Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_AP022589 Mycolicibacter minnesotensis strain JCM 17932 11 crisprs cas3,csb1gr7,DEDDh,csa3,WYL,DinG,cas4 5 8 3 0

Results visualization

1. NZ_AP022589
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP022589_1 732140-732284 Orphan NA
2 spacers
csb1gr7

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP022589_2 1021882-1021996 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP022589_3 1848525-1848630 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP022589_4 1895484-1895579 Orphan NA
1 spacers
WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP022589_5 2377900-2378187 Orphan NA
6 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP022589_6 2674643-2674943 Orphan NA
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP022589_7 3042084-3042298 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP022589_8 3105850-3105987 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP022589_9 3166088-3166199 Orphan NA
2 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP022589_10 3324075-3324157 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP022589_11 3708755-3708991 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_AP022589_6 6.2|2674722|32|NZ_AP022589|CRISPRCasFinder 2674722-2674753 32 NZ_AP022589.1 2676952-2676983 0 1.0
NZ_AP022589_6 6.3|2674779|38|NZ_AP022589|CRISPRCasFinder 2674779-2674816 38 NZ_AP022589.1 2677009-2677046 0 1.0
NZ_AP022589_6 6.4|2674842|17|NZ_AP022589|CRISPRCasFinder 2674842-2674858 17 NZ_AP022589.1 2677072-2677088 0 1.0
NZ_AP022589_6 6.5|2674884|35|NZ_AP022589|CRISPRCasFinder 2674884-2674918 35 NZ_AP022589.1 2677114-2677148 0 1.0
NZ_AP022589_6 6.4|2674842|17|NZ_AP022589|CRISPRCasFinder 2674842-2674858 17 NZ_AP022589.1 3815565-3815581 1 0.941
NZ_AP022589_6 6.4|2674842|17|NZ_AP022589|CRISPRCasFinder 2674842-2674858 17 NZ_AP022589.1 3772952-3772968 1 0.941
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_AP022589.1 2676898-2676926 2 0.931

1. spacer 6.2|2674722|32|NZ_AP022589|CRISPRCasFinder matches to position: 2676952-2676983, mismatch: 0, identity: 1.0 

cgttgccgaagagccagccggcggctccgccg	CRISPR spacer
cgttgccgaagagccagccggcggctccgccg	Protospacer
********************************

2. spacer 6.3|2674779|38|NZ_AP022589|CRISPRCasFinder matches to position: 2677009-2677046, mismatch: 0, identity: 1.0 

cgtctccgcctgcgccgccgttgccgaggattcccagg	CRISPR spacer
cgtctccgcctgcgccgccgttgccgaggattcccagg	Protospacer
**************************************

3. spacer 6.4|2674842|17|NZ_AP022589|CRISPRCasFinder matches to position: 2677072-2677088, mismatch: 0, identity: 1.0 

caccgtcggtggtgctg	CRISPR spacer
caccgtcggtggtgctg	Protospacer
*****************

4. spacer 6.5|2674884|35|NZ_AP022589|CRISPRCasFinder matches to position: 2677114-2677148, mismatch: 0, identity: 1.0 

agatccagccgcctgcgccgccgttggggttggct	CRISPR spacer
agatccagccgcctgcgccgccgttggggttggct	Protospacer
***********************************

5. spacer 6.4|2674842|17|NZ_AP022589|CRISPRCasFinder matches to position: 3815565-3815581, mismatch: 1, identity: 0.941 

caccgtcggtggtgctg	CRISPR spacer
caccgtcggtggcgctg	Protospacer
************.****

6. spacer 6.4|2674842|17|NZ_AP022589|CRISPRCasFinder matches to position: 3772952-3772968, mismatch: 1, identity: 0.941 

caccgtcggtggtgctg	CRISPR spacer
cacggtcggtggtgctg	Protospacer
*** *************

7. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to position: 2676898-2676926, mismatch: 2, identity: 0.931 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gggcgggcagtccggccagggtggggccg	Protospacer
*****************. **********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_AP022589_5 5.2|2377960|21|NZ_AP022589|CRT 2377960-2377980 21 NZ_CP010857 Marinovum algicola DG 898 plasmid pMaD2, complete sequence 85922-85942 1 0.952
NZ_AP022589_5 5.2|2377960|21|NZ_AP022589|CRT 2377960-2377980 21 NZ_CP029831 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence 96764-96784 1 0.952
NZ_AP022589_5 5.2|2377960|21|NZ_AP022589|CRT 2377960-2377980 21 NZ_CP023000 Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence 602846-602866 1 0.952
NZ_AP022589_5 5.2|2377960|21|NZ_AP022589|CRT 2377960-2377980 21 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 453475-453495 1 0.952
NZ_AP022589_5 5.1|2377918|24|NZ_AP022589|CRT 2377918-2377941 24 MN855777 Bacteriophage sp. isolate 33, complete genome 37651-37674 3 0.875
NZ_AP022589_3 3.1|1848565|26|NZ_AP022589|CRISPRCasFinder 1848565-1848590 26 NZ_CP005190 Sphingobium sp. MI1205 plasmid pMI1, complete sequence 123370-123395 4 0.846
NZ_AP022589_3 3.1|1848565|26|NZ_AP022589|CRISPRCasFinder 1848565-1848590 26 NC_020542 Sphingomonas sp. MM-1 plasmid pISP0, complete sequence 132125-132150 4 0.846
NZ_AP022589_5 5.1|2377918|24|NZ_AP022589|CRT 2377918-2377941 24 NZ_CP013855 Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence 2406-2429 4 0.833
NZ_AP022589_5 5.4|2378035|27|NZ_AP022589|CRT 2378035-2378061 27 NZ_CP033582 Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence 157789-157815 4 0.852
NZ_AP022589_5 5.5|2378080|30|NZ_AP022589|CRT 2378080-2378109 30 NZ_LN832562 Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence 360669-360698 4 0.867
NZ_AP022589_3 3.1|1848565|26|NZ_AP022589|CRISPRCasFinder 1848565-1848590 26 NZ_CP013634 Rhizobium sp. N324 plasmid pRspN324d, complete sequence 494028-494053 5 0.808
NZ_AP022589_3 3.1|1848565|26|NZ_AP022589|CRISPRCasFinder 1848565-1848590 26 NC_011366 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence 453655-453680 5 0.808
NZ_AP022589_5 5.4|2378035|27|NZ_AP022589|CRT 2378035-2378061 27 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 224663-224689 5 0.815
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NC_012811 Methylorubrum extorquens AM1 megaplasmid, complete sequence 349494-349522 5 0.828
NZ_AP022589_3 3.1|1848565|26|NZ_AP022589|CRISPRCasFinder 1848565-1848590 26 NC_012811 Methylorubrum extorquens AM1 megaplasmid, complete sequence 581115-581140 6 0.769
NZ_AP022589_5 5.4|2378035|27|NZ_AP022589|CRT 2378035-2378061 27 NC_012811 Methylorubrum extorquens AM1 megaplasmid, complete sequence 908320-908346 6 0.778
NZ_AP022589_5 5.4|2378035|27|NZ_AP022589|CRT 2378035-2378061 27 NZ_CP033024 Agrobacterium fabrum strain 1D132 plasmid pAt1D132a, complete sequence 76326-76352 6 0.778
NZ_AP022589_5 5.4|2378035|27|NZ_AP022589|CRT 2378035-2378061 27 NZ_CP020951 Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence 5186-5212 6 0.778
NZ_AP022589_5 5.4|2378035|27|NZ_AP022589|CRT 2378035-2378061 27 NZ_CP013529 Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence 5117-5143 6 0.778
NZ_AP022589_5 5.4|2378035|27|NZ_AP022589|CRT 2378035-2378061 27 NZ_CP013582 Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence 5117-5143 6 0.778
NZ_AP022589_5 5.5|2378080|30|NZ_AP022589|CRT 2378080-2378109 30 MN536026 Pseudomonas phage vB_Pae-SS2019XI, complete genome 41758-41787 6 0.8
NZ_AP022589_5 5.5|2378080|30|NZ_AP022589|CRT 2378080-2378109 30 NC_021056 Streptomyces sp. PAMC 26508 plasmid pSP01, complete sequence 90651-90680 6 0.8
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP021082 Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence 138072-138100 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP029836 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed6, complete sequence 77230-77258 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 620524-620552 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 637670-637698 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP029777 Deinococcus actinosclerus strain Deinococcus actinosclerus SJTR plasmid unnamed3, complete sequence 229830-229858 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 1283334-1283362 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 720616-720644 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 750240-750268 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 886291-886319 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 475551-475579 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 1064810-1064838 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 635201-635229 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 724212-724240 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 1050720-1050748 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NC_016623 Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence 384442-384470 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 641869-641897 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 553158-553186 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 549363-549391 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 549353-549381 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 639563-639591 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 837442-837470 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 724218-724246 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 837442-837470 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 703602-703630 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 729125-729153 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 837443-837471 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 647181-647209 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 703602-703630 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 729125-729153 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 837445-837473 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 703602-703630 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 647209-647237 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 703606-703634 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 729125-729153 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 729125-729153 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 729125-729153 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 837445-837473 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 837445-837473 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 647209-647237 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 652986-653014 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 652931-652959 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 689982-690010 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 725227-725255 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 837445-837473 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 647209-647237 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 703602-703630 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 837439-837467 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 647209-647237 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 647209-647237 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 837445-837473 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 729127-729155 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 837445-837473 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 837445-837473 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 1995715-1995743 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP015867 Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence 325311-325339 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 1388516-1388544 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 1186769-1186797 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 331180-331208 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 1985185-1985213 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 373572-373600 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 1629272-1629300 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 427872-427900 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NC_017805 Deinococcus gobiensis I-0 plasmid P1, complete sequence 431683-431711 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 1347590-1347618 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 1311786-1311814 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 1454816-1454844 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 804151-804179 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 1336071-1336099 6 0.793
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 1336071-1336099 6 0.793
NZ_AP022589_5 5.5|2378080|30|NZ_AP022589|CRT 2378080-2378109 30 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 1433368-1433397 7 0.767
NZ_AP022589_5 5.5|2378080|30|NZ_AP022589|CRT 2378080-2378109 30 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 1276471-1276500 7 0.767
NZ_AP022589_5 5.5|2378080|30|NZ_AP022589|CRT 2378080-2378109 30 NZ_CP022568 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK04, complete sequence 295487-295516 7 0.767
NZ_AP022589_5 5.5|2378080|30|NZ_AP022589|CRT 2378080-2378109 30 NZ_CP035710 Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence 205733-205762 7 0.767
NZ_AP022589_5 5.5|2378080|30|NZ_AP022589|CRT 2378080-2378109 30 NZ_CP020613 Paracoccus contaminans strain RKI 16-01929T=LMG 29738T=CCM 8701T=CIP 111112T plasmid unnamed, complete sequence 47541-47570 7 0.767
NZ_AP022589_6 6.2|2674722|32|NZ_AP022589|CRISPRCasFinder 2674722-2674753 32 MH513982 Microbacterium phage Sansa, complete genome 11386-11417 7 0.781
NZ_AP022589_6 6.2|2674722|32|NZ_AP022589|CRISPRCasFinder 2674722-2674753 32 LN997843 Streptomyces reticuli genome assembly TUE45, plasmid : II 448305-448336 7 0.781
NZ_AP022589_6 6.2|2674722|32|NZ_AP022589|CRISPRCasFinder 2674722-2674753 32 CP042595 Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence 166270-166301 7 0.781
NZ_AP022589_5 5.5|2378080|30|NZ_AP022589|CRT 2378080-2378109 30 NZ_CP049244 Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence 183087-183116 8 0.733
NZ_AP022589_5 5.5|2378080|30|NZ_AP022589|CRT 2378080-2378109 30 NC_016623 Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence 161834-161863 8 0.733
NZ_AP022589_5 5.5|2378080|30|NZ_AP022589|CRT 2378080-2378109 30 NC_019309 Pseudomonas sp. K-62 plasmid pMR68, complete sequence 5293-5322 8 0.733
NZ_AP022589_5 5.5|2378080|30|NZ_AP022589|CRT 2378080-2378109 30 NC_042132 Gordonia phage Sour, complete genome 34114-34143 8 0.733
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_AP022607 Mycobacterium branderi strain JCM 12687 plasmid pJCM12687 464997-465025 8 0.724
NZ_AP022589_6 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder 2674668-2674696 29 NZ_CP014598 Yangia sp. CCB-MM3 plasmid unnamed2, complete sequence 96149-96177 8 0.724
NZ_AP022589_6 6.2|2674722|32|NZ_AP022589|CRISPRCasFinder 2674722-2674753 32 NZ_CP027024 Streptomyces sp. WAC00288 plasmid p2, complete sequence 35228-35259 8 0.75
NZ_AP022589_6 6.2|2674722|32|NZ_AP022589|CRISPRCasFinder 2674722-2674753 32 NZ_CP027024 Streptomyces sp. WAC00288 plasmid p2, complete sequence 62108-62139 8 0.75
NZ_AP022589_5 5.5|2378080|30|NZ_AP022589|CRT 2378080-2378109 30 NZ_CP011523 Streptomyces sp. CFMR 7 strain CFMR-7 plasmid unnamed, complete sequence 62296-62325 9 0.7
NZ_AP022589_6 6.2|2674722|32|NZ_AP022589|CRISPRCasFinder 2674722-2674753 32 CP000385 Mycobacterium sp. MCS Plasmid1, complete sequence 64139-64170 9 0.719
NZ_AP022589_6 6.2|2674722|32|NZ_AP022589|CRISPRCasFinder 2674722-2674753 32 NC_008704 Mycobacterium sp. KMS plasmid pMKMS02, complete sequence 90198-90229 9 0.719
NZ_AP022589_6 6.2|2674722|32|NZ_AP022589|CRISPRCasFinder 2674722-2674753 32 NC_022063 Mycobacterium phage Phelemich, complete genome 67711-67742 9 0.719
NZ_AP022589_6 6.2|2674722|32|NZ_AP022589|CRISPRCasFinder 2674722-2674753 32 KF024727 Mycobacterium phage Reprobate, complete genome 67716-67747 9 0.719
NZ_AP022589_6 6.5|2674884|35|NZ_AP022589|CRISPRCasFinder 2674884-2674918 35 MH067970 Arthrobacter sp. strain ANT_H40 plasmid pA40H1, complete sequence 14000-14034 10 0.714

1. spacer 5.2|2377960|21|NZ_AP022589|CRT matches to NZ_CP010857 (Marinovum algicola DG 898 plasmid pMaD2, complete sequence) position: , mismatch: 1, identity: 0.952 

tcgccgccgacgccgatcaac	CRISPR spacer
ccgccgccgacgccgatcaac	Protospacer
.********************

2. spacer 5.2|2377960|21|NZ_AP022589|CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 1, identity: 0.952 

tcgccgccgacgccgatcaac	CRISPR spacer
tcgccgccgacgccgatcagc	Protospacer
*******************.*

3. spacer 5.2|2377960|21|NZ_AP022589|CRT matches to NZ_CP023000 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence) position: , mismatch: 1, identity: 0.952 

tcgccgccgacgccgatcaac	CRISPR spacer
ttgccgccgacgccgatcaac	Protospacer
*.*******************

4. spacer 5.2|2377960|21|NZ_AP022589|CRT matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 1, identity: 0.952 

tcgccgccgacgccgatcaac	CRISPR spacer
tcgccgccgacgccgatcagc	Protospacer
*******************.*

5. spacer 5.1|2377918|24|NZ_AP022589|CRT matches to MN855777 (Bacteriophage sp. isolate 33, complete genome) position: , mismatch: 3, identity: 0.875 

tagccaccgacaccgctgtcgctg	CRISPR spacer
cagccaccgacgccgctatcgctg	Protospacer
.**********.*****.******

6. spacer 3.1|1848565|26|NZ_AP022589|CRISPRCasFinder matches to NZ_CP005190 (Sphingobium sp. MI1205 plasmid pMI1, complete sequence) position: , mismatch: 4, identity: 0.846 

ttccgctgccccaggccccccgcctc	CRISPR spacer
tcgcgctgccccatgccccgcgcctc	Protospacer
*. ********** ***** ******

7. spacer 3.1|1848565|26|NZ_AP022589|CRISPRCasFinder matches to NC_020542 (Sphingomonas sp. MM-1 plasmid pISP0, complete sequence) position: , mismatch: 4, identity: 0.846 

ttccgctgccccaggccccccgcctc	CRISPR spacer
tcgcgctgccccatgccccgcgcctc	Protospacer
*. ********** ***** ******

8. spacer 5.1|2377918|24|NZ_AP022589|CRT matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 4, identity: 0.833 

tagccaccgacaccgctgtcgctg	CRISPR spacer
gccccaccgccaccgctgtcgctg	Protospacer
   ****** **************

9. spacer 5.4|2378035|27|NZ_AP022589|CRT matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 4, identity: 0.852 

gcccctccggtgccgaagagcccggcc	CRISPR spacer
gcgtcgccgctgccgaagagcccggcc	Protospacer
** .* *** *****************

10. spacer 5.5|2378080|30|NZ_AP022589|CRT matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 4, identity: 0.867 

gcgacgccggcctcggcgctg--tcccagcct	CRISPR spacer
gcgatgccggcctcggcgctggcgcccagc--	Protospacer
****.****************   ******

11. spacer 3.1|1848565|26|NZ_AP022589|CRISPRCasFinder matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 5, identity: 0.808 

ttccgctgccccaggccccccgcctc	CRISPR spacer
atccgcagccccaggccccgcgccga	Protospacer
 ***** ************ ****

12. spacer 3.1|1848565|26|NZ_AP022589|CRISPRCasFinder matches to NC_011366 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence) position: , mismatch: 5, identity: 0.808 

ttccgctgccccaggccccccgcctc	CRISPR spacer
atccgcagccccaggccccgcgccga	Protospacer
 ***** ************ ****

13. spacer 5.4|2378035|27|NZ_AP022589|CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 5, identity: 0.815 

gcccctccggtgccgaagagcccggcc	CRISPR spacer
tcgacgccggtgccgaagatcccggcc	Protospacer
 *  * ************* *******

14. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 5, identity: 0.828 

gggcgggcagtccggccgcggtggggccg--	CRISPR spacer
aggcgggcagtccggccgccgt--cgccggt	Protospacer
.****************** **   ****

15. spacer 3.1|1848565|26|NZ_AP022589|CRISPRCasFinder matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.769 

ttccgctgccccaggccccccgcctc	CRISPR spacer
cgccgctgccccaggcccctcgcgct	Protospacer
. *****************.*** ..

16. spacer 5.4|2378035|27|NZ_AP022589|CRT matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.778 

gcccctccggtgccgaagagcccggcc	CRISPR spacer
cgggcgccggtgccgacgagcccggcc	Protospacer
    * ********** **********

17. spacer 5.4|2378035|27|NZ_AP022589|CRT matches to NZ_CP033024 (Agrobacterium fabrum strain 1D132 plasmid pAt1D132a, complete sequence) position: , mismatch: 6, identity: 0.778 

gcccctccggtgccgaagagcccggcc	CRISPR spacer
tttccgccggtgccgaagagcgcggca	Protospacer
 ..** *************** ****

18. spacer 5.4|2378035|27|NZ_AP022589|CRT matches to NZ_CP020951 (Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence) position: , mismatch: 6, identity: 0.778 

gcccctccggtgccgaagagcccggcc	CRISPR spacer
tcgtttccggtgccgaagagcgcggcg	Protospacer
 * ..**************** ****

19. spacer 5.4|2378035|27|NZ_AP022589|CRT matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 6, identity: 0.778 

gcccctccggtgccgaagagcccggcc	CRISPR spacer
tcgtttccggtgccgaagagcgcggcg	Protospacer
 * ..**************** ****

20. spacer 5.4|2378035|27|NZ_AP022589|CRT matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 6, identity: 0.778 

gcccctccggtgccgaagagcccggcc	CRISPR spacer
tcgtttccggtgccgaagagcgcggcg	Protospacer
 * ..**************** ****

21. spacer 5.5|2378080|30|NZ_AP022589|CRT matches to MN536026 (Pseudomonas phage vB_Pae-SS2019XI, complete genome) position: , mismatch: 6, identity: 0.8 

gcgacgccggcctcggcgctgtcccagcct-	CRISPR spacer
gcgtcgccggcctcggcgct-ttcgggcgtg	Protospacer
*** **************** *.* .** *

22. spacer 5.5|2378080|30|NZ_AP022589|CRT matches to NC_021056 (Streptomyces sp. PAMC 26508 plasmid pSP01, complete sequence) position: , mismatch: 6, identity: 0.8 

gcgacgccggcctcggcgctgtcccagcct	CRISPR spacer
gcaccgccggcccgggcgctgtcccaggca	Protospacer
**. ********. ************* *

23. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP021082 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
aggcgggcagtcaggccgcggtggacggg	Protospacer
.*********** ***********.   *

24. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP029836 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed6, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gggcgggcagcccggacgcggtggacgtg	Protospacer
**********.**** ********.  .*

25. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gcgcgggcaggccggccgcggtgacggtg	Protospacer
* ******** ************. * .*

26. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gcgcgggcaggccggccgcggtgacggtg	Protospacer
* ******** ************. * .*

27. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP029777 (Deinococcus actinosclerus strain Deinococcus actinosclerus SJTR plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gcgcgggcagtccggccgaggtgaacctg	Protospacer
* **************** ****.. *.*

28. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gcgcgggcaggccggccgcggtgacggtg	Protospacer
* ******** ************. * .*

29. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gcgcgggcaggccggccgcggtgacggtg	Protospacer
* ******** ************. * .*

30. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gcgcgggcaggccggccgcggtgacggtg	Protospacer
* ******** ************. * .*

31. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gcgcgggcaggccggccgcggtgacggtg	Protospacer
* ******** ************. * .*

32. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gcgcgggcaggccggccgcggtgacggtg	Protospacer
* ******** ************. * .*

33. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gcgcgggcaggccggccgcggtgacggtg	Protospacer
* ******** ************. * .*

34. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gcgcgggcaggccggccgcggtgacggtg	Protospacer
* ******** ************. * .*

35. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gcgcgggcaggccggccgcggtgacggtg	Protospacer
* ******** ************. * .*

36. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gcgcgggcaggccggccgcggtgacggtg	Protospacer
* ******** ************. * .*

37. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
aggccggcggtccggccgcggtggaggcc	Protospacer
.*** ***.***************.* *

38. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gcgcgggcaggccggccgcggtgacggtg	Protospacer
* ******** ************. * .*

39. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gcgcgggcaggccggccgcggtgacggtg	Protospacer
* ******** ************. * .*

40. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gcgcgggcaggccggccgcggtgacggtg	Protospacer
* ******** ************. * .*

41. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gcgcgggcaggccggccgcggtgacggtg	Protospacer
* ******** ************. * .*

42. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gcgcgggcaggccggccgcggtgacggtg	Protospacer
* ******** ************. * .*

43. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gcgcgggcaggccggccgcggtgacggtg	Protospacer
* ******** ************. * .*

44. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gcgcgggcaggccggccgcggtgacggtg	Protospacer
* ******** ************. * .*

45. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gcgcgggcaggccggccgcggtgacggtg	Protospacer
* ******** ************. * .*

46. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gcgcgggcaggccggccgcggtgacggtg	Protospacer
* ******** ************. * .*

47. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gcgcgggcaggccggccgcggtgacggtg	Protospacer
* ******** ************. * .*

48. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gcgcgggcaggccggccgcggtgacggtg	Protospacer
* ******** ************. * .*

49. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gcgcgggcaggccggccgcggtgacggtg	Protospacer
* ******** ************. * .*

50. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gcgcgggcaggccggccgcggtgacggtg	Protospacer
* ******** ************. * .*

51. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gcgcgggcaggccggccgcggtgacggtg	Protospacer
* ******** ************. * .*

52. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gcgcgggcaggccggccgcggtgacggtg	Protospacer
* ******** ************. * .*

53. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gcgcgggcaggccggccgcggtgacggtg	Protospacer
* ******** ************. * .*

54. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gcgcgggcaggccggccgcggtgacggtg	Protospacer
* ******** ************. * .*

55. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gcgcgggcaggccggccgcggtgacggtg	Protospacer
* ******** ************. * .*

56. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gcgcgggcaggccggccgcggtgacggtg	Protospacer
* ******** ************. * .*

57. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gcgcgggcaggccggccgcggtgacggtg	Protospacer
* ******** ************. * .*

58. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gcgcgggcaggccggccgcggtgacggtg	Protospacer
* ******** ************. * .*

59. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gcgcgggcaggccggccgcggtgacggtg	Protospacer
* ******** ************. * .*

60. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gcgcgggcaggccggccgcggtgacggtg	Protospacer
* ******** ************. * .*

61. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gcgcgggcaggccggccgcggtgacggtg	Protospacer
* ******** ************. * .*

62. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gcgcgggcaggccggccgcggtgacggtg	Protospacer
* ******** ************. * .*

63. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gcgcgggcaggccggccgcggtgacggtg	Protospacer
* ******** ************. * .*

64. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gcgcgggcaggccggccgcggtgacggtg	Protospacer
* ******** ************. * .*

65. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gcgcgggcaggccggccgcggtgacggtg	Protospacer
* ******** ************. * .*

66. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gcgcgggcaggccggccgcggtgacggtg	Protospacer
* ******** ************. * .*

67. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gcgcgggcaggccggccgcggtgacggtg	Protospacer
* ******** ************. * .*

68. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gcgcgggcaggccggccgcggtgacggtg	Protospacer
* ******** ************. * .*

69. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gcgcgggcaggccggccgcggtgacggtg	Protospacer
* ******** ************. * .*

70. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gcgcgggcaggccggccgcggtgacggtg	Protospacer
* ******** ************. * .*

71. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gcgcgggcaggccggccgcggtgacggtg	Protospacer
* ******** ************. * .*

72. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gcgcgggcaggccggccgcggtgacggtg	Protospacer
* ******** ************. * .*

73. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gcgcgggcaggccggccgcggtgacggtg	Protospacer
* ******** ************. * .*

74. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gcgcgggcaggccggccgcggtgacggtg	Protospacer
* ******** ************. * .*

75. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gcgcgggcaggccggccgcggtgacggtg	Protospacer
* ******** ************. * .*

76. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gcgcgggcaggccggccgcggtgacggtg	Protospacer
* ******** ************. * .*

77. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
ggtcgggcagttcggccgcggtgtcggtg	Protospacer
** ********.***********  * .*

78. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gcgcgggcaggccggccgcggtgacggtg	Protospacer
* ******** ************. * .*

79. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gcgcgggcaggccggccgcggtgacggtg	Protospacer
* ******** ************. * .*

80. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gcgcgggcaggccggccgcggtgacggtg	Protospacer
* ******** ************. * .*

81. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gcgcgggcaggccggccgcggtgacggtg	Protospacer
* ******** ************. * .*

82. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gcgcgggcaggccggccgcggtgacggtg	Protospacer
* ******** ************. * .*

83. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gcgcgggcaggccggccgcggtgacggtg	Protospacer
* ******** ************. * .*

84. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gcgcgggcaggccggccgcggtgacggtg	Protospacer
* ******** ************. * .*

85. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NC_017805 (Deinococcus gobiensis I-0 plasmid P1, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gggcgggcagcccggccgaggtgaacctg	Protospacer
**********.******* ****.. *.*

86. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gcgcgggcaggccggccgcggtgacggtg	Protospacer
* ******** ************. * .*

87. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gcgcgggcaggccggccgcggtgacggtg	Protospacer
* ******** ************. * .*

88. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gcgcgggcaggccggccgcggtgacggtg	Protospacer
* ******** ************. * .*

89. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gcgcgggcaggccggccgcggtgacggtg	Protospacer
* ******** ************. * .*

90. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gcgcgggcaggccggccgcggtgacggtg	Protospacer
* ******** ************. * .*

91. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
gcgcgggcaggccggccgcggtgacggtg	Protospacer
* ******** ************. * .*

92. spacer 5.5|2378080|30|NZ_AP022589|CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.767 

gcgacgccggcctcggcgctgtcccagcct	CRISPR spacer
tcgacgccggcctcggcgatggcccgcacg	Protospacer
 ***************** ** ***.  *

93. spacer 5.5|2378080|30|NZ_AP022589|CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.767 

gcgacgccggcctcggcgctgtcccagcct	CRISPR spacer
tcgacgccggcctcggcgatggccctcacg	Protospacer
 ***************** ** ***   *

94. spacer 5.5|2378080|30|NZ_AP022589|CRT matches to NZ_CP022568 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK04, complete sequence) position: , mismatch: 7, identity: 0.767 

gcgacgccggcctcggcgctgtcccagcct	CRISPR spacer
gcgtcgccggcctcgacgctgtcgatccca	Protospacer
*** ***********.*******    **

95. spacer 5.5|2378080|30|NZ_AP022589|CRT matches to NZ_CP035710 (Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence) position: , mismatch: 7, identity: 0.767 

gcgacgccggcctcggcgctgtcccagcct	CRISPR spacer
gcgacgctggcctcggcgctgggcgcggcg	Protospacer
*******.*************  *  * *

96. spacer 5.5|2378080|30|NZ_AP022589|CRT matches to NZ_CP020613 (Paracoccus contaminans strain RKI 16-01929T=LMG 29738T=CCM 8701T=CIP 111112T plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767 

gcgacgccggcctcggcgctgtcccagcct	CRISPR spacer
gcgccgccgccctcggcgctgtcgcgcctg	Protospacer
*** ***** ************* *. *.

97. spacer 6.2|2674722|32|NZ_AP022589|CRISPRCasFinder matches to MH513982 (Microbacterium phage Sansa, complete genome) position: , mismatch: 7, identity: 0.781 

cgttgccgaagagccagccggcggctccgccg	CRISPR spacer
tcttgccgaacagccagccagcggctccagag	Protospacer
. ******** ********.********.  *

98. spacer 6.2|2674722|32|NZ_AP022589|CRISPRCasFinder matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 7, identity: 0.781 

cgttgccgaagagccagccggcggctccgccg	CRISPR spacer
cgttgccgaagacccagccggcgccgtggatg	Protospacer
************ ********** * . * .*

99. spacer 6.2|2674722|32|NZ_AP022589|CRISPRCasFinder matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 7, identity: 0.781 

cgttgccgaagagccagccggcggctccgccg	CRISPR spacer
cgttgccgaacagccagcgggcgccgtcgacc	Protospacer
********** ******* **** * .** *

100. spacer 5.5|2378080|30|NZ_AP022589|CRT matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.733 

gcgacgccggcctcggcgctgtcccagcct	CRISPR spacer
tcgacgccggcctgggcgctggccggagcg	Protospacer
 ************ ******* ** .. *

101. spacer 5.5|2378080|30|NZ_AP022589|CRT matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 8, identity: 0.733 

gcgacgccggcctcggcgctgtcccagcct	CRISPR spacer
tccacgccggccgcggcgctgtccaccaca	Protospacer
 * ********* ***********    *

102. spacer 5.5|2378080|30|NZ_AP022589|CRT matches to NC_019309 (Pseudomonas sp. K-62 plasmid pMR68, complete sequence) position: , mismatch: 8, identity: 0.733 

gcgacgccggcctcggcgctgtcccagcct	CRISPR spacer
ggacggccggcctccgcgctgtaccagcac	Protospacer
* .  ********* ******* ***** .

103. spacer 5.5|2378080|30|NZ_AP022589|CRT matches to NC_042132 (Gordonia phage Sour, complete genome) position: , mismatch: 8, identity: 0.733 

gcgacgccggcctcggcgctgtcccagcct	CRISPR spacer
gcgacgccgacctcggcgctgatgccgagg	Protospacer
*********.*********** . * *

104. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 8, identity: 0.724 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
ctgcgggcagcccggcggcggtgggtagc	Protospacer
  ********.***** ********

105. spacer 6.1|2674668|29|NZ_AP022589|CRISPRCasFinder matches to NZ_CP014598 (Yangia sp. CCB-MM3 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.724 

gggcgggcagtccggccgcggtggggccg	CRISPR spacer
ccgcgggcagttcggcggcggtgggaagc	Protospacer
  *********.**** ********.

106. spacer 6.2|2674722|32|NZ_AP022589|CRISPRCasFinder matches to NZ_CP027024 (Streptomyces sp. WAC00288 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.75 

cgttgccgaagagccagccggcggctccgccg	CRISPR spacer
cgtcgccgaagacccagccggcgccgtggatg	Protospacer
***.******** ********** * . * .*

107. spacer 6.2|2674722|32|NZ_AP022589|CRISPRCasFinder matches to NZ_CP027024 (Streptomyces sp. WAC00288 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.75 

cgttgccgaagagccagccggcggctccgccg	CRISPR spacer
cgtcgccgaagacccagccggcgccgtggatg	Protospacer
***.******** ********** * . * .*

108. spacer 5.5|2378080|30|NZ_AP022589|CRT matches to NZ_CP011523 (Streptomyces sp. CFMR 7 strain CFMR-7 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7 

gcgacgccggcctcggcgctgtcccagcct	CRISPR spacer
acgaagccggcctcggcgctgcccggcatc	Protospacer
.*** ****************.** .  ..

109. spacer 6.2|2674722|32|NZ_AP022589|CRISPRCasFinder matches to CP000385 (Mycobacterium sp. MCS Plasmid1, complete sequence) position: , mismatch: 9, identity: 0.719 

cgttgccgaagagccagccggcggctccgccg	CRISPR spacer
gcaaggaggagagccggcgggcggctccgccg	Protospacer
    *  *.******.** *************

110. spacer 6.2|2674722|32|NZ_AP022589|CRISPRCasFinder matches to NC_008704 (Mycobacterium sp. KMS plasmid pMKMS02, complete sequence) position: , mismatch: 9, identity: 0.719 

cgttgccgaagagccagccggcggctccgccg	CRISPR spacer
gcaaggaggagagccggcgggcggctccgccg	Protospacer
    *  *.******.** *************

111. spacer 6.2|2674722|32|NZ_AP022589|CRISPRCasFinder matches to NC_022063 (Mycobacterium phage Phelemich, complete genome) position: , mismatch: 9, identity: 0.719 

cgttgccgaagagccagccggcggctccgccg	CRISPR spacer
tcttgccgatgagccagcgggcggcgttgacc	Protospacer
. ******* ******** ****** ..* *

112. spacer 6.2|2674722|32|NZ_AP022589|CRISPRCasFinder matches to KF024727 (Mycobacterium phage Reprobate, complete genome) position: , mismatch: 9, identity: 0.719 

cgttgccgaagagccagccggcggctccgccg	CRISPR spacer
tcttgccgatgagccagcgggcggcgttgacc	Protospacer
. ******* ******** ****** ..* *

113. spacer 6.5|2674884|35|NZ_AP022589|CRISPRCasFinder matches to MH067970 (Arthrobacter sp. strain ANT_H40 plasmid pA40H1, complete sequence) position: , mismatch: 10, identity: 0.714 

agatccagccgcctgcgccgccgttggggttggct	CRISPR spacer
gcagttggccgcccgcgccgccgttggggttgaac	Protospacer
. * ...******.******************. .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 484831 : 496332 13 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_2 1543474 : 1550062 9 Mycobacterium_phage(66.67%) NA NA
DBSCAN-SWA_3 3182468 : 3201978 20 Mycobacterium_phage(100.0%) tail NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage