Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 1 crisprs csa3,DEDDh,cas4,WYL,cas3,casR,DinG 0 1 1 0
NZ_AP022592 Mycolicibacterium arabiense strain JCM 18538 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_AP022593
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP022593_1 2864877-2865003 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_AP022593_1 1.1|2864920|41|NZ_AP022593|CRISPRCasFinder 2864920-2864960 41 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2864920-2864960 0 1.0

1. spacer 1.1|2864920|41|NZ_AP022593|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 0, identity: 1.0

acacaacccccacactcgcgcacaacccctcgccgccgcgc	CRISPR spacer
acacaacccccacactcgcgcacaacccctcgccgccgcgc	Protospacer
*****************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1670433 : 1678127 8 Lactococcus_phage(14.29%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage