Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP048598 Klebsiella aerogenes strain AUH-KAM-9 chromosome, complete genome 4 crisprs DEDDh,csa3,cas3,RT,WYL,DinG 2 2 2 0

Results visualization

1. NZ_CP048598
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048598_1 991954-992068 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048598_2 1188031-1188168 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048598_3 2786592-2786732 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048598_4 3442785-3442857 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP048598_4 4.1|3442809|25|NZ_CP048598|CRISPRCasFinder 3442809-3442833 25 NZ_CP048598.1 2365268-2365292 1 0.96
NZ_CP048598_4 4.1|3442809|25|NZ_CP048598|CRISPRCasFinder 3442809-3442833 25 NZ_CP048598.1 1462343-1462367 1 0.96
NZ_CP048598_4 4.1|3442809|25|NZ_CP048598|CRISPRCasFinder 3442809-3442833 25 NZ_CP048598.1 2172398-2172422 1 0.96
NZ_CP048598_3 3.1|2786646|33|NZ_CP048598|CRISPRCasFinder 2786646-2786678 33 NZ_CP048598.1 4906169-4906201 2 0.939

1. spacer 4.1|3442809|25|NZ_CP048598|CRISPRCasFinder matches to position: 2365268-2365292, mismatch: 1, identity: 0.96

ggctacccgcggtgccgttttttgt	CRISPR spacer
ggctacccgcggtgtcgttttttgt	Protospacer
**************.**********

2. spacer 4.1|3442809|25|NZ_CP048598|CRISPRCasFinder matches to position: 1462343-1462367, mismatch: 1, identity: 0.96

ggctacccgcggtgccgttttttgt	CRISPR spacer
ggctacccgcggtaccgttttttgt	Protospacer
*************.***********

3. spacer 4.1|3442809|25|NZ_CP048598|CRISPRCasFinder matches to position: 2172398-2172422, mismatch: 1, identity: 0.96

ggctacccgcggtgccgttttttgt	CRISPR spacer
ggctactcgcggtgccgttttttgt	Protospacer
******.******************

4. spacer 3.1|2786646|33|NZ_CP048598|CRISPRCasFinder matches to position: 4906169-4906201, mismatch: 2, identity: 0.939

cggtggcgctagtgcttaccggggctacagcgc	CRISPR spacer
cggtggcgctggcgcttaccggggctacagcgc	Protospacer
**********.*.********************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP048598_4 4.1|3442809|25|NZ_CP048598|CRISPRCasFinder 3442809-3442833 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 323589-323613 2 0.92
NZ_CP048598_4 4.1|3442809|25|NZ_CP048598|CRISPRCasFinder 3442809-3442833 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 324019-324043 2 0.92
NZ_CP048598_3 3.1|2786646|33|NZ_CP048598|CRISPRCasFinder 2786646-2786678 33 LR134132 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 12 99081-99113 3 0.909
NZ_CP048598_4 4.1|3442809|25|NZ_CP048598|CRISPRCasFinder 3442809-3442833 25 LR134122 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2 447689-447713 3 0.88
NZ_CP048598_3 3.1|2786646|33|NZ_CP048598|CRISPRCasFinder 2786646-2786678 33 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 323506-323538 4 0.879
NZ_CP048598_4 4.1|3442809|25|NZ_CP048598|CRISPRCasFinder 3442809-3442833 25 LR134122 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2 447528-447552 4 0.84
NZ_CP048598_3 3.1|2786646|33|NZ_CP048598|CRISPRCasFinder 2786646-2786678 33 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 583050-583082 6 0.818

1. spacer 4.1|3442809|25|NZ_CP048598|CRISPRCasFinder matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

ggctacccgcggtgccgttttttgt	CRISPR spacer
atctacccgcggtgccgttttttgt	Protospacer
. ***********************

2. spacer 4.1|3442809|25|NZ_CP048598|CRISPRCasFinder matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

ggctacccgcggtgccgttttttgt	CRISPR spacer
ggctacccgcggtgccgtttttttg	Protospacer
***********************  

3. spacer 3.1|2786646|33|NZ_CP048598|CRISPRCasFinder matches to LR134132 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 12) position: , mismatch: 3, identity: 0.909

cggtggcgctagtgcttaccggggctacagcgc-	CRISPR spacer
cggtggcgctagcgcttaccggggctac-gcact	Protospacer
************.*************** **.* 

4. spacer 4.1|3442809|25|NZ_CP048598|CRISPRCasFinder matches to LR134122 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2) position: , mismatch: 3, identity: 0.88

ggctacccgcggtgccgttttttgt	CRISPR spacer
cactactcgcggtgccgttttttgt	Protospacer
 .****.******************

5. spacer 3.1|2786646|33|NZ_CP048598|CRISPRCasFinder matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.879

cggtggcgctagtgcttaccggggctacagcgc	CRISPR spacer
cggtggcgctaccgcttaccggggctacaacac	Protospacer
*********** .****************.*.*

6. spacer 4.1|3442809|25|NZ_CP048598|CRISPRCasFinder matches to LR134122 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2) position: , mismatch: 4, identity: 0.84

ggctacccgcggtgccgttttttgt	CRISPR spacer
cgctactcgcggtgccgtttttttg	Protospacer
 *****.****************  

7. spacer 3.1|2786646|33|NZ_CP048598|CRISPRCasFinder matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.818

cggtggcgctagtgcttaccggggctacagcgc	CRISPR spacer
cggtggcgctaacgcttaccggggctaccaacc	Protospacer
***********..*************** .  *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 4688372 : 4693732 6 Escherichia_phage(50.0%) tRNA NA
DBSCAN-SWA_2 4766744 : 4818056 67 Klebsiella_phage(18.0%) holin,integrase,terminase,coat,tail attL 4751926:4751941|attR 4815362:4815377
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage