Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_AP022375 Providencia rettgeri strain BML2576 1 crisprs cas3,WYL,DEDDh,RT,csa3,DinG 1 1 3 0

Results visualization

1. NZ_AP022375
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP022375_1 1278951-1279075 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_AP022375_1 1.1|1278999|29|NZ_AP022375|CRISPRCasFinder 1278999-1279027 29 NZ_AP022375.1 1279300-1279328 0 1.0

1. spacer 1.1|1278999|29|NZ_AP022375|CRISPRCasFinder matches to position: 1279300-1279328, mismatch: 0, identity: 1.0

ccgcagcgttgttggctgcgtgctctcac	CRISPR spacer
ccgcagcgttgttggctgcgtgctctcac	Protospacer
*****************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_AP022375_1 1.1|1278999|29|NZ_AP022375|CRISPRCasFinder 1278999-1279027 29 NC_013930 Thioalkalivibrio sp. K90mix plasmid pTK9001, complete sequence 139169-139197 5 0.828

1. spacer 1.1|1278999|29|NZ_AP022375|CRISPRCasFinder matches to NC_013930 (Thioalkalivibrio sp. K90mix plasmid pTK9001, complete sequence) position: , mismatch: 5, identity: 0.828

ccgcagcgttgttggctgcgtgctctcac	CRISPR spacer
ccgctgcgttgttggctgcgggctgggac	Protospacer
**** *************** ***   **

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1658571 : 1736470 89 Cronobacter_phage(51.11%) terminase,integrase,holin,head,tRNA,tail,capsid,portal attL 1677771:1677816|attR 1707209:1707254
DBSCAN-SWA_2 2979286 : 3025141 40 Cronobacter_phage(50.0%) plate,protease NA
DBSCAN-SWA_3 3363389 : 3373970 11 Mycobacterium_phage(25.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage