Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP048340 Escherichia coli strain 142 plasmid p142_C, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP048341 Escherichia coli strain 142 plasmid p142_D, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP048338 Escherichia coli strain 142 plasmid p142_A-OXA181, complete sequence 0 crisprs csa3 0 0 1 0
NZ_CP048342 Escherichia coli strain 142 plasmid p142_E, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP048343 Escherichia coli strain 142 plasmid p142_F, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP048337 Escherichia coli strain 142 chromosome, complete genome 7 crisprs RT,csa3,PD-DExK,cas3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2,DEDDh,DinG 2 23 9 0
NZ_CP048339 Escherichia coli strain 142 plasmid p142_B, complete sequence 0 crisprs DEDDh 0 0 0 0

Results visualization

1. NZ_CP048338
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1262 : 64054 58 Escherichia_phage(50.0%) transposase,protease,integrase NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP048340
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 9244 : 44051 43 Vibrio_phage(44.83%) plate,portal,terminase,protease,capsid,tail,head,holin NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP048337
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048337_1 1152290-1153235 Unclear I-E
15 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048337_2 1178782-1179604 TypeI-E I-E
13 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048337_3 2329034-2329157 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048337_4 3076341-3076432 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048337_5 3209380-3209527 Orphan I-F
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048337_6 4119676-4119811 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048337_7 4127249-4127390 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP048337_1 1.9|1152807|33|NZ_CP048337|PILER-CR,CRISPRCasFinder 1152807-1152839 33 NZ_CP048337.1 1132458-1132490 1 0.97
NZ_CP048337_1 1.24|1152808|32|NZ_CP048337|CRT 1152808-1152839 32 NZ_CP048337.1 1132458-1132489 1 0.969

1. spacer 1.9|1152807|33|NZ_CP048337|PILER-CR,CRISPRCasFinder matches to position: 1132458-1132490, mismatch: 1, identity: 0.97 

attccggctacttttgttgctccctgctcatcc	CRISPR spacer
attccagctacttttgttgctccctgctcatcc	Protospacer
*****.***************************

2. spacer 1.24|1152808|32|NZ_CP048337|CRT matches to position: 1132458-1132489, mismatch: 1, identity: 0.969 

ttccggctacttttgttgctccctgctcatcc	CRISPR spacer
ttccagctacttttgttgctccctgctcatcc	Protospacer
****.***************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP048337_4 4.1|3076367|40|NZ_CP048337|CRISPRCasFinder 3076367-3076406 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 0 1.0
NZ_CP048337_6 6.1|4119696|43|NZ_CP048337|PILER-CR 4119696-4119738 43 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141084-141126 0 1.0
NZ_CP048337_3 3.1|2329077|38|NZ_CP048337|CRISPRCasFinder 2329077-2329114 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
NZ_CP048337_2 2.10|1179360|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT 1179360-1179391 32 MF547662 Clostridioides phage LIBA6276, complete genome 37369-37400 4 0.875
NZ_CP048337_2 2.10|1179360|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT 1179360-1179391 32 MF547663 Clostridioides phage LIBA2945, complete genome 37369-37400 4 0.875
NZ_CP048337_2 2.2|1178872|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT 1178872-1178903 32 MK972713 Salmonella phage SW5, complete genome 27687-27718 5 0.844
NZ_CP048337_2 2.2|1178872|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT 1178872-1178903 32 MK972714 Salmonella phage SW3, complete genome 27909-27940 5 0.844
NZ_CP048337_2 2.2|1178872|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT 1178872-1178903 32 NC_049460 Salmonella phage SI7, complete genome 18129-18160 5 0.844
NZ_CP048337_2 2.10|1179360|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT 1179360-1179391 32 NZ_CP029155 Clostridioides difficile strain CD161 plasmid unnamed1, complete sequence 83504-83535 5 0.844
NZ_CP048337_2 2.3|1178933|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT 1178933-1178964 32 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 1203814-1203845 6 0.812
NZ_CP048337_2 2.3|1178933|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT 1178933-1178964 32 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 1167510-1167541 6 0.812
NZ_CP048337_7 7.1|4127301|38|NZ_CP048337|CRISPRCasFinder 4127301-4127338 38 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 24789-24826 6 0.842
NZ_CP048337_7 7.1|4127301|38|NZ_CP048337|CRISPRCasFinder 4127301-4127338 38 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 24902-24939 6 0.842
NZ_CP048337_7 7.1|4127301|38|NZ_CP048337|CRISPRCasFinder 4127301-4127338 38 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 4073-4110 6 0.842
NZ_CP048337_7 7.1|4127301|38|NZ_CP048337|CRISPRCasFinder 4127301-4127338 38 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 4072-4109 6 0.842
NZ_CP048337_7 7.1|4127301|38|NZ_CP048337|CRISPRCasFinder 4127301-4127338 38 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 4072-4109 6 0.842
NZ_CP048337_7 7.1|4127301|38|NZ_CP048337|CRISPRCasFinder 4127301-4127338 38 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 4072-4109 6 0.842
NZ_CP048337_1 1.19|1152502|32|NZ_CP048337|CRT 1152502-1152533 32 NC_018022 Mycolicibacterium chubuense NBB4 plasmid pMYCCH.01, complete sequence 373536-373567 7 0.781
NZ_CP048337_2 2.1|1178811|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT 1178811-1178842 32 LR597649 Escherichia phage ESSI2_ev015 genome assembly, chromosome: 1 17850-17881 7 0.781
NZ_CP048337_2 2.1|1178811|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT 1178811-1178842 32 NC_049393 Escherichia phage ESSI2_ev040 genome assembly, chromosome: 1 17628-17659 7 0.781
NZ_CP048337_2 2.1|1178811|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT 1178811-1178842 32 NC_049394 Escherichia phage ESSI2_ev129 genome assembly, chromosome: 1 17890-17921 7 0.781
NZ_CP048337_2 2.3|1178933|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT 1178933-1178964 32 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 1175642-1175673 7 0.781
NZ_CP048337_1 1.22|1152685|33|NZ_CP048337|CRT 1152685-1152717 33 NZ_CP020331 Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence 413541-413573 8 0.758
NZ_CP048337_1 1.27|1152991|32|NZ_CP048337|CRT 1152991-1153022 32 MN855615 Siphoviridae sp. isolate 320, complete genome 7076-7107 8 0.75
NZ_CP048337_1 1.27|1152991|32|NZ_CP048337|CRT 1152991-1153022 32 NC_034248 Rhizobium phage RHEph10, complete genome 31444-31475 8 0.75
NZ_CP048337_2 2.3|1178933|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT 1178933-1178964 32 NC_031109 Gordonia phage Jumbo, complete genome 25391-25422 8 0.75
NZ_CP048337_2 2.3|1178933|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT 1178933-1178964 32 NZ_CP050093 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence 398774-398805 8 0.75
NZ_CP048337_2 2.3|1178933|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT 1178933-1178964 32 NC_008384 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence 565533-565564 8 0.75
NZ_CP048337_2 2.3|1178933|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT 1178933-1178964 32 NZ_CP042332 Bosea sp. F3-2 plasmid pB32-1, complete sequence 63515-63546 8 0.75
NZ_CP048337_2 2.3|1178933|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT 1178933-1178964 32 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 350647-350678 8 0.75
NZ_CP048337_2 2.4|1178994|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT 1178994-1179025 32 CP022610 Escherichia coli strain ATCC 700415 plasmid unnamed, complete sequence 10541-10572 8 0.75
NZ_CP048337_2 2.5|1179055|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT 1179055-1179086 32 NZ_CP024236 Escherichia coli O6:H16 strain 2014EL-1346-6 plasmid unnamed4, complete sequence 57083-57114 8 0.75
NZ_CP048337_2 2.6|1179116|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT 1179116-1179147 32 MN694482 Marine virus AFVG_250M11, complete genome 1728-1759 8 0.75
NZ_CP048337_2 2.8|1179238|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT 1179238-1179269 32 NZ_CP008818 Ochrobactrum anthropi strain OAB plasmid 2, complete sequence 52227-52258 8 0.75
NZ_CP048337_2 2.8|1179238|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT 1179238-1179269 32 NC_009671 Ochrobactrum anthropi ATCC 49188 plasmid pOANT03, complete sequence 23638-23669 8 0.75
NZ_CP048337_7 7.1|4127301|38|NZ_CP048337|CRISPRCasFinder 4127301-4127338 38 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 3331-3368 8 0.789
NZ_CP048337_7 7.1|4127301|38|NZ_CP048337|CRISPRCasFinder 4127301-4127338 38 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 3330-3367 8 0.789
NZ_CP048337_7 7.1|4127301|38|NZ_CP048337|CRISPRCasFinder 4127301-4127338 38 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 3330-3367 8 0.789
NZ_CP048337_7 7.1|4127301|38|NZ_CP048337|CRISPRCasFinder 4127301-4127338 38 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 3330-3367 8 0.789
NZ_CP048337_1 1.7|1152684|34|NZ_CP048337|PILER-CR,CRISPRCasFinder 1152684-1152717 34 NZ_CP020331 Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence 413540-413573 9 0.735
NZ_CP048337_1 1.12|1152990|33|NZ_CP048337|PILER-CR,CRISPRCasFinder 1152990-1153022 33 MN855615 Siphoviridae sp. isolate 320, complete genome 7075-7107 9 0.727
NZ_CP048337_1 1.25|1152869|32|NZ_CP048337|CRT 1152869-1152900 32 NZ_CP016721 Lactococcus lactis subsp. lactis strain UC11 plasmid pUC11B, complete sequence 30466-30497 9 0.719
NZ_CP048337_1 1.25|1152869|32|NZ_CP048337|CRT 1152869-1152900 32 NZ_CP016727 Lactococcus lactis subsp. lactis strain UC08 plasmid pUC08B, complete sequence 30464-30495 9 0.719
NZ_CP048337_1 1.29|1153113|32|NZ_CP048337|CRT 1153113-1153144 32 MK448690 Streptococcus phage Javan169, complete genome 9831-9862 9 0.719
NZ_CP048337_1 1.29|1153113|32|NZ_CP048337|CRT 1153113-1153144 32 MK448854 Streptococcus phage Javan146, complete genome 11811-11842 9 0.719
NZ_CP048337_2 2.3|1178933|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT 1178933-1178964 32 NZ_CP017077 Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence 555186-555217 9 0.719
NZ_CP048337_2 2.3|1178933|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT 1178933-1178964 32 NZ_CP040819 Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence 471692-471723 9 0.719
NZ_CP048337_2 2.5|1179055|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT 1179055-1179086 32 NZ_CP053709 Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed1, complete sequence 137043-137074 9 0.719
NZ_CP048337_2 2.7|1179177|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT 1179177-1179208 32 MT446414 UNVERIFIED: Escherichia virus TH43, complete genome 38100-38131 9 0.719
NZ_CP048337_2 2.9|1179299|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT 1179299-1179330 32 MN812211 Flavobacterium phage vB_FspS_laban6-1, complete genome 21752-21783 9 0.719
NZ_CP048337_2 2.9|1179299|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT 1179299-1179330 32 NZ_CP012534 Psychrobacter sp. P11G5 plasmid pPspP11G5a, complete sequence 26937-26968 9 0.719
NZ_CP048337_2 2.10|1179360|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT 1179360-1179391 32 MN693584 Marine virus AFVG_25M163, complete genome 29591-29622 9 0.719
NZ_CP048337_2 2.10|1179360|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT 1179360-1179391 32 MN103543 Pseudomonas phage vB_PaeM_PS119XW, complete genome 258501-258532 9 0.719
NZ_CP048337_2 2.10|1179360|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT 1179360-1179391 32 MK599315 Pseudomonas phage PA1C, complete genome 257887-257918 9 0.719
NZ_CP048337_5 5.1|3209408|32|NZ_CP048337|CRISPRCasFinder 3209408-3209439 32 NZ_CP045060 Salmonella enterica subsp. enterica serovar Muenchen strain LG26 plasmid pLG26p1, complete sequence 9736-9767 9 0.719
NZ_CP048337_5 5.1|3209408|32|NZ_CP048337|CRISPRCasFinder 3209408-3209439 32 NZ_CP045053 Salmonella enterica subsp. enterica serovar Muenchen strain LG24 plasmid pLG24p1, complete sequence 9737-9768 9 0.719
NZ_CP048337_5 5.1|3209408|32|NZ_CP048337|CRISPRCasFinder 3209408-3209439 32 NZ_CP045057 Salmonella enterica subsp. enterica serovar Muenchen strain LG25 plasmid pLG25p1, complete sequence 9736-9767 9 0.719
NZ_CP048337_5 5.3|3209416|32|NZ_CP048337|PILER-CR 3209416-3209447 32 NZ_CP045060 Salmonella enterica subsp. enterica serovar Muenchen strain LG26 plasmid pLG26p1, complete sequence 9736-9767 9 0.719
NZ_CP048337_5 5.3|3209416|32|NZ_CP048337|PILER-CR 3209416-3209447 32 NZ_CP045053 Salmonella enterica subsp. enterica serovar Muenchen strain LG24 plasmid pLG24p1, complete sequence 9737-9768 9 0.719
NZ_CP048337_5 5.3|3209416|32|NZ_CP048337|PILER-CR 3209416-3209447 32 NZ_CP045057 Salmonella enterica subsp. enterica serovar Muenchen strain LG25 plasmid pLG25p1, complete sequence 9736-9767 9 0.719
NZ_CP048337_7 7.1|4127301|38|NZ_CP048337|CRISPRCasFinder 4127301-4127338 38 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 14114-14151 9 0.763
NZ_CP048337_7 7.1|4127301|38|NZ_CP048337|CRISPRCasFinder 4127301-4127338 38 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 51843-51880 9 0.763
NZ_CP048337_7 7.1|4127301|38|NZ_CP048337|CRISPRCasFinder 4127301-4127338 38 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229388-229425 9 0.763
NZ_CP048337_7 7.1|4127301|38|NZ_CP048337|CRISPRCasFinder 4127301-4127338 38 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239882-239919 9 0.763
NZ_CP048337_7 7.1|4127301|38|NZ_CP048337|CRISPRCasFinder 4127301-4127338 38 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230794-230831 9 0.763
NZ_CP048337_7 7.1|4127301|38|NZ_CP048337|CRISPRCasFinder 4127301-4127338 38 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211764-211801 9 0.763
NZ_CP048337_7 7.1|4127301|38|NZ_CP048337|CRISPRCasFinder 4127301-4127338 38 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 40383-40420 9 0.763
NZ_CP048337_7 7.1|4127301|38|NZ_CP048337|CRISPRCasFinder 4127301-4127338 38 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 313601-313638 9 0.763
NZ_CP048337_7 7.1|4127301|38|NZ_CP048337|CRISPRCasFinder 4127301-4127338 38 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 386517-386554 9 0.763
NZ_CP048337_7 7.1|4127301|38|NZ_CP048337|CRISPRCasFinder 4127301-4127338 38 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 397090-397127 9 0.763
NZ_CP048337_7 7.1|4127301|38|NZ_CP048337|CRISPRCasFinder 4127301-4127338 38 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 404135-404172 9 0.763
NZ_CP048337_7 7.1|4127301|38|NZ_CP048337|CRISPRCasFinder 4127301-4127338 38 NZ_CP044308 Escherichia coli strain C27A plasmid pC27A-3, complete sequence 114998-115035 9 0.763
NZ_CP048337_7 7.1|4127301|38|NZ_CP048337|CRISPRCasFinder 4127301-4127338 38 NZ_CP019246 Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence 40307-40344 9 0.763
NZ_CP048337_7 7.1|4127301|38|NZ_CP048337|CRISPRCasFinder 4127301-4127338 38 MT230112 Escherichia coli strain DH5alpha plasmid pESBL112, complete sequence 103-140 9 0.763
NZ_CP048337_7 7.1|4127301|38|NZ_CP048337|CRISPRCasFinder 4127301-4127338 38 NZ_AP023207 Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence 31308-31345 9 0.763
NZ_CP048337_7 7.1|4127301|38|NZ_CP048337|CRISPRCasFinder 4127301-4127338 38 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 8897-8934 9 0.763
NZ_CP048337_7 7.1|4127301|38|NZ_CP048337|CRISPRCasFinder 4127301-4127338 38 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 17901-17938 9 0.763
NZ_CP048337_2 2.9|1179299|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT 1179299-1179330 32 NZ_KX711616 Bacillus subtilis strain 72 plasmid pBS72, complete sequence 1474-1505 10 0.688
NZ_CP048337_7 7.1|4127301|38|NZ_CP048337|CRISPRCasFinder 4127301-4127338 38 NZ_CP044308 Escherichia coli strain C27A plasmid pC27A-3, complete sequence 56040-56077 10 0.737
NZ_CP048337_7 7.1|4127301|38|NZ_CP048337|CRISPRCasFinder 4127301-4127338 38 NZ_CP053046 Escherichia fergusonii strain HNCF11W plasmid pHNCF11W-130kb, complete sequence 58275-58312 10 0.737
NZ_CP048337_7 7.1|4127301|38|NZ_CP048337|CRISPRCasFinder 4127301-4127338 38 NZ_CP010208 Escherichia coli strain M11 plasmid B, complete sequence 30215-30252 10 0.737
NZ_CP048337_2 2.9|1179299|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT 1179299-1179330 32 NC_023026 Francisella novicida strain PA10-7858 plasmid pFNPA10, complete sequence 2981-3012 11 0.656

1. spacer 4.1|3076367|40|NZ_CP048337|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 0, identity: 1.0 

gcgctgcgggtcattcttgaaattacccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
****************************************

2. spacer 6.1|4119696|43|NZ_CP048337|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 0, identity: 1.0 

tgtcacacgcagataaatccaactttcaatattgttaagttcc	CRISPR spacer
tgtcacacgcagataaatccaactttcaatattgttaagttcc	Protospacer
*******************************************

3. spacer 3.1|2329077|38|NZ_CP048337|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947 

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

4. spacer 2.10|1179360|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT matches to MF547662 (Clostridioides phage LIBA6276, complete genome) position: , mismatch: 4, identity: 0.875 

tacagtttccataaattcacctcgtttatata-	CRISPR spacer
tactgtttccataaattcacctc-cttataaaa	Protospacer
*** ******************* .***** *

5. spacer 2.10|1179360|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT matches to MF547663 (Clostridioides phage LIBA2945, complete genome) position: , mismatch: 4, identity: 0.875 

tacagtttccataaattcacctcgtttatata-	CRISPR spacer
tactgtttccataaattcacctc-cttataaaa	Protospacer
*** ******************* .***** *

6. spacer 2.2|1178872|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT matches to MK972713 (Salmonella phage SW5, complete genome) position: , mismatch: 5, identity: 0.844 

gaccagtcgggccagacatcggggacgcagaa	CRISPR spacer
gaccagtcgggccagacatcgagcacggccaa	Protospacer
*********************.* ***   **

7. spacer 2.2|1178872|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT matches to MK972714 (Salmonella phage SW3, complete genome) position: , mismatch: 5, identity: 0.844 

gaccagtcgggccagacatcggggacgcagaa	CRISPR spacer
gaccagtcgggccagacatcgagcacggccaa	Protospacer
*********************.* ***   **

8. spacer 2.2|1178872|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT matches to NC_049460 (Salmonella phage SI7, complete genome) position: , mismatch: 5, identity: 0.844 

gaccagtcgggccagacatcggggacgcagaa	CRISPR spacer
gaccagtcgggccagacatcgagcacggccaa	Protospacer
*********************.* ***   **

9. spacer 2.10|1179360|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029155 (Clostridioides difficile strain CD161 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.844 

tacagtttccataaattcacctcgtttatata-	CRISPR spacer
tactgtttccataaattcacctc-cctataaaa	Protospacer
*** ******************* ..**** *

10. spacer 2.3|1178933|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 6, identity: 0.812 

ccgaccgccatcgcgcatttcgtcgaacgtcg	CRISPR spacer
cacgcggccatcgcgcagttcgtcgaacgccg	Protospacer
*  .* *********** ***********.**

11. spacer 2.3|1178933|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 6, identity: 0.812 

ccgaccgccatcgcgcatttcgtcgaacgtcg	CRISPR spacer
gcgttcgccatcgcgcatttcgtccatcgttg	Protospacer
 ** .******************* * ***.*

12. spacer 7.1|4127301|38|NZ_CP048337|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 6, identity: 0.842 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
ttgatgtcggatgcggcgtaaacgccttatccgaccta	Protospacer
* * *************.**************.***..

13. spacer 7.1|4127301|38|NZ_CP048337|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 6, identity: 0.842 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
ttgatgtcggatgcggcgtaaacgccttatccgaccta	Protospacer
* * *************.**************.***..

14. spacer 7.1|4127301|38|NZ_CP048337|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 6, identity: 0.842 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
taactgccggatgcggcataaacgccttatccggccta	Protospacer
**.***.*************************..**..

15. spacer 7.1|4127301|38|NZ_CP048337|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 6, identity: 0.842 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
taactgccggatgcggcataaacgccttatccggccta	Protospacer
**.***.*************************..**..

16. spacer 7.1|4127301|38|NZ_CP048337|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 6, identity: 0.842 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
taactgccggatgcggcataaacgccttatccggccta	Protospacer
**.***.*************************..**..

17. spacer 7.1|4127301|38|NZ_CP048337|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 6, identity: 0.842 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
taactgccggatgcggcataaacgccttatccggccta	Protospacer
**.***.*************************..**..

18. spacer 1.19|1152502|32|NZ_CP048337|CRT matches to NC_018022 (Mycolicibacterium chubuense NBB4 plasmid pMYCCH.01, complete sequence) position: , mismatch: 7, identity: 0.781 

aatggcgctgccgatcgacaaatgggacctgg-	CRISPR spacer
gatggcgatgccgatggacaaat-gcacatgct	Protospacer
.****** ******* ******* * ** **

19. spacer 2.1|1178811|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT matches to LR597649 (Escherichia phage ESSI2_ev015 genome assembly, chromosome: 1) position: , mismatch: 7, identity: 0.781 

caaacgtcaggcggaagtgttccggtcatata	CRISPR spacer
aaaggctcaggctgaagtgttccggtcttaca	Protospacer
 **.  ****** ************** **.*

20. spacer 2.1|1178811|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT matches to NC_049393 (Escherichia phage ESSI2_ev040 genome assembly, chromosome: 1) position: , mismatch: 7, identity: 0.781 

caaacgtcaggcggaagtgttccggtcatata	CRISPR spacer
aaaggctcaggctgaagtgttccggtcttaca	Protospacer
 **.  ****** ************** **.*

21. spacer 2.1|1178811|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT matches to NC_049394 (Escherichia phage ESSI2_ev129 genome assembly, chromosome: 1) position: , mismatch: 7, identity: 0.781 

caaacgtcaggcggaagtgttccggtcatata	CRISPR spacer
aaaggctcaggctgaagtgttccggtcttaca	Protospacer
 **.  ****** ************** **.*

22. spacer 2.3|1178933|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 7, identity: 0.781 

ccgaccgccatcgcgcatttcgtcgaacgtcg	CRISPR spacer
gcgttcgccatcgcgcatttcgtccatcgctg	Protospacer
 ** .******************* * **..*

23. spacer 1.22|1152685|33|NZ_CP048337|CRT matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 8, identity: 0.758 

cgggagccagtgctaacgatatcgcggccgcgc	CRISPR spacer
ggcgcggcagcgcgaacgatatcgcggccgccg	Protospacer
 * * * ***.** *****************

24. spacer 1.27|1152991|32|NZ_CP048337|CRT matches to MN855615 (Siphoviridae sp. isolate 320, complete genome) position: , mismatch: 8, identity: 0.75 

gccgcgtacatcaacgcagcagcaagcgcata	CRISPR spacer
ccactgcccatcaaagcaccagcaagcgcata	Protospacer
 *  .*. ****** *** *************

25. spacer 1.27|1152991|32|NZ_CP048337|CRT matches to NC_034248 (Rhizobium phage RHEph10, complete genome) position: , mismatch: 8, identity: 0.75 

gccgcgtacatcaacgcagcagcaagcgcata	CRISPR spacer
accgcggccatcaacgcagcagcataaggaga	Protospacer
.*****  **************** . * * *

26. spacer 2.3|1178933|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT matches to NC_031109 (Gordonia phage Jumbo, complete genome) position: , mismatch: 8, identity: 0.75 

ccgaccgccatcgcgcatttcgtcgaacgtcg	CRISPR spacer
gacaataccatcgcggattttgtcgaacgtcg	Protospacer
   * ..******** ****.***********

27. spacer 2.3|1178933|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050093 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgaccgccatcgcgcatttcgtcgaacgtcg	CRISPR spacer
tctgacggcatcgcgcatttcggcgaacgcct	Protospacer
.* . ** ************** ******.*

28. spacer 2.3|1178933|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT matches to NC_008384 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgaccgccatcgcgcatttcgtcgaacgtcg	CRISPR spacer
tctgacggcatcgcgcatttcggcgaacgcct	Protospacer
.* . ** ************** ******.*

29. spacer 2.3|1178933|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042332 (Bosea sp. F3-2 plasmid pB32-1, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgaccgccatcgcgcatttcgtcgaacgtcg	CRISPR spacer
cacgacgccgtcgcgcatttcgtcgaccgcct	Protospacer
*  . ****.**************** **.*

30. spacer 2.3|1178933|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 8, identity: 0.75 

ccgaccgccatcgcgcatttcgtcgaacgtcg	CRISPR spacer
gccgccgccatcgcgcaattcggcgaatatgg	Protospacer
 * .************* **** ****..* *

31. spacer 2.4|1178994|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT matches to CP022610 (Escherichia coli strain ATCC 700415 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

caaaaaaataatatccggcagtctgtacggta	CRISPR spacer
aagaaaaatcatatccggcagtctttagcgag	Protospacer
 *.****** ************** **  * .

32. spacer 2.5|1179055|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024236 (Escherichia coli O6:H16 strain 2014EL-1346-6 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75 

-caacattttccaatatcacccagcaatcaatt	CRISPR spacer
gtaac-ttttctaatatcacccagcactccggg	Protospacer
 .*** *****.************** ** .

33. spacer 2.6|1179116|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT matches to MN694482 (Marine virus AFVG_250M11, complete genome) position: , mismatch: 8, identity: 0.75 

tcatgaaggcttcgattatttcttgatacctg	CRISPR spacer
tcattaaggcttcgattttttctagtttagtt	Protospacer
**** ************ ***** * *   *

34. spacer 2.8|1179238|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP008818 (Ochrobactrum anthropi strain OAB plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.75 

-caataacaccggcatttgtccacgacaatatt	CRISPR spacer
tcggcgacg-cggcatttgtccacgacacaatt	Protospacer
 *....**. ******************  ***

35. spacer 2.8|1179238|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT matches to NC_009671 (Ochrobactrum anthropi ATCC 49188 plasmid pOANT03, complete sequence) position: , mismatch: 8, identity: 0.75 

-caataacaccggcatttgtccacgacaatatt	CRISPR spacer
tcggcgacg-cggcatttgtccacgacacaatt	Protospacer
 *....**. ******************  ***

36. spacer 7.1|4127301|38|NZ_CP048337|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 8, identity: 0.789 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
caactgccggatgcggcgtaaacgccttatccgtccta	Protospacer
.*.***.**********.**************. **..

37. spacer 7.1|4127301|38|NZ_CP048337|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 8, identity: 0.789 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
caactgccggatgcggcgtaaacgccttatccgtccta	Protospacer
.*.***.**********.**************. **..

38. spacer 7.1|4127301|38|NZ_CP048337|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 8, identity: 0.789 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
caactgccggatgcggcgtaaacgccttatccgtccta	Protospacer
.*.***.**********.**************. **..

39. spacer 7.1|4127301|38|NZ_CP048337|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 8, identity: 0.789 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
caactgccggatgcggcgtaaacgccttatccgtccta	Protospacer
.*.***.**********.**************. **..

40. spacer 1.7|1152684|34|NZ_CP048337|PILER-CR,CRISPRCasFinder matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 9, identity: 0.735 

gcgggagccagtgctaacgatatcgcggccgcgc	CRISPR spacer
cggcgcggcagcgcgaacgatatcgcggccgccg	Protospacer
  * * * ***.** *****************

41. spacer 1.12|1152990|33|NZ_CP048337|PILER-CR,CRISPRCasFinder matches to MN855615 (Siphoviridae sp. isolate 320, complete genome) position: , mismatch: 9, identity: 0.727 

ggccgcgtacatcaacgcagcagcaagcgcata	CRISPR spacer
accactgcccatcaaagcaccagcaagcgcata	Protospacer
. *  .*. ****** *** *************

42. spacer 1.25|1152869|32|NZ_CP048337|CRT matches to NZ_CP016721 (Lactococcus lactis subsp. lactis strain UC11 plasmid pUC11B, complete sequence) position: , mismatch: 9, identity: 0.719 

aatatttacttggatgcgtcggacattgaatc	CRISPR spacer
tttcatgacttgaatgcgtaggacattgaaag	Protospacer
  *  * *****.****** **********

43. spacer 1.25|1152869|32|NZ_CP048337|CRT matches to NZ_CP016727 (Lactococcus lactis subsp. lactis strain UC08 plasmid pUC08B, complete sequence) position: , mismatch: 9, identity: 0.719 

aatatttacttggatgcgtcggacattgaatc	CRISPR spacer
tttcatgacttgaatgcgtaggacattgaaag	Protospacer
  *  * *****.****** **********

44. spacer 1.29|1153113|32|NZ_CP048337|CRT matches to MK448690 (Streptococcus phage Javan169, complete genome) position: , mismatch: 9, identity: 0.719 

tcaacgaaaacgcagagcgaggaacggatatt	CRISPR spacer
aagagcaaaacggagagcgagaaacggatttc	Protospacer
  .*  ****** ********.******* *.

45. spacer 1.29|1153113|32|NZ_CP048337|CRT matches to MK448854 (Streptococcus phage Javan146, complete genome) position: , mismatch: 9, identity: 0.719 

tcaacgaaaacgcagagcgaggaacggatatt	CRISPR spacer
aagagcaaaacggagagcgagaaacggatttc	Protospacer
  .*  ****** ********.******* *.

46. spacer 2.3|1178933|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017077 (Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgaccgccatcgcgcatttcgtcgaacgtcg	CRISPR spacer
tcgaccggcatcgcgcagttcgtcgctgagag	Protospacer
.****** ********* *******   .  *

47. spacer 2.3|1178933|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040819 (Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgaccgccatcgcgcatttcgtcgaacgtcg	CRISPR spacer
gagaccggcatcgcgcatttcctcgagcacat	Protospacer
  ***** ************* ****.*..

48. spacer 2.5|1179055|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053709 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

caacattttccaatatcacccagcaatcaatt	CRISPR spacer
gattgccttccaatatcagccagctatcaaat	Protospacer
 * ....*********** ***** ***** *

49. spacer 2.7|1179177|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT matches to MT446414 (UNVERIFIED: Escherichia virus TH43, complete genome) position: , mismatch: 9, identity: 0.719 

atttcattaattttgcagagaagtgtctcgaa	CRISPR spacer
atttcatcaactttgcagagaaggaaatttat	Protospacer
*******.**.************ .  *. *

50. spacer 2.9|1179299|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT matches to MN812211 (Flavobacterium phage vB_FspS_laban6-1, complete genome) position: , mismatch: 9, identity: 0.719 

gcgtaagaaaacaattttttcagaaaactaac	CRISPR spacer
aaataagaaaacaattttttcttaaaaaagat	Protospacer
. .******************  ****  .*.

51. spacer 2.9|1179299|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012534 (Psychrobacter sp. P11G5 plasmid pPspP11G5a, complete sequence) position: , mismatch: 9, identity: 0.719 

gcgtaagaaaacaattttttcag---aaaactaac	CRISPR spacer
gcgtaagaaaacagtttttccagttccagatg---	Protospacer
*************.*****.***    *.*.

52. spacer 2.10|1179360|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT matches to MN693584 (Marine virus AFVG_25M163, complete genome) position: , mismatch: 9, identity: 0.719 

tacagtttccataaattcacctcgtttatata	CRISPR spacer
ggggatatctataaactcacctcgtttatatt	Protospacer
 . ..* **.*****.***************

53. spacer 2.10|1179360|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT matches to MN103543 (Pseudomonas phage vB_PaeM_PS119XW, complete genome) position: , mismatch: 9, identity: 0.719 

tacagtttccataaattcacctcgtttatata	CRISPR spacer
cgcttcttccatacattcacctcggttatgga	Protospacer
..*  .******* ********** ****. *

54. spacer 2.10|1179360|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT matches to MK599315 (Pseudomonas phage PA1C, complete genome) position: , mismatch: 9, identity: 0.719 

tacagtttccataaattcacctcgtttatata	CRISPR spacer
cgcttcttccatacattcacctcggttatgga	Protospacer
..*  .******* ********** ****. *

55. spacer 5.1|3209408|32|NZ_CP048337|CRISPRCasFinder matches to NZ_CP045060 (Salmonella enterica subsp. enterica serovar Muenchen strain LG26 plasmid pLG26p1, complete sequence) position: , mismatch: 9, identity: 0.719 

atggtgggcgggtggagtatgttaccagtgaa	CRISPR spacer
acaccgggcgggtggaacatgttaccaggaca	Protospacer
*.. .***********..********** . *

56. spacer 5.1|3209408|32|NZ_CP048337|CRISPRCasFinder matches to NZ_CP045053 (Salmonella enterica subsp. enterica serovar Muenchen strain LG24 plasmid pLG24p1, complete sequence) position: , mismatch: 9, identity: 0.719 

atggtgggcgggtggagtatgttaccagtgaa	CRISPR spacer
acaccgggcgggtggaacatgttaccaggaca	Protospacer
*.. .***********..********** . *

57. spacer 5.1|3209408|32|NZ_CP048337|CRISPRCasFinder matches to NZ_CP045057 (Salmonella enterica subsp. enterica serovar Muenchen strain LG25 plasmid pLG25p1, complete sequence) position: , mismatch: 9, identity: 0.719 

atggtgggcgggtggagtatgttaccagtgaa	CRISPR spacer
acaccgggcgggtggaacatgttaccaggaca	Protospacer
*.. .***********..********** . *

58. spacer 5.3|3209416|32|NZ_CP048337|PILER-CR matches to NZ_CP045060 (Salmonella enterica subsp. enterica serovar Muenchen strain LG26 plasmid pLG26p1, complete sequence) position: , mismatch: 9, identity: 0.719 

atggtgggcgggtggagtatgttaccagtgaa	CRISPR spacer
acaccgggcgggtggaacatgttaccaggaca	Protospacer
*.. .***********..********** . *

59. spacer 5.3|3209416|32|NZ_CP048337|PILER-CR matches to NZ_CP045053 (Salmonella enterica subsp. enterica serovar Muenchen strain LG24 plasmid pLG24p1, complete sequence) position: , mismatch: 9, identity: 0.719 

atggtgggcgggtggagtatgttaccagtgaa	CRISPR spacer
acaccgggcgggtggaacatgttaccaggaca	Protospacer
*.. .***********..********** . *

60. spacer 5.3|3209416|32|NZ_CP048337|PILER-CR matches to NZ_CP045057 (Salmonella enterica subsp. enterica serovar Muenchen strain LG25 plasmid pLG25p1, complete sequence) position: , mismatch: 9, identity: 0.719 

atggtgggcgggtggagtatgttaccagtgaa	CRISPR spacer
acaccgggcgggtggaacatgttaccaggaca	Protospacer
*.. .***********..********** . *

61. spacer 7.1|4127301|38|NZ_CP048337|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
tgattgccggatgcggcgtaaacgccttatccggccta	Protospacer
*...**.**********.**************..**..

62. spacer 7.1|4127301|38|NZ_CP048337|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
ctggtgccggatgcggcgtaaacgccttatccggccta	Protospacer
. * **.**********.**************..**..

63. spacer 7.1|4127301|38|NZ_CP048337|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
cgactgccggatgcggcgtaaacgccttatccggccta	Protospacer
...***.**********.**************..**..

64. spacer 7.1|4127301|38|NZ_CP048337|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
cgactgccggatgcggcgtaaacgccttatccggccta	Protospacer
...***.**********.**************..**..

65. spacer 7.1|4127301|38|NZ_CP048337|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
cgactgccggatgcggcgtaaacgccttatccggccta	Protospacer
...***.**********.**************..**..

66. spacer 7.1|4127301|38|NZ_CP048337|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
cgactgccggatgcggcgtaaacgccttatccggccta	Protospacer
...***.**********.**************..**..

67. spacer 7.1|4127301|38|NZ_CP048337|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
tttttgccggatgcggcgtaaacgccttatccggccta	Protospacer
*  .**.**********.**************..**..

68. spacer 7.1|4127301|38|NZ_CP048337|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
aaaatgccggatgcggcgtaaacgccttatccggccta	Protospacer
 *. **.**********.**************..**..

69. spacer 7.1|4127301|38|NZ_CP048337|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
caagtgccggatgcggcgtaaacgccttatccggccta	Protospacer
.*. **.**********.**************..**..

70. spacer 7.1|4127301|38|NZ_CP048337|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
caattgccggatgcggcgtaaacgccttatccggccta	Protospacer
.*..**.**********.**************..**..

71. spacer 7.1|4127301|38|NZ_CP048337|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
ttcttgccggatgcggcgtaaacgccttatccggccta	Protospacer
*  .**.**********.**************..**..

72. spacer 7.1|4127301|38|NZ_CP048337|CRISPRCasFinder matches to NZ_CP044308 (Escherichia coli strain C27A plasmid pC27A-3, complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
ccactgccggatgcggcgtaaacgccttatccgtccta	Protospacer
. .***.**********.**************. **..

73. spacer 7.1|4127301|38|NZ_CP048337|CRISPRCasFinder matches to NZ_CP019246 (Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
tttatgccggatgcggcgtaaacgccttatccggccta	Protospacer
*   **.**********.**************..**..

74. spacer 7.1|4127301|38|NZ_CP048337|CRISPRCasFinder matches to MT230112 (Escherichia coli strain DH5alpha plasmid pESBL112, complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
atgttgccggatgcggcgtaaacgccttatccggccta	Protospacer
  *.**.**********.**************..**..

75. spacer 7.1|4127301|38|NZ_CP048337|CRISPRCasFinder matches to NZ_AP023207 (Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
caaatgccggatgcggcgtaaacgccttatccggccta	Protospacer
.*. **.**********.**************..**..

76. spacer 7.1|4127301|38|NZ_CP048337|CRISPRCasFinder matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
cggttgccggatgcggcgtaaacgccttatccggccta	Protospacer
..*.**.**********.**************..**..

77. spacer 7.1|4127301|38|NZ_CP048337|CRISPRCasFinder matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
gacttgccggatgcggcgtaaacgccttatccggccac	Protospacer
 * .**.**********.**************..**

78. spacer 2.9|1179299|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KX711616 (Bacillus subtilis strain 72 plasmid pBS72, complete sequence) position: , mismatch: 10, identity: 0.688 

gcgtaagaaaacaattttttcagaaaactaac	CRISPR spacer
gacaaagaaaacaatcttttaagaaaagcttt	Protospacer
*   ***********.**** ****** .  .

79. spacer 7.1|4127301|38|NZ_CP048337|CRISPRCasFinder matches to NZ_CP044308 (Escherichia coli strain C27A plasmid pC27A-3, complete sequence) position: , mismatch: 10, identity: 0.737 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
ccattgccggatgcggcgtaaacgccttatccggccta	Protospacer
. ..**.**********.**************..**..

80. spacer 7.1|4127301|38|NZ_CP048337|CRISPRCasFinder matches to NZ_CP053046 (Escherichia fergusonii strain HNCF11W plasmid pHNCF11W-130kb, complete sequence) position: , mismatch: 10, identity: 0.737 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
aggttgccggatgcggcgtaaacgccttatccggcata	Protospacer
 .*.**.**********.**************..* ..

81. spacer 7.1|4127301|38|NZ_CP048337|CRISPRCasFinder matches to NZ_CP010208 (Escherichia coli strain M11 plasmid B, complete sequence) position: , mismatch: 10, identity: 0.737 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
caaatgccggatgcggcgtaaacgccttatctggccta	Protospacer
.*. **.**********.*************...**..

82. spacer 2.9|1179299|32|NZ_CP048337|PILER-CR,CRISPRCasFinder,CRT matches to NC_023026 (Francisella novicida strain PA10-7858 plasmid pFNPA10, complete sequence) position: , mismatch: 11, identity: 0.656 

gcgtaagaaaacaattttttcagaaaactaac	CRISPR spacer
acgaaagaaaacaactttttcagagtggcgtt	Protospacer
.** **********.*********. . .. .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 852729 : 858281 9 Stx2-converting_phage(42.86%) transposase NA
DBSCAN-SWA_2 1811361 : 1820803 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_3 2398490 : 2467464 82 Enterobacteria_phage(41.51%) integrase,lysis,tail,protease,terminase,portal attL 2406066:2406082|attR 2436807:2436823
DBSCAN-SWA_4 2723343 : 2789933 76 Enterobacteria_phage(36.54%) integrase,holin,tail,lysis,protease,terminase,capsid,head,transposase,portal attL 2740688:2740715|attR 2790070:2790097
DBSCAN-SWA_5 3194457 : 3283826 90 Salmonella_phage(60.71%) integrase,tail,lysis,protease,terminase,tRNA,plate,capsid,head,portal attL 3249522:3249548|attR 3283901:3283927
DBSCAN-SWA_6 3899940 : 3965758 56 Shigella_phage(11.11%) protease,plate,tRNA,transposase NA
DBSCAN-SWA_7 4148736 : 4241965 98 Enterobacteria_phage(40.0%) integrase,tail,lysis,protease,terminase,tRNA,transposase,portal attL 4199051:4199066|attR 4245644:4245659
DBSCAN-SWA_8 4594187 : 4649075 68 Escherichia_phage(33.33%) integrase,holin,tail,lysis,protease,terminase,tRNA,capsid,head,transposase,portal attL 4594749:4594764|attR 4616002:4616017
DBSCAN-SWA_9 4666787 : 4683308 22 Burkholderia_phage(33.33%) tail,plate NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage