Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP048436 Flavonifractor plautii strain JCM 32125 chromosome, complete genome 1 crisprs RT,PD-DExK,WYL,csa3,cas14j,DinG,DEDDh,cas3,cas5,cas8c,cas7,cas4,cas1,cas2 0 1 9 2

Results visualization

1. NZ_CP048436
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048436_1 2513016-2513456 TypeI I-C
6 spacers
cas2,cas1,cas4,cas7,cas8c,cas5,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP048436_1 1.4|2513252|34|NZ_CP048436|PILER-CR,CRISPRCasFinder,CRT 2513252-2513285 34 NC_006569 Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence 35336-35369 11 0.676

1. spacer 1.4|2513252|34|NZ_CP048436|PILER-CR,CRISPRCasFinder,CRT matches to NC_006569 (Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence) position: , mismatch: 11, identity: 0.676

acctgggatatggcccagcgcgtcaagccgctgc	CRISPR spacer
gttcaggatatggccctgcgcgtccagccgggca	Protospacer
.....*********** ******* *****    

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1008812 : 1063558 53 Prochlorococcus_phage(22.22%) integrase,transposase attL 1008699:1008758|attR 1048665:1049713
DBSCAN-SWA_2 1119975 : 1161924 43 Paenibacillus_phage(25.0%) integrase,tRNA,transposase attL 1113020:1113035|attR 1166458:1166473
DBSCAN-SWA_3 1380999 : 1394631 11 Clostridium_phage(11.11%) terminase NA
DBSCAN-SWA_4 1723682 : 1773042 55 Paenibacillus_phage(33.33%) transposase NA
DBSCAN-SWA_5 2026286 : 2051781 22 Paenibacillus_phage(33.33%) integrase,transposase attL 2020584:2020599|attR 2057631:2057646
DBSCAN-SWA_6 2174660 : 2201292 36 Paenibacillus_phage(25.0%) transposase,capsid,head,tail,protease,terminase,portal NA
DBSCAN-SWA_7 3034558 : 3086386 48 Paenibacillus_phage(26.67%) integrase,transposase attL 3080256:3080315|attR 3090285:3091641
DBSCAN-SWA_8 3264799 : 3311460 39 Clostridioides_phage(16.67%) tail,integrase,holin,transposase attL 3264790:3264849|attR 3318437:3319485
DBSCAN-SWA_9 3520286 : 3563461 48 Clostridium_phage(25.0%) holin,transposase,plate,capsid,head,tail NA
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_CP048436.1|WP_009260171.1|1715440_1715938_+|hypothetical-protein 1715440_1715938_+ 165 aa aa 51 NA NA No NA
NZ_CP048436.1|WP_163390338.1|2160767_2161265_-|hypothetical-protein 2160767_2161265_- 165 aa aa 51 NA NA No NA