Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_AP022612 Mycolicibacterium confluentis strain JCM 13671 4 crisprs csa3,cas3,DinG,DEDDh,cas4,WYL 8 8 2 0

Results visualization

1. NZ_AP022612
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP022612_1 882414-882568 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP022612_2 1545477-1546120 Orphan NA
11 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP022612_3 1547941-1548086 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP022612_4 5018059-5018144 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_AP022612_2 2.2|1545569|25|NZ_AP022612|CRT 1545569-1545593 25 NZ_AP022612.1 1547888-1547912 0 1.0
NZ_AP022612_2 2.3|1545614|34|NZ_AP022612|CRT 1545614-1545647 34 NZ_AP022612.1 1547933-1547966 0 1.0
NZ_AP022612_2 2.6|1545764|25|NZ_AP022612|CRT 1545764-1545788 25 NZ_AP022612.1 1548083-1548107 0 1.0
NZ_AP022612_2 2.7|1545809|34|NZ_AP022612|CRT 1545809-1545842 34 NZ_AP022612.1 1548128-1548161 0 1.0
NZ_AP022612_2 2.8|1545863|25|NZ_AP022612|CRT 1545863-1545887 25 NZ_AP022612.1 1548182-1548206 0 1.0
NZ_AP022612_2 2.9|1545908|43|NZ_AP022612|CRT 1545908-1545950 43 NZ_AP022612.1 1548227-1548269 0 1.0
NZ_AP022612_2 2.10|1545971|49|NZ_AP022612|CRT 1545971-1546019 49 NZ_AP022612.1 1548290-1548338 0 1.0
NZ_AP022612_2 2.11|1546040|61|NZ_AP022612|CRT 1546040-1546100 61 NZ_AP022612.1 1548359-1548419 1 0.984

1. spacer 2.2|1545569|25|NZ_AP022612|CRT matches to position: 1547888-1547912, mismatch: 0, identity: 1.0 

tggtgacgcgggttcttatggcgat	CRISPR spacer
tggtgacgcgggttcttatggcgat	Protospacer
*************************

2. spacer 2.3|1545614|34|NZ_AP022612|CRT matches to position: 1547933-1547966, mismatch: 0, identity: 1.0 

cggcggtggtgctgtgggtggccatggtggtgtg	CRISPR spacer
cggcggtggtgctgtgggtggccatggtggtgtg	Protospacer
**********************************

3. spacer 2.6|1545764|25|NZ_AP022612|CRT matches to position: 1548083-1548107, mismatch: 0, identity: 1.0 

tggcaacgtgagcgttgacggtgct	CRISPR spacer
tggcaacgtgagcgttgacggtgct	Protospacer
*************************

4. spacer 2.7|1545809|34|NZ_AP022612|CRT matches to position: 1548128-1548161, mismatch: 0, identity: 1.0 

tggtgacggtggtcgcggtgccgatggcgcggtg	CRISPR spacer
tggtgacggtggtcgcggtgccgatggcgcggtg	Protospacer
**********************************

5. spacer 2.8|1545863|25|NZ_AP022612|CRT matches to position: 1548182-1548206, mismatch: 0, identity: 1.0 

taacgacggtgcgatgggcggcagt	CRISPR spacer
taacgacggtgcgatgggcggcagt	Protospacer
*************************

6. spacer 2.9|1545908|43|NZ_AP022612|CRT matches to position: 1548227-1548269, mismatch: 0, identity: 1.0 

tggtacgggcgctggttccggtgacggtggtgctggtggcgat	CRISPR spacer
tggtacgggcgctggttccggtgacggtggtgctggtggcgat	Protospacer
*******************************************

7. spacer 2.10|1545971|49|NZ_AP022612|CRT matches to position: 1548290-1548338, mismatch: 0, identity: 1.0 

tggtgccggttcggacggcgattccggtgtcgacggcgctggtcagaac	CRISPR spacer
tggtgccggttcggacggcgattccggtgtcgacggcgctggtcagaac	Protospacer
*************************************************

8. spacer 2.11|1546040|61|NZ_AP022612|CRT matches to position: 1548359-1548419, mismatch: 1, identity: 0.984 

tggctacggtgcctccggtggtcgcggcggtgatgcgctgggcaacggtgatggcggtgc	CRISPR spacer
tggctacggtgcctccggtggtcgcggcggtgatgcgctgggcaacggtgatggcggtgc	Protospacer
************************************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_AP022612_2 2.4|1545668|22|NZ_AP022612|CRT 1545668-1545689 22 NZ_HG813239 Erwinia amylovora strain 692 plasmid pEA29, complete sequence 20899-20920 2 0.909
NZ_AP022612_2 2.4|1545668|22|NZ_AP022612|CRT 1545668-1545689 22 NZ_CP023568 Erwinia pyrifoliae strain EpK1/15 plasmid pEP48, complete sequence 17910-17931 2 0.909
NZ_AP022612_2 2.4|1545668|22|NZ_AP022612|CRT 1545668-1545689 22 NC_005706 Erwinia amylovora Ea88 plasmid pEA29, complete sequence 20834-20855 2 0.909
NZ_AP022612_2 2.4|1545668|22|NZ_AP022612|CRT 1545668-1545689 22 NC_018978 Erwinia amylovora ATCC BAA-2158 plasmid pEA29, complete sequence 20764-20785 2 0.909
NZ_AP022612_2 2.4|1545668|22|NZ_AP022612|CRT 1545668-1545689 22 NZ_CP024971 Erwinia amylovora strain E-2 plasmid pEa-E-2, complete sequence 20891-20912 2 0.909
NZ_AP022612_2 2.4|1545668|22|NZ_AP022612|CRT 1545668-1545689 22 NZ_CP050241 Erwinia amylovora strain FB-20 plasmid pEA29, complete sequence 20891-20912 2 0.909
NZ_AP022612_2 2.4|1545668|22|NZ_AP022612|CRT 1545668-1545689 22 NC_013957 Erwinia amylovora CFBP1430 plasmid pEA29, complete sequence 20899-20920 2 0.909
NZ_AP022612_2 2.4|1545668|22|NZ_AP022612|CRT 1545668-1545689 22 NC_004445 Erwinia pyrifoliae Ep1/96 plasmid pEP36, complete sequence 19846-19867 2 0.909
NZ_AP022612_2 2.4|1545668|22|NZ_AP022612|CRT 1545668-1545689 22 NC_004834 Erwinia sp. Ejp 556 plasmid pEJ30, complete sequence 19832-19853 2 0.909
NZ_AP022612_2 2.4|1545668|22|NZ_AP022612|CRT 1545668-1545689 22 NC_013972 Erwinia amylovora ATCC 49946 plasmid 1, complete sequence 20891-20912 2 0.909
NZ_AP022612_2 2.4|1545668|22|NZ_AP022612|CRT 1545668-1545689 22 NC_017442 Erwinia sp. Ejp617 plasmid pJE01, complete sequence 27161-27182 2 0.909
NZ_AP022612_2 2.2|1545569|25|NZ_AP022612|CRT 1545569-1545593 25 CP021186 Sphingomonas wittichii DC-6 plasmid pDC05, complete sequence 17928-17952 3 0.88
NZ_AP022612_2 2.4|1545668|22|NZ_AP022612|CRT 1545668-1545689 22 NZ_CP045319 Roseivivax sp. THAF197b plasmid pTHAF197b_a, complete sequence 19534-19555 3 0.864
NZ_AP022612_2 2.8|1545863|25|NZ_AP022612|CRT 1545863-1545887 25 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 807975-807999 3 0.88
NZ_AP022612_2 2.8|1545863|25|NZ_AP022612|CRT 1545863-1545887 25 NZ_CP017244 Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence 1395959-1395983 3 0.88
NZ_AP022612_2 2.8|1545863|25|NZ_AP022612|CRT 1545863-1545887 25 NZ_CP039909 Agrobacterium tumefaciens strain CFBP6624 plasmid pAtCFBP6624, complete sequence 310721-310745 5 0.8
NZ_AP022612_2 2.8|1545863|25|NZ_AP022612|CRT 1545863-1545887 25 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 2095594-2095618 6 0.76
NZ_AP022612_2 2.8|1545863|25|NZ_AP022612|CRT 1545863-1545887 25 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 2163538-2163562 6 0.76
NZ_AP022612_1 1.1|882443|34|NZ_AP022612|CRISPRCasFinder 882443-882476 34 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 1564772-1564805 7 0.794
NZ_AP022612_1 1.1|882443|34|NZ_AP022612|CRISPRCasFinder 882443-882476 34 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 1641944-1641977 7 0.794
NZ_AP022612_1 1.1|882443|34|NZ_AP022612|CRISPRCasFinder 882443-882476 34 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 1483052-1483085 7 0.794
NZ_AP022612_1 1.1|882443|34|NZ_AP022612|CRISPRCasFinder 882443-882476 34 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 1554887-1554920 7 0.794
NZ_AP022612_1 1.1|882443|34|NZ_AP022612|CRISPRCasFinder 882443-882476 34 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 1482074-1482107 7 0.794
NZ_AP022612_1 1.1|882443|34|NZ_AP022612|CRISPRCasFinder 882443-882476 34 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 1552348-1552381 7 0.794
NZ_AP022612_1 1.1|882443|34|NZ_AP022612|CRISPRCasFinder 882443-882476 34 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 1552349-1552382 7 0.794
NZ_AP022612_1 1.1|882443|34|NZ_AP022612|CRISPRCasFinder 882443-882476 34 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 1483044-1483077 7 0.794
NZ_AP022612_1 1.1|882443|34|NZ_AP022612|CRISPRCasFinder 882443-882476 34 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 1482397-1482430 7 0.794
NZ_AP022612_1 1.1|882443|34|NZ_AP022612|CRISPRCasFinder 882443-882476 34 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 1483034-1483067 7 0.794
NZ_AP022612_1 1.1|882443|34|NZ_AP022612|CRISPRCasFinder 882443-882476 34 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 1564937-1564970 7 0.794
NZ_AP022612_1 1.1|882443|34|NZ_AP022612|CRISPRCasFinder 882443-882476 34 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 1564918-1564951 7 0.794
NZ_AP022612_1 1.1|882443|34|NZ_AP022612|CRISPRCasFinder 882443-882476 34 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 1564899-1564932 7 0.794
NZ_AP022612_1 1.2|882506|34|NZ_AP022612|CRISPRCasFinder 882506-882539 34 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 536345-536378 7 0.794
NZ_AP022612_2 2.5|1545710|34|NZ_AP022612|CRT 1545710-1545743 34 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 1268467-1268500 7 0.794
NZ_AP022612_2 2.7|1545809|34|NZ_AP022612|CRT 1545809-1545842 34 NC_023282 Streptomyces sp. FR1 plasmid pFRL2, complete sequence 79431-79464 7 0.794
NZ_AP022612_1 1.1|882443|34|NZ_AP022612|CRISPRCasFinder 882443-882476 34 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 2016609-2016642 8 0.765
NZ_AP022612_1 1.1|882443|34|NZ_AP022612|CRISPRCasFinder 882443-882476 34 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 979173-979206 8 0.765
NZ_AP022612_1 1.1|882443|34|NZ_AP022612|CRISPRCasFinder 882443-882476 34 NZ_CP024986 Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence 68662-68695 8 0.765
NZ_AP022612_1 1.1|882443|34|NZ_AP022612|CRISPRCasFinder 882443-882476 34 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 580933-580966 8 0.765
NZ_AP022612_1 1.1|882443|34|NZ_AP022612|CRISPRCasFinder 882443-882476 34 NZ_CP016560 Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence 238189-238222 8 0.765
NZ_AP022612_1 1.1|882443|34|NZ_AP022612|CRISPRCasFinder 882443-882476 34 NC_024970 Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence 172382-172415 8 0.765
NZ_AP022612_1 1.1|882443|34|NZ_AP022612|CRISPRCasFinder 882443-882476 34 NZ_KJ396772 Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence 172382-172415 8 0.765
NZ_AP022612_2 2.5|1545710|34|NZ_AP022612|CRT 1545710-1545743 34 NZ_CP049157 Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence 1108099-1108132 8 0.765
NZ_AP022612_2 2.5|1545710|34|NZ_AP022612|CRT 1545710-1545743 34 NZ_CP049317 Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence 536310-536343 8 0.765
NZ_AP022612_2 2.5|1545710|34|NZ_AP022612|CRT 1545710-1545743 34 NZ_AP022571 Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence 93780-93813 8 0.765
NZ_AP022612_2 2.7|1545809|34|NZ_AP022612|CRT 1545809-1545842 34 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 1200050-1200083 8 0.765
NZ_AP022612_2 2.7|1545809|34|NZ_AP022612|CRT 1545809-1545842 34 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 1248964-1248997 8 0.765
NZ_AP022612_2 2.7|1545809|34|NZ_AP022612|CRT 1545809-1545842 34 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 2009618-2009651 8 0.765
NZ_AP022612_2 2.7|1545809|34|NZ_AP022612|CRT 1545809-1545842 34 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 1118421-1118454 8 0.765
NZ_AP022612_2 2.7|1545809|34|NZ_AP022612|CRT 1545809-1545842 34 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 1812372-1812405 8 0.765
NZ_AP022612_2 2.7|1545809|34|NZ_AP022612|CRT 1545809-1545842 34 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 1178144-1178177 8 0.765
NZ_AP022612_2 2.7|1545809|34|NZ_AP022612|CRT 1545809-1545842 34 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 1882585-1882618 8 0.765
NZ_AP022612_2 2.7|1545809|34|NZ_AP022612|CRT 1545809-1545842 34 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 1117518-1117551 8 0.765
NZ_AP022612_2 2.7|1545809|34|NZ_AP022612|CRT 1545809-1545842 34 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 1811392-1811425 8 0.765
NZ_AP022612_2 2.7|1545809|34|NZ_AP022612|CRT 1545809-1545842 34 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 1151695-1151728 8 0.765
NZ_AP022612_2 2.7|1545809|34|NZ_AP022612|CRT 1545809-1545842 34 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 1912988-1913021 8 0.765
NZ_AP022612_2 2.7|1545809|34|NZ_AP022612|CRT 1545809-1545842 34 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 1151684-1151717 8 0.765
NZ_AP022612_2 2.7|1545809|34|NZ_AP022612|CRT 1545809-1545842 34 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 1912990-1913023 8 0.765
NZ_AP022612_2 2.7|1545809|34|NZ_AP022612|CRT 1545809-1545842 34 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 1118413-1118446 8 0.765
NZ_AP022612_2 2.7|1545809|34|NZ_AP022612|CRT 1545809-1545842 34 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 1812382-1812415 8 0.765
NZ_AP022612_2 2.7|1545809|34|NZ_AP022612|CRT 1545809-1545842 34 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 1117769-1117802 8 0.765
NZ_AP022612_2 2.7|1545809|34|NZ_AP022612|CRT 1545809-1545842 34 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 1811766-1811799 8 0.765
NZ_AP022612_2 2.7|1545809|34|NZ_AP022612|CRT 1545809-1545842 34 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 1118404-1118437 8 0.765
NZ_AP022612_2 2.7|1545809|34|NZ_AP022612|CRT 1545809-1545842 34 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 1812352-1812385 8 0.765
NZ_AP022612_2 2.7|1545809|34|NZ_AP022612|CRT 1545809-1545842 34 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 1200163-1200196 8 0.765
NZ_AP022612_2 2.7|1545809|34|NZ_AP022612|CRT 1545809-1545842 34 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 1200147-1200180 8 0.765
NZ_AP022612_2 2.7|1545809|34|NZ_AP022612|CRT 1545809-1545842 34 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 1200140-1200173 8 0.765
NZ_AP022612_2 2.7|1545809|34|NZ_AP022612|CRT 1545809-1545842 34 NZ_CP023549 Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence 41571-41604 8 0.765
NZ_AP022612_1 1.2|882506|34|NZ_AP022612|CRISPRCasFinder 882506-882539 34 NZ_CP034838 Rahnella aquatilis strain KM12 plasmid pKM12v1, complete sequence 10368-10401 9 0.735
NZ_AP022612_1 1.2|882506|34|NZ_AP022612|CRISPRCasFinder 882506-882539 34 NZ_CP034839 Rahnella aquatilis strain KM25 plasmid pKM12v2, complete sequence 10368-10401 9 0.735
NZ_AP022612_2 2.5|1545710|34|NZ_AP022612|CRT 1545710-1545743 34 MT771343 Gordonia phage Clown, complete genome 49535-49568 9 0.735
NZ_AP022612_2 2.5|1545710|34|NZ_AP022612|CRT 1545710-1545743 34 MN103533 Mycobacterium phage Weirdo19, complete genome 21399-21432 9 0.735
NZ_AP022612_2 2.5|1545710|34|NZ_AP022612|CRT 1545710-1545743 34 NZ_CP022581 Gordonia rubripertincta strain CWB2 plasmid pGCWB2, complete sequence 74294-74327 9 0.735
NZ_AP022612_2 2.7|1545809|34|NZ_AP022612|CRT 1545809-1545842 34 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 1913775-1913808 9 0.735
NZ_AP022612_2 2.7|1545809|34|NZ_AP022612|CRT 1545809-1545842 34 NC_013856 Azospirillum sp. B510 plasmid pAB510b, complete sequence 678414-678447 9 0.735
NZ_AP022612_2 2.7|1545809|34|NZ_AP022612|CRT 1545809-1545842 34 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 1913967-1914000 9 0.735
NZ_AP022612_2 2.7|1545809|34|NZ_AP022612|CRT 1545809-1545842 34 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 1913964-1913997 9 0.735
NZ_AP022612_2 2.7|1545809|34|NZ_AP022612|CRT 1545809-1545842 34 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 1913928-1913961 9 0.735
NZ_AP022612_2 2.7|1545809|34|NZ_AP022612|CRT 1545809-1545842 34 NZ_CP015009 Aminobacter aminovorans strain KCTC 2477 plasmid pAA04, complete sequence 116433-116466 9 0.735
NZ_AP022612_2 2.7|1545809|34|NZ_AP022612|CRT 1545809-1545842 34 NZ_AP014708 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_4p, complete sequence 44947-44980 9 0.735
NZ_AP022612_1 1.2|882506|34|NZ_AP022612|CRISPRCasFinder 882506-882539 34 NZ_CP050104 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence 1229035-1229068 10 0.706
NZ_AP022612_1 1.2|882506|34|NZ_AP022612|CRISPRCasFinder 882506-882539 34 NZ_CP025507 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence 976968-977001 10 0.706
NZ_AP022612_1 1.2|882506|34|NZ_AP022612|CRISPRCasFinder 882506-882539 34 NZ_CP050109 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence 1229035-1229068 10 0.706
NZ_AP022612_1 1.2|882506|34|NZ_AP022612|CRISPRCasFinder 882506-882539 34 NZ_CP022666 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence 400505-400538 10 0.706
NZ_AP022612_1 1.2|882506|34|NZ_AP022612|CRISPRCasFinder 882506-882539 34 NZ_CP050086 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence 1208990-1209023 10 0.706
NZ_AP022612_2 2.3|1545614|34|NZ_AP022612|CRT 1545614-1545647 34 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 805256-805289 10 0.706
NZ_AP022612_2 2.3|1545614|34|NZ_AP022612|CRT 1545614-1545647 34 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 259112-259145 10 0.706
NZ_AP022612_2 2.3|1545614|34|NZ_AP022612|CRT 1545614-1545647 34 NZ_CP032341 Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence 484152-484185 10 0.706
NZ_AP022612_2 2.3|1545614|34|NZ_AP022612|CRT 1545614-1545647 34 NZ_CP012916 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence 564453-564486 10 0.706
NZ_AP022612_2 2.5|1545710|34|NZ_AP022612|CRT 1545710-1545743 34 NZ_CP027299 Streptomyces sp. SGAir0924 plasmid unnamed_5 248469-248502 10 0.706
NZ_AP022612_2 2.5|1545710|34|NZ_AP022612|CRT 1545710-1545743 34 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 273805-273838 10 0.706
NZ_AP022612_1 1.1|882443|34|NZ_AP022612|CRISPRCasFinder 882443-882476 34 NZ_CP016619 Microvirga ossetica strain V5/3m plasmid unnamed2, complete sequence 807418-807451 11 0.676
NZ_AP022612_1 1.2|882506|34|NZ_AP022612|CRISPRCasFinder 882506-882539 34 NZ_CP025013 Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence 801566-801599 11 0.676
NZ_AP022612_1 1.2|882506|34|NZ_AP022612|CRISPRCasFinder 882506-882539 34 NZ_CP011667 Streptomyces sp. Mg1 plasmid pSMg1-3, complete sequence 67521-67554 11 0.676
NZ_AP022612_2 2.5|1545710|34|NZ_AP022612|CRT 1545710-1545743 34 CP000621 Burkholderia vietnamiensis G4 plasmid pBVIE05, complete sequence 47254-47287 11 0.676
NZ_AP022612_2 2.7|1545809|34|NZ_AP022612|CRT 1545809-1545842 34 NZ_CP025188 Roseomonas mucosa strain AD2 plasmid p1-AD2, complete sequence 393252-393285 11 0.676
NZ_AP022612_2 2.7|1545809|34|NZ_AP022612|CRT 1545809-1545842 34 NZ_CP024582 Roseomonas sp. FDAARGOS_362 plasmid unnamed1, complete sequence 35010-35043 11 0.676

1. spacer 2.4|1545668|22|NZ_AP022612|CRT matches to NZ_HG813239 (Erwinia amylovora strain 692 plasmid pEA29, complete sequence) position: , mismatch: 2, identity: 0.909 

gcagaccggtgatggtggcttc	CRISPR spacer
gcagaccggtgatggtggcaac	Protospacer
*******************  *

2. spacer 2.4|1545668|22|NZ_AP022612|CRT matches to NZ_CP023568 (Erwinia pyrifoliae strain EpK1/15 plasmid pEP48, complete sequence) position: , mismatch: 2, identity: 0.909 

gcagaccggtgatggtggcttc	CRISPR spacer
gcagaccggtgatggtggcaac	Protospacer
*******************  *

3. spacer 2.4|1545668|22|NZ_AP022612|CRT matches to NC_005706 (Erwinia amylovora Ea88 plasmid pEA29, complete sequence) position: , mismatch: 2, identity: 0.909 

gcagaccggtgatggtggcttc	CRISPR spacer
gcagaccggtgatggtggcaac	Protospacer
*******************  *

4. spacer 2.4|1545668|22|NZ_AP022612|CRT matches to NC_018978 (Erwinia amylovora ATCC BAA-2158 plasmid pEA29, complete sequence) position: , mismatch: 2, identity: 0.909 

gcagaccggtgatggtggcttc	CRISPR spacer
gcagaccggtgatggtggcaac	Protospacer
*******************  *

5. spacer 2.4|1545668|22|NZ_AP022612|CRT matches to NZ_CP024971 (Erwinia amylovora strain E-2 plasmid pEa-E-2, complete sequence) position: , mismatch: 2, identity: 0.909 

gcagaccggtgatggtggcttc	CRISPR spacer
gcagaccggtgatggtggcaac	Protospacer
*******************  *

6. spacer 2.4|1545668|22|NZ_AP022612|CRT matches to NZ_CP050241 (Erwinia amylovora strain FB-20 plasmid pEA29, complete sequence) position: , mismatch: 2, identity: 0.909 

gcagaccggtgatggtggcttc	CRISPR spacer
gcagaccggtgatggtggcaac	Protospacer
*******************  *

7. spacer 2.4|1545668|22|NZ_AP022612|CRT matches to NC_013957 (Erwinia amylovora CFBP1430 plasmid pEA29, complete sequence) position: , mismatch: 2, identity: 0.909 

gcagaccggtgatggtggcttc	CRISPR spacer
gcagaccggtgatggtggcaac	Protospacer
*******************  *

8. spacer 2.4|1545668|22|NZ_AP022612|CRT matches to NC_004445 (Erwinia pyrifoliae Ep1/96 plasmid pEP36, complete sequence) position: , mismatch: 2, identity: 0.909 

gcagaccggtgatggtggcttc	CRISPR spacer
gcagaccggtgatggtggcaac	Protospacer
*******************  *

9. spacer 2.4|1545668|22|NZ_AP022612|CRT matches to NC_004834 (Erwinia sp. Ejp 556 plasmid pEJ30, complete sequence) position: , mismatch: 2, identity: 0.909 

gcagaccggtgatggtggcttc	CRISPR spacer
gcagaccggtgatggtggcaac	Protospacer
*******************  *

10. spacer 2.4|1545668|22|NZ_AP022612|CRT matches to NC_013972 (Erwinia amylovora ATCC 49946 plasmid 1, complete sequence) position: , mismatch: 2, identity: 0.909 

gcagaccggtgatggtggcttc	CRISPR spacer
gcagaccggtgatggtggcaac	Protospacer
*******************  *

11. spacer 2.4|1545668|22|NZ_AP022612|CRT matches to NC_017442 (Erwinia sp. Ejp617 plasmid pJE01, complete sequence) position: , mismatch: 2, identity: 0.909 

gcagaccggtgatggtggcttc	CRISPR spacer
gcagaccggtgatggtggcaac	Protospacer
*******************  *

12. spacer 2.2|1545569|25|NZ_AP022612|CRT matches to CP021186 (Sphingomonas wittichii DC-6 plasmid pDC05, complete sequence) position: , mismatch: 3, identity: 0.88 

tggtgacgcgggttcttatggcgat	CRISPR spacer
tggtgacgagggtccttatggcgaa	Protospacer
******** ****.**********

13. spacer 2.4|1545668|22|NZ_AP022612|CRT matches to NZ_CP045319 (Roseivivax sp. THAF197b plasmid pTHAF197b_a, complete sequence) position: , mismatch: 3, identity: 0.864 

gcagaccggtgatggtggcttc	CRISPR spacer
tcagaccggtgatggtggctct	Protospacer
 *******************..

14. spacer 2.8|1545863|25|NZ_AP022612|CRT matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 3, identity: 0.88 

taacgacggtgcgatgggcggcagt	CRISPR spacer
tatcgacggtgcgatggccggcaat	Protospacer
** ************** *****.*

15. spacer 2.8|1545863|25|NZ_AP022612|CRT matches to NZ_CP017244 (Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence) position: , mismatch: 3, identity: 0.88 

taacgacggtgcgatgggcggcagt	CRISPR spacer
tatcgacggtgcgatggccggcaat	Protospacer
** ************** *****.*

16. spacer 2.8|1545863|25|NZ_AP022612|CRT matches to NZ_CP039909 (Agrobacterium tumefaciens strain CFBP6624 plasmid pAtCFBP6624, complete sequence) position: , mismatch: 5, identity: 0.8 

taacgacggtgcgatgggcggcagt	CRISPR spacer
gcttgacggtgcgatgggcggcagg	Protospacer
   .********************

17. spacer 2.8|1545863|25|NZ_AP022612|CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 6, identity: 0.76 

taacgacggtgcgatgggcggcagt	CRISPR spacer
cctcgacggtgcgatgggcggcgag	Protospacer
.  *******************..

18. spacer 2.8|1545863|25|NZ_AP022612|CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 6, identity: 0.76 

taacgacggtgcgatgggcggcagt	CRISPR spacer
cctcgacggtgcgatgggcggcgag	Protospacer
.  *******************..

19. spacer 1.1|882443|34|NZ_AP022612|CRISPRCasFinder matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794 

taccgggca-gggcggcgggcacaaccggggttgc	CRISPR spacer
-gcctggcgcaggcggcgggcacaacgggggtggc	Protospacer
 .** ***. .*************** ***** **

20. spacer 1.1|882443|34|NZ_AP022612|CRISPRCasFinder matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 7, identity: 0.794 

taccgggca-gggcggcgggcacaaccggggttgc	CRISPR spacer
-gcctggcgcaggcggcgggcacaacgggggtggc	Protospacer
 .** ***. .*************** ***** **

21. spacer 1.1|882443|34|NZ_AP022612|CRISPRCasFinder matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794 

taccgggca-gggcggcgggcacaaccggggttgc	CRISPR spacer
-gcctggcgcaggcggcgggcacaacgggggtggc	Protospacer
 .** ***. .*************** ***** **

22. spacer 1.1|882443|34|NZ_AP022612|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794 

taccgggca-gggcggcgggcacaaccggggttgc	CRISPR spacer
-gcctggcgcaggcggcgggcacaacgggggtggc	Protospacer
 .** ***. .*************** ***** **

23. spacer 1.1|882443|34|NZ_AP022612|CRISPRCasFinder matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 7, identity: 0.794 

taccgggca-gggcggcgggcacaaccggggttgc	CRISPR spacer
-gcctggcgcaggcggcgggcacaacgggggtggc	Protospacer
 .** ***. .*************** ***** **

24. spacer 1.1|882443|34|NZ_AP022612|CRISPRCasFinder matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794 

taccgggca-gggcggcgggcacaaccggggttgc	CRISPR spacer
-gcctggcgcaggcggcgggcacaacgggggtggc	Protospacer
 .** ***. .*************** ***** **

25. spacer 1.1|882443|34|NZ_AP022612|CRISPRCasFinder matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794 

taccgggca-gggcggcgggcacaaccggggttgc	CRISPR spacer
-gcctggcgcaggcggcgggcacaacgggggtggc	Protospacer
 .** ***. .*************** ***** **

26. spacer 1.1|882443|34|NZ_AP022612|CRISPRCasFinder matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794 

taccgggca-gggcggcgggcacaaccggggttgc	CRISPR spacer
-gcctggcgcaggcggcgggcacaacgggggtggc	Protospacer
 .** ***. .*************** ***** **

27. spacer 1.1|882443|34|NZ_AP022612|CRISPRCasFinder matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794 

taccgggca-gggcggcgggcacaaccggggttgc	CRISPR spacer
-gcctggcgcaggcggcgggcacaacgggggtggc	Protospacer
 .** ***. .*************** ***** **

28. spacer 1.1|882443|34|NZ_AP022612|CRISPRCasFinder matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794 

taccgggca-gggcggcgggcacaaccggggttgc	CRISPR spacer
-gcctggcgcaggcggcgggcacaacgggggtggc	Protospacer
 .** ***. .*************** ***** **

29. spacer 1.1|882443|34|NZ_AP022612|CRISPRCasFinder matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794 

taccgggca-gggcggcgggcacaaccggggttgc	CRISPR spacer
-gcctggcgcaggcggcgggcacaacgggggtggc	Protospacer
 .** ***. .*************** ***** **

30. spacer 1.1|882443|34|NZ_AP022612|CRISPRCasFinder matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794 

taccgggca-gggcggcgggcacaaccggggttgc	CRISPR spacer
-gcctggcgcaggcggcgggcacaacgggggtggc	Protospacer
 .** ***. .*************** ***** **

31. spacer 1.1|882443|34|NZ_AP022612|CRISPRCasFinder matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794 

taccgggca-gggcggcgggcacaaccggggttgc	CRISPR spacer
-gcctggcgcaggcggcgggcacaacgggggtggc	Protospacer
 .** ***. .*************** ***** **

32. spacer 1.2|882506|34|NZ_AP022612|CRISPRCasFinder matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.794 

cagccggggt---tgcggcgggcatgccgggcagggc	CRISPR spacer
---ccaggttcagtgcggcgggggtgccgggcagggc	Protospacer
   **.** *   ********* .*************

33. spacer 2.5|1545710|34|NZ_AP022612|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794 

cggtgtcggtgctgtcggtgttgcg-gctggcttc	CRISPR spacer
cggtgacggtgctgtcggcgttgcgcagtgggtg-	Protospacer
***** ************.****** . *** *

34. spacer 2.7|1545809|34|NZ_AP022612|CRT matches to NC_023282 (Streptomyces sp. FR1 plasmid pFRL2, complete sequence) position: , mismatch: 7, identity: 0.794 

tggtgacggtggtcgcggtgccgatggcgcggtg	CRISPR spacer
aaacgacggcggccgcggtgccgatggcgcgggg	Protospacer
 ...*****.**.******************* *

35. spacer 1.1|882443|34|NZ_AP022612|CRISPRCasFinder matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765 

taccg-ggcagggcggcgggcacaaccggggttgc	CRISPR spacer
-gcagcagcagggcggcgggatcaaccgggggggc	Protospacer
 .* * .*************  *********  **

36. spacer 1.1|882443|34|NZ_AP022612|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.765 

taccgggcagggcggcgggcacaaccggg-gttgc	CRISPR spacer
ggcgcggcagggcggcgggcatcaccgggtgatg-	Protospacer
 .*  ****************. ****** * **

37. spacer 1.1|882443|34|NZ_AP022612|CRISPRCasFinder matches to NZ_CP024986 (Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence) position: , mismatch: 8, identity: 0.765 

taccgggcagggcggcgggcacaaccggggttgc--	CRISPR spacer
agccgggcagggcggcgggcatcaccacg--tgccg	Protospacer
 .*******************. ***. *  ***

38. spacer 1.1|882443|34|NZ_AP022612|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 8, identity: 0.765 

taccgggcagggcggcgggcacaaccggg-gttgc	CRISPR spacer
ggcgcggcagggcggcgggcatcaccgggtgatg-	Protospacer
 .*  ****************. ****** * **

39. spacer 1.1|882443|34|NZ_AP022612|CRISPRCasFinder matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 8, identity: 0.765 

taccgggcagggcggcgggcacaaccggg-gttgc	CRISPR spacer
ggcgcggcagggcggcgggcatcaccgggtgatg-	Protospacer
 .*  ****************. ****** * **

40. spacer 1.1|882443|34|NZ_AP022612|CRISPRCasFinder matches to NC_024970 (Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 8, identity: 0.765 

taccgggcagggcggcgggcacaaccggggttgc--	CRISPR spacer
agccgggcagggcggcgggcatcaccacg--tgccg	Protospacer
 .*******************. ***. *  ***

41. spacer 1.1|882443|34|NZ_AP022612|CRISPRCasFinder matches to NZ_KJ396772 (Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 8, identity: 0.765 

taccgggcagggcggcgggcacaaccggggttgc--	CRISPR spacer
agccgggcagggcggcgggcatcaccacg--tgccg	Protospacer
 .*******************. ***. *  ***

42. spacer 2.5|1545710|34|NZ_AP022612|CRT matches to NZ_CP049157 (Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence) position: , mismatch: 8, identity: 0.765 

-cggtgtcggtgctgtcggtgttgcggctggcttc	CRISPR spacer
tccgcg-cggtgttgtcggtgttgccgctggatag	Protospacer
 * *.* *****.************ ***** *

43. spacer 2.5|1545710|34|NZ_AP022612|CRT matches to NZ_CP049317 (Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence) position: , mismatch: 8, identity: 0.765 

-cggtgtcggtgctgtcggtgttgcggctggcttc	CRISPR spacer
tccgcg-cggtgttgtcggtgttgccgctggatag	Protospacer
 * *.* *****.************ ***** *

44. spacer 2.5|1545710|34|NZ_AP022612|CRT matches to NZ_AP022571 (Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence) position: , mismatch: 8, identity: 0.765 

cggtgtcggtgctgtcggtgttgcggctggcttc	CRISPR spacer
cggtgccggtgctgccggtgttgccgtcgcccgc	Protospacer
*****.********.********* *..* *. *

45. spacer 2.7|1545809|34|NZ_AP022612|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765 

tggtgacggtggtcgcggtgccgatggcgcggtg	CRISPR spacer
tggtgccggtggtcgcggggccgaggtccgagag	Protospacer
***** ************ ***** * *  .* *

46. spacer 2.7|1545809|34|NZ_AP022612|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 8, identity: 0.765 

tggtgacggtggtcgcggtgccgatggcgcggtg	CRISPR spacer
tggtgccggtggtcgcggggccgaggtccgagag	Protospacer
***** ************ ***** * *  .* *

47. spacer 2.7|1545809|34|NZ_AP022612|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 8, identity: 0.765 

tggtgacggtggtcgcggtgccgatggcgcggtg	CRISPR spacer
tggtgccggtggtcgcggggccgaggtccgagag	Protospacer
***** ************ ***** * *  .* *

48. spacer 2.7|1545809|34|NZ_AP022612|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765 

tggtgacggtggtcgcggtgccgatggcgcggtg	CRISPR spacer
tggtgccggtggtcgcggggccgaggtccgagag	Protospacer
***** ************ ***** * *  .* *

49. spacer 2.7|1545809|34|NZ_AP022612|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765 

tggtgacggtggtcgcggtgccgatggcgcggtg	CRISPR spacer
tggtgccggtggtcgcggggccgaggtccgagag	Protospacer
***** ************ ***** * *  .* *

50. spacer 2.7|1545809|34|NZ_AP022612|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765 

tggtgacggtggtcgcggtgccgatggcgcggtg	CRISPR spacer
tggtgccggtggtcgcggggccgaggtccgagag	Protospacer
***** ************ ***** * *  .* *

51. spacer 2.7|1545809|34|NZ_AP022612|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765 

tggtgacggtggtcgcggtgccgatggcgcggtg	CRISPR spacer
tggtgccggtggtcgcggggccgaggtccgagag	Protospacer
***** ************ ***** * *  .* *

52. spacer 2.7|1545809|34|NZ_AP022612|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 8, identity: 0.765 

tggtgacggtggtcgcggtgccgatggcgcggtg	CRISPR spacer
tggtgccggtggtcgcggggccgaggtccgagag	Protospacer
***** ************ ***** * *  .* *

53. spacer 2.7|1545809|34|NZ_AP022612|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 8, identity: 0.765 

tggtgacggtggtcgcggtgccgatggcgcggtg	CRISPR spacer
tggtgccggtggtcgcggggccgaggtccgagag	Protospacer
***** ************ ***** * *  .* *

54. spacer 2.7|1545809|34|NZ_AP022612|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765 

tggtgacggtggtcgcggtgccgatggcgcggtg	CRISPR spacer
tggtgccggtggtcgcggggccgaggtccgagag	Protospacer
***** ************ ***** * *  .* *

55. spacer 2.7|1545809|34|NZ_AP022612|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765 

tggtgacggtggtcgcggtgccgatggcgcggtg	CRISPR spacer
tggtgccggtggtcgcggggccgaggtccgagag	Protospacer
***** ************ ***** * *  .* *

56. spacer 2.7|1545809|34|NZ_AP022612|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765 

tggtgacggtggtcgcggtgccgatggcgcggtg	CRISPR spacer
tggtgccggtggtcgcggggccgaggtccgagag	Protospacer
***** ************ ***** * *  .* *

57. spacer 2.7|1545809|34|NZ_AP022612|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765 

tggtgacggtggtcgcggtgccgatggcgcggtg	CRISPR spacer
tggtgccggtggtcgcggggccgaggtccgagag	Protospacer
***** ************ ***** * *  .* *

58. spacer 2.7|1545809|34|NZ_AP022612|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765 

tggtgacggtggtcgcggtgccgatggcgcggtg	CRISPR spacer
tggtgccggtggtcgcggggccgaggtccgagag	Protospacer
***** ************ ***** * *  .* *

59. spacer 2.7|1545809|34|NZ_AP022612|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765 

tggtgacggtggtcgcggtgccgatggcgcggtg	CRISPR spacer
tggtgccggtggtcgcggggccgaggtccgagag	Protospacer
***** ************ ***** * *  .* *

60. spacer 2.7|1545809|34|NZ_AP022612|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765 

tggtgacggtggtcgcggtgccgatggcgcggtg	CRISPR spacer
tggtgccggtggtcgcggggccgaggtccgagag	Protospacer
***** ************ ***** * *  .* *

61. spacer 2.7|1545809|34|NZ_AP022612|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765 

tggtgacggtggtcgcggtgccgatggcgcggtg	CRISPR spacer
tggtgccggtggtcgcggggccgaggtccgagag	Protospacer
***** ************ ***** * *  .* *

62. spacer 2.7|1545809|34|NZ_AP022612|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765 

tggtgacggtggtcgcggtgccgatggcgcggtg	CRISPR spacer
tggtgccggtggtcgcggggccgaggtccgagag	Protospacer
***** ************ ***** * *  .* *

63. spacer 2.7|1545809|34|NZ_AP022612|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765 

tggtgacggtggtcgcggtgccgatggcgcggtg	CRISPR spacer
tggtgccggtggtcgcggggccgaggtccgagag	Protospacer
***** ************ ***** * *  .* *

64. spacer 2.7|1545809|34|NZ_AP022612|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765 

tggtgacggtggtcgcggtgccgatggcgcggtg	CRISPR spacer
tggtgccggtggtcgcggggccgaggtccgagag	Protospacer
***** ************ ***** * *  .* *

65. spacer 2.7|1545809|34|NZ_AP022612|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765 

tggtgacggtggtcgcggtgccgatggcgcggtg	CRISPR spacer
tggtgccggtggtcgcggggccgaggtccgagag	Protospacer
***** ************ ***** * *  .* *

66. spacer 2.7|1545809|34|NZ_AP022612|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765 

tggtgacggtggtcgcggtgccgatggcgcggtg	CRISPR spacer
tggtgccggtggtcgcggggccgaggtccgagag	Protospacer
***** ************ ***** * *  .* *

67. spacer 2.7|1545809|34|NZ_AP022612|CRT matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765 

tggtgacggtggtcgcggtgccgatggcgcggtg-	CRISPR spacer
cgaagacggtggtctcgttgccgatggc-cagcgt	Protospacer
.*. ********** ** ********** *.*.*

68. spacer 1.2|882506|34|NZ_AP022612|CRISPRCasFinder matches to NZ_CP034838 (Rahnella aquatilis strain KM12 plasmid pKM12v1, complete sequence) position: , mismatch: 9, identity: 0.735 

cagccggggttgcggcgggcatgccgggcagggc	CRISPR spacer
cgccgagaactgcggcgggaatgccgggcatggc	Protospacer
*. * .*...********* ********** ***

69. spacer 1.2|882506|34|NZ_AP022612|CRISPRCasFinder matches to NZ_CP034839 (Rahnella aquatilis strain KM25 plasmid pKM12v2, complete sequence) position: , mismatch: 9, identity: 0.735 

cagccggggttgcggcgggcatgccgggcagggc	CRISPR spacer
cgccgagaactgcggcgggaatgccgggcatggc	Protospacer
*. * .*...********* ********** ***

70. spacer 2.5|1545710|34|NZ_AP022612|CRT matches to MT771343 (Gordonia phage Clown, complete genome) position: , mismatch: 9, identity: 0.735 

cggtgtcggtgctgtcggtgttgcggctggcttc	CRISPR spacer
cggtgtaggtgccgtcggtgttgcggacgatgag	Protospacer
****** *****.************* .*..

71. spacer 2.5|1545710|34|NZ_AP022612|CRT matches to MN103533 (Mycobacterium phage Weirdo19, complete genome) position: , mismatch: 9, identity: 0.735 

cggtgtcggtgctgtcggtgttgcggctggcttc	CRISPR spacer
gggtgtcggtgttgtcggggttgcggcggtagaa	Protospacer
 **********.****** ******** *

72. spacer 2.5|1545710|34|NZ_AP022612|CRT matches to NZ_CP022581 (Gordonia rubripertincta strain CWB2 plasmid pGCWB2, complete sequence) position: , mismatch: 9, identity: 0.735 

cggtgtcggtgctgtcggtgttgcggctggcttc	CRISPR spacer
cggtatcggtgctgtcggtggtgcgcagcaccac	Protospacer
****.*************** ****    .*. *

73. spacer 2.7|1545809|34|NZ_AP022612|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735 

tggtgacggtggtcgcggtgccgatggcgcggtg	CRISPR spacer
tggtgccggtggtcgcggggccgagatccgagag	Protospacer
***** ************ ***** . *  .* *

74. spacer 2.7|1545809|34|NZ_AP022612|CRT matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 9, identity: 0.735 

tggtgacggtggtcgcggtgccgatggcgcggtg	CRISPR spacer
gcgcggcgatggtcgcggtgccgatgccgccgat	Protospacer
  *.*.**.***************** *** *

75. spacer 2.7|1545809|34|NZ_AP022612|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735 

tggtgacggtggtcgcggtgccgatggcgcggtg	CRISPR spacer
tggtgccggtggtcgcggggccgagatccgagag	Protospacer
***** ************ ***** . *  .* *

76. spacer 2.7|1545809|34|NZ_AP022612|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735 

tggtgacggtggtcgcggtgccgatggcgcggtg	CRISPR spacer
tggtgccggtggtcgcggggccgagatccgagag	Protospacer
***** ************ ***** . *  .* *

77. spacer 2.7|1545809|34|NZ_AP022612|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735 

tggtgacggtggtcgcggtgccgatggcgcggtg	CRISPR spacer
tggtgccggtggtcgcggggccgagatccgagag	Protospacer
***** ************ ***** . *  .* *

78. spacer 2.7|1545809|34|NZ_AP022612|CRT matches to NZ_CP015009 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA04, complete sequence) position: , mismatch: 9, identity: 0.735 

tggtgacggtggtcgcggtgccgatggcgcggtg	CRISPR spacer
tggtgatggtggtcgcggtggcgacgcgacaagg	Protospacer
******.************* ***.*  .*.. *

79. spacer 2.7|1545809|34|NZ_AP022612|CRT matches to NZ_AP014708 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_4p, complete sequence) position: , mismatch: 9, identity: 0.735 

tggtgacggtggtcgcggtgccgatggcgcggtg	CRISPR spacer
gcgcgccgatggtcgcggtgccgatggagccgga	Protospacer
  *.* **.****************** ** * .

80. spacer 1.2|882506|34|NZ_AP022612|CRISPRCasFinder matches to NZ_CP050104 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence) position: , mismatch: 10, identity: 0.706 

cagccggggttgcggcgggcatgccgggcagggc	CRISPR spacer
tccgctcttttgcggcgggcctgccgggcagggt	Protospacer
.   *    *********** ************.

81. spacer 1.2|882506|34|NZ_AP022612|CRISPRCasFinder matches to NZ_CP025507 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence) position: , mismatch: 10, identity: 0.706 

cagccggggttgcggcgggcatgccgggcagggc	CRISPR spacer
tccgctcttttgcggcgggcctgccgggcagggt	Protospacer
.   *    *********** ************.

82. spacer 1.2|882506|34|NZ_AP022612|CRISPRCasFinder matches to NZ_CP050109 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence) position: , mismatch: 10, identity: 0.706 

cagccggggttgcggcgggcatgccgggcagggc	CRISPR spacer
tccgctcttttgcggcgggcctgccgggcagggt	Protospacer
.   *    *********** ************.

83. spacer 1.2|882506|34|NZ_AP022612|CRISPRCasFinder matches to NZ_CP022666 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence) position: , mismatch: 10, identity: 0.706 

cagccggggttgcggcgggcatgccgggcagggc	CRISPR spacer
tccgctcttttgcggcgggcctgccgggcagggt	Protospacer
.   *    *********** ************.

84. spacer 1.2|882506|34|NZ_AP022612|CRISPRCasFinder matches to NZ_CP050086 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence) position: , mismatch: 10, identity: 0.706 

cagccggggttgcggcgggcatgccgggcagggc	CRISPR spacer
tccgctcttttgcggcgggcctgccgggcagggt	Protospacer
.   *    *********** ************.

85. spacer 2.3|1545614|34|NZ_AP022612|CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 10, identity: 0.706 

cggcggtggtgctgtgggtggccatggtggtgtg	CRISPR spacer
cggcggcggtgctgtgggcggccaccaccctggt	Protospacer
******.***********.*****. ..  **

86. spacer 2.3|1545614|34|NZ_AP022612|CRT matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 10, identity: 0.706 

cggcggtggtgctgtgggtggccatggtggtgtg	CRISPR spacer
cggcggcggtgctgtgggcggccaccaccctggt	Protospacer
******.***********.*****. ..  **

87. spacer 2.3|1545614|34|NZ_AP022612|CRT matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 10, identity: 0.706 

cggcggtggtgctgtgggtggccatggtggtgtg	CRISPR spacer
cggcggcggtgctgtgggcggccaccacgctcgt	Protospacer
******.***********.*****. ..* *

88. spacer 2.3|1545614|34|NZ_AP022612|CRT matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 10, identity: 0.706 

cggcggtggtgctgtgggtggccatggtggtgtg	CRISPR spacer
cggcggcggtgctgtgggcggccaccacgctcgt	Protospacer
******.***********.*****. ..* *

89. spacer 2.5|1545710|34|NZ_AP022612|CRT matches to NZ_CP027299 (Streptomyces sp. SGAir0924 plasmid unnamed_5) position: , mismatch: 10, identity: 0.706 

cggtgtcggtgctgtcggtgttgcggctggcttc	CRISPR spacer
gcgccccggtgctgtcggtgatgcggctgggcga	Protospacer
  *. .************** ********* .

90. spacer 2.5|1545710|34|NZ_AP022612|CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 10, identity: 0.706 

cggtgtcggtgctgtcggtgttgcggctggcttc	CRISPR spacer
tcctgctggtgctgtcggtggtgctgctggcact	Protospacer
.  **..************* *** ****** ..

91. spacer 1.1|882443|34|NZ_AP022612|CRISPRCasFinder matches to NZ_CP016619 (Microvirga ossetica strain V5/3m plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.676 

taccgggcagggcggcgggcacaaccggggttgc	CRISPR spacer
tgtgtagcagggcggcgggcacatcctgggaatt	Protospacer
*..  .***************** ** ***   .

92. spacer 1.2|882506|34|NZ_AP022612|CRISPRCasFinder matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 11, identity: 0.676 

cagccggggttgcggcgggcatgccgggcagggc	CRISPR spacer
tccgctcttttgcggcgggcctgtcgggcagggt	Protospacer
.   *    *********** **.*********.

93. spacer 1.2|882506|34|NZ_AP022612|CRISPRCasFinder matches to NZ_CP011667 (Streptomyces sp. Mg1 plasmid pSMg1-3, complete sequence) position: , mismatch: 11, identity: 0.676 

cagccggggttgcggcgggcatgccgggcagggc	CRISPR spacer
aggagacggtcgcggcggccatgccgggcagcag	Protospacer
 .*  . ***.******* ************ .

94. spacer 2.5|1545710|34|NZ_AP022612|CRT matches to CP000621 (Burkholderia vietnamiensis G4 plasmid pBVIE05, complete sequence) position: , mismatch: 11, identity: 0.676 

cggtgtcggtgctgtcggtgttgcggctggcttc	CRISPR spacer
atttgtcggtgccgtcggtattgcggccgtagca	Protospacer
   *********.******.*******.*   .

95. spacer 2.7|1545809|34|NZ_AP022612|CRT matches to NZ_CP025188 (Roseomonas mucosa strain AD2 plasmid p1-AD2, complete sequence) position: , mismatch: 11, identity: 0.676 

tggtgacggtggtcgcggtgccgatggcgcggtg	CRISPR spacer
ccagcacgctggtcgcggtgccgacggcggtgca	Protospacer
. .  *** ***************.****  *..

96. spacer 2.7|1545809|34|NZ_AP022612|CRT matches to NZ_CP024582 (Roseomonas sp. FDAARGOS_362 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.676 

tggtgacggtggtcgcggtgccgatggcgcggtg	CRISPR spacer
ccagcacgctggtcgcggtgccgacggcggtgca	Protospacer
. .  *** ***************.****  *..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2870678 : 2923131 51 Mycobacterium_phage(36.36%) integrase,transposase,tRNA,capsid attL 2921625:2921647|attR 2933650:2933672
DBSCAN-SWA_2 3293934 : 3303191 10 Lactococcus_phage(16.67%) NA NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage