158 3367084 : 3370498 3 Shigella_phage(50.0%) transposase NA
DBSCAN-SWA_159 3384733 : 3386134 1 environmental_Halophage(100.0%) NA NA
DBSCAN-SWA_160 3391747 : 3400123 9 Enterobacteria_phage(20.0%) tRNA NA
DBSCAN-SWA_161 3403928 : 3409301 3 Pandoravirus(50.0%) NA NA
DBSCAN-SWA_162 3417828 : 3419061 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_163 3439292 : 3439970 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_164 3453447 : 3454602 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_165 3465765 : 3468077 3 Stx2-converting_phage(100.0%) transposase NA
DBSCAN-SWA_166 3502011 : 3502896 1 Diadromus_pulchellus_ascovirus(100.0%) NA NA
DBSCAN-SWA_167 3522538 : 3526270 3 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_168 3529510 : 3540460 11 Bacillus_virus(20.0%) NA NA
DBSCAN-SWA_169 3544914 : 3546348 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_170 3551486 : 3552725 1 Sinorhizobium_phage(100.0%) tRNA NA
DBSCAN-SWA_171 3559671 : 3649141 63 Shigella_phage(21.05%) tRNA,transposase NA
DBSCAN-SWA_172 3653071 : 3655104 2 Hokovirus(50.0%) NA NA
DBSCAN-SWA_173 3658216 : 3660829 3 uncultured_Mediterranean_phage(66.67%) NA NA
DBSCAN-SWA_174 3664211 : 3671351 5 Escherichia_phage(80.0%) NA NA
DBSCAN-SWA_175 3689175 : 3690186 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_176 3697661 : 3698627 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_177 3704093 : 3709653 5 Pseudomonas_phage(25.0%) tRNA NA
DBSCAN-SWA_178 3722561 : 3727857 5 Bacillus_virus(20.0%) NA NA
DBSCAN-SWA_179 3731661 : 3732807 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_180 3742320 : 3744615 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_181 3768146 : 3769112 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_182 3780275 : 3786890 7 Tetraselmis_virus(25.0%) tRNA NA
DBSCAN-SWA_183 3798055 : 3798811 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_184 3803669 : 3804518 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_185 3809119 : 3816167 4 Oenococcus_phage(33.33%) NA NA
DBSCAN-SWA_186 3820199 : 3825284 4 Only_Syngen_Nebraska_virus(33.33%) NA NA
DBSCAN-SWA_187 3828976 : 3829459 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_188 3838903 : 3886340 35 Stx2-converting_phage(35.29%) tRNA,transposase NA
DBSCAN-SWA_189 3890702 : 3894445 3 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_190 3897903 : 3898164 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_191 3902283 : 3913572 7 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_192 3919346 : 3920503 1 Acinetobacter_phage(100.0%) transposase NA
DBSCAN-SWA_193 3931923 : 3938380 8 Faustovirus(20.0%) NA NA
DBSCAN-SWA_194 3948264 : 3948696 1 Powai_lake_megavirus(100.0%) NA NA
DBSCAN-SWA_195 3957525 : 3962804 4 Bodo_saltans_virus(33.33%) NA NA
DBSCAN-SWA_196 3969980 : 3973980 4 Prochlorococcus_phage(33.33%) NA NA
DBSCAN-SWA_197 3996508 : 3997222 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_198 4016043 : 4016994 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_199 4036425 : 4040147 5 Deep-sea_thermophilic_phage(50.0%) NA NA
DBSCAN-SWA_200 4045763 : 4046555 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_201 4049572 : 4061266 11 Streptococcus_phage(40.0%) NA NA
DBSCAN-SWA_202 4064483 : 4130887 48 Stx2-converting_phage(33.33%) tRNA,transposase NA
DBSCAN-SWA_203 4134102 : 4144603 9 Stx2-converting_phage(40.0%) transposase NA
DBSCAN-SWA_204 4153158 : 4154295 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_205 4160772 : 4162290 1 Mollivirus(100.0%) NA NA
DBSCAN-SWA_206 4166501 : 4167275 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_207 4183105 : 4183705 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_208 4220494 : 4223515 3 Cronobacter_phage(33.33%) NA NA
DBSCAN-SWA_209 4230530 : 4284144 34 Shigella_phage(23.53%) tail,protease,transposase NA
DBSCAN-SWA_210 4290410 : 4291028 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_211 4303122 : 4310770 7 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_212 4316524 : 4320825 4 Clostridioides_phage(50.0%) NA NA
DBSCAN-SWA_213 4334573 : 4335431 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_214 4342608 : 4343277 1 Cellulophaga_phage(100.0%) NA NA
DBSCAN-SWA_215 4346971 : 4440659 86 Escherichia_phage(40.0%) head,tRNA,lysis,tail,portal,holin,plate,terminase,integrase,transposase,capsid attL 4389486:4389512|attR 4425246:4425272
DBSCAN-SWA_216 4444460 : 4445813 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_217 4450531 : 4461182 9 Catovirus(20.0%) NA NA
DBSCAN-SWA_218 4465426 : 4472220 6 Synechococcus_phage(25.0%) NA NA
DBSCAN-SWA_219 4477836 : 4484147 6 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_220 4491745 : 4548591 39 Acinetobacter_phage(22.22%) transposase NA
DBSCAN-SWA_221 4558996 : 4622913 55 Escherichia_phage(22.22%) tail,transposase NA
DBSCAN-SWA_222 4635127 : 4635880 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_223 4650435 : 4651592 1 Acinetobacter_phage(100.0%) transposase NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage