Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_AP022373 Providencia rettgeri strain BML2531 1 crisprs WYL,DEDDh,csa3,cas3,DinG 0 0 7 0
NZ_AP022376 Providencia rettgeri strain BML2531 plasmid pBML2531, complete sequence 1 crisprs NA 0 1 1 0

Results visualization

1. NZ_AP022373
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP022373_1 1243565-1243721 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 585446 : 593879 8 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_2 1758794 : 1804040 59 Pectobacterium_phage(17.07%) integrase,tail,lysis,head,tRNA,terminase attL 1744039:1744052|attR 1765285:1765298
DBSCAN-SWA_3 1953928 : 2001484 82 Salmonella_phage(28.85%) terminase,capsid,lysis,integrase attL 1953074:1953133|attR 2001595:2001662
DBSCAN-SWA_4 2160231 : 2178928 30 Morganella_phage(25.0%) NA NA
DBSCAN-SWA_5 2182200 : 2196776 19 Morganella_phage(33.33%) tail,head,protease,portal,terminase,capsid NA
DBSCAN-SWA_6 3553957 : 3564538 11 Mycobacterium_phage(25.0%) NA NA
DBSCAN-SWA_7 3783630 : 3828021 63 Enterobacteria_phage(33.33%) integrase,tail,lysis,protease,portal,terminase attL 3783560:3783575|attR 3831903:3831918
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_AP022376
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP022376_1 10457-10590 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_AP022376_1 1.1|10496|56|NZ_AP022376|CRISPRCasFinder 10496-10551 56 NZ_AP022376 Providencia rettgeri strain BML2531 plasmid pBML2531, complete sequence 10496-10551 0 1.0
NZ_AP022376_1 1.1|10496|56|NZ_AP022376|CRISPRCasFinder 10496-10551 56 NZ_CP012903 Providencia rettgeri strain N15-01091 plasmid pNDM15-1091, complete sequence 11591-11646 0 1.0

1. spacer 1.1|10496|56|NZ_AP022376|CRISPRCasFinder matches to NZ_AP022376 (Providencia rettgeri strain BML2531 plasmid pBML2531, complete sequence) position: , mismatch: 0, identity: 1.0

gaccaatgatctaaataaacagttttcctttttagtatgaaaacccacccaaaagt	CRISPR spacer
gaccaatgatctaaataaacagttttcctttttagtatgaaaacccacccaaaagt	Protospacer
********************************************************

2. spacer 1.1|10496|56|NZ_AP022376|CRISPRCasFinder matches to NZ_CP012903 (Providencia rettgeri strain N15-01091 plasmid pNDM15-1091, complete sequence) position: , mismatch: 0, identity: 1.0

gaccaatgatctaaataaacagttttcctttttagtatgaaaacccacccaaaagt	CRISPR spacer
gaccaatgatctaaataaacagttttcctttttagtatgaaaacccacccaaaagt	Protospacer
********************************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 8521 : 55062 49 Escherichia_phage(27.78%) integrase,transposase attL 8470:8529|attR 54306:55125
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage