Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP049257 Nocardioides sp. R-3366 chromosome, complete genome 5 crisprs WYL,csa3,DEDDh,cas4,cas3,casR 0 3 361 0

Results visualization

1. NZ_CP049257
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP049257_1 1516134-1516207 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP049257_2 3494493-3494682 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP049257_3 3584050-3584192 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP049257_4 4801905-4802012 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP049257_5 5031231-5031469 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP049257_1 1.1|1516161|20|NZ_CP049257|CRISPRCasFinder 1516161-1516180 20 NC_023284 Streptomyces sp. F2 plasmid pFRL4, complete sequence 369576-369595 1 0.95
NZ_CP049257_2 2.2|3494572|23|NZ_CP049257|CRT 3494572-3494594 23 NZ_CP045074 Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence 244208-244230 2 0.913
NZ_CP049257_2 2.2|3494572|23|NZ_CP049257|CRT 3494572-3494594 23 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 612426-612448 2 0.913
NZ_CP049257_2 2.2|3494572|23|NZ_CP049257|CRT 3494572-3494594 23 NZ_CP023064 Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence 403908-403930 2 0.913
NZ_CP049257_2 2.2|3494572|23|NZ_CP049257|CRT 3494572-3494594 23 NZ_CP031082 Paracoccus yeei strain CCUG 32053 plasmid pYEE4, complete sequence 42930-42952 2 0.913
NZ_CP049257_2 2.2|3494572|23|NZ_CP049257|CRT 3494572-3494594 23 MN234216 Streptomyces phage Gilgamesh, complete genome 106401-106423 2 0.913
NZ_CP049257_2 2.2|3494572|23|NZ_CP049257|CRT 3494572-3494594 23 NZ_CP044425 Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence 322560-322582 2 0.913
NZ_CP049257_2 2.2|3494572|23|NZ_CP049257|CRT 3494572-3494594 23 NZ_CP020441 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed1, complete sequence 24748-24770 2 0.913
NZ_CP049257_2 2.2|3494572|23|NZ_CP049257|CRT 3494572-3494594 23 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 1761652-1761674 2 0.913
NZ_CP049257_2 2.2|3494572|23|NZ_CP049257|CRT 3494572-3494594 23 NZ_CP044080 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence 9028-9050 2 0.913
NZ_CP049257_2 2.2|3494572|23|NZ_CP049257|CRT 3494572-3494594 23 NZ_CP020540 Sphingobium herbicidovorans strain MH plasmid pSHV1, complete sequence 140823-140845 3 0.87
NZ_CP049257_2 2.1|3494515|35|NZ_CP049257|CRT 3494515-3494549 35 NZ_CP024312 Rhizobium sp. NXC24 plasmid pRspNXC24a, complete sequence 116549-116583 10 0.714

1. spacer 1.1|1516161|20|NZ_CP049257|CRISPRCasFinder matches to NC_023284 (Streptomyces sp. F2 plasmid pFRL4, complete sequence) position: , mismatch: 1, identity: 0.95

acggtcgggcgtcgccgcgt	CRISPR spacer
ccggtcgggcgtcgccgcgt	Protospacer
 *******************

2. spacer 2.2|3494572|23|NZ_CP049257|CRT matches to NZ_CP045074 (Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.913

tcgcgcgcgccgtccttggcgtg	CRISPR spacer
tcgcgcgcgccgtcctcggggtg	Protospacer
****************.** ***

3. spacer 2.2|3494572|23|NZ_CP049257|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 2, identity: 0.913

tcgcgcgcgccgtccttggcgtg	CRISPR spacer
tcgcgcgcgccgtgctcggcgtg	Protospacer
************* **.******

4. spacer 2.2|3494572|23|NZ_CP049257|CRT matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 2, identity: 0.913

tcgcgcgcgccgtccttggcgtg	CRISPR spacer
tcgcgcgcgccgtgctcggcgtg	Protospacer
************* **.******

5. spacer 2.2|3494572|23|NZ_CP049257|CRT matches to NZ_CP031082 (Paracoccus yeei strain CCUG 32053 plasmid pYEE4, complete sequence) position: , mismatch: 2, identity: 0.913

tcgcgcgcgccgtccttggcgtg	CRISPR spacer
tcgcgcgcgccgtcctcggggtg	Protospacer
****************.** ***

6. spacer 2.2|3494572|23|NZ_CP049257|CRT matches to MN234216 (Streptomyces phage Gilgamesh, complete genome) position: , mismatch: 2, identity: 0.913

tcgcgcgcgccgtccttggcgtg-	CRISPR spacer
tcgcgcgcgccgtccttgg-gcgc	Protospacer
******************* *.* 

7. spacer 2.2|3494572|23|NZ_CP049257|CRT matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 2, identity: 0.913

tcgcgcgcgccgtccttggcgtg	CRISPR spacer
tcgcgcgcgccgtcctcggggtg	Protospacer
****************.** ***

8. spacer 2.2|3494572|23|NZ_CP049257|CRT matches to NZ_CP020441 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.913

tcgcgcgcgccgtccttggcgtg	CRISPR spacer
tcgcgcgcgccgtcctcggggtg	Protospacer
****************.** ***

9. spacer 2.2|3494572|23|NZ_CP049257|CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 2, identity: 0.913

tcgcgcgcgccgtccttggcgtg	CRISPR spacer
tcgcgcgcgccgtgctcggcgtg	Protospacer
************* **.******

10. spacer 2.2|3494572|23|NZ_CP049257|CRT matches to NZ_CP044080 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.913

tcgcgcgcgccgtccttggcgtg	CRISPR spacer
tcgcgcgcgccgtcctcggggtg	Protospacer
****************.** ***

11. spacer 2.2|3494572|23|NZ_CP049257|CRT matches to NZ_CP020540 (Sphingobium herbicidovorans strain MH plasmid pSHV1, complete sequence) position: , mismatch: 3, identity: 0.87

tcgcgcgcgccgtccttggcgtg	CRISPR spacer
gcgcgcgcgccttccttggcgtc	Protospacer
 ********** ********** 

12. spacer 2.1|3494515|35|NZ_CP049257|CRT matches to NZ_CP024312 (Rhizobium sp. NXC24 plasmid pRspNXC24a, complete sequence) position: , mismatch: 10, identity: 0.714

tccacggcgcggtcccgggcctcctggcgcagctg	CRISPR spacer
ggcccggcgtggtgccgggcctcctggcgcgaaga	Protospacer
  * *****.*** ****************..  .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 33360 34 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_2 44033 : 51536 2 Emiliania_huxleyi_virus(50.0%) NA NA
DBSCAN-SWA_3 68919 : 71184 3 Acanthamoeba_polyphaga_mimivirus(50.0%) NA NA
DBSCAN-SWA_4 80844 : 87030 5 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_5 94660 : 98238 5 Kaumoebavirus(50.0%) NA NA
DBSCAN-SWA_6 135257 : 142061 7 Streptococcus_phage(33.33%) NA NA
DBSCAN-SWA_7 159180 : 159822 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_8 167644 : 169561 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_9 173308 : 174076 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_10 182062 : 185008 1 Bradyrhizobium_phage(100.0%) NA NA
DBSCAN-SWA_11 200090 : 200756 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_12 212908 : 214081 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_13 220665 : 221427 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_14 229107 : 230813 2 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_15 238901 : 245460 6 Bacillus_phage(75.0%) NA NA
DBSCAN-SWA_16 249878 : 253637 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_17 262723 : 263626 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_18 281946 : 283590 1 Acidianus_filamentous_virus(100.0%) NA NA
DBSCAN-SWA_19 295658 : 297284 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_20 304556 : 304952 1 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_21 313369 : 319109 5 Streptococcus_phage(33.33%) NA NA
DBSCAN-SWA_22 323565 : 324357 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_23 335476 : 342273 5 Micromonas_pusilla_virus(33.33%) NA NA
DBSCAN-SWA_24 362843 : 363764 1 Eastern_grey_kangaroopox_virus(100.0%) NA NA
DBSCAN-SWA_25 372048 : 374618 2 Acanthocystis_turfacea_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_26 409005 : 413260 3 Mycobacterium_phage(50.0%) NA NA
DBSCAN-SWA_27 422445 : 424149 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_28 434465 : 435821 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_29 447868 : 454309 5 Tupanvirus(33.33%) NA NA
DBSCAN-SWA_30 483220 : 489331 6 uncultured_Mediterranean_phage(33.33%) NA NA
DBSCAN-SWA_31 493504 : 501313 8 uncultured_virus(50.0%) tRNA NA
DBSCAN-SWA_32 504382 : 505882 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_33 535738 : 536800 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_34 562942 : 564477 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_35 579555 : 585209 4 Indivirus(50.0%) NA NA
DBSCAN-SWA_36 596521 : 607071 9 Bacillus_phage(20.0%) NA NA
DBSCAN-SWA_37 621795 : 622896 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_38 634679 : 636730 2 Microbacterium_phage(50.0%) NA NA
DBSCAN-SWA_39 647942 : 648500 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_40 652067 : 663402 12 Mycobacterium_phage(20.0%) NA NA
DBSCAN-SWA_41 667801 : 668404 1 Cassava_brown_streak_virus(100.0%) NA NA
DBSCAN-SWA_42 671869 : 672625 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_43 675742 : 678022 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_44 683608 : 684652 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_45 697920 : 699954 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_46 714289 : 716265 2 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_47 726419 : 727163 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_48 754020 : 755082 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_49 761713 : 763444 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_50 781383 : 788253 10 Bacillus_phage(20.0%) integrase attL 780486:780502|attR 795614:795630
DBSCAN-SWA_51 795347 : 797022 2 Dickeya_phage(50.0%) NA NA
DBSCAN-SWA_52 800199 : 801021 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_53 817377 : 818802 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_54 828481 : 829966 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_55 848312 : 851633 4 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_56 871127 : 873397 2 Streptomyces_phage(50.0%) NA NA
DBSCAN-SWA_57 881632 : 888558 5 Acinetobacter_phage(50.0%) tRNA NA
DBSCAN-SWA_58 901969 : 902830 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_59 906904 : 908593 1 Pacmanvirus(100.0%) NA NA
DBSCAN-SWA_60 915519 : 922027 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_61 925265 : 933443 8 Agrobacterium_phage(50.0%) protease,tRNA NA
DBSCAN-SWA_62 945247 : 945658 1 Anguillid_herpesvirus(100.0%) NA NA
DBSCAN-SWA_63 971025 : 974962 4 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_64 979901 : 981497 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_65 992519 : 993497 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_66 1002697 : 1005975 3 Indivirus(50.0%) NA NA
DBSCAN-SWA_67 1023961 : 1025704 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_68 1030082 : 1030982 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_69 1035285 : 1039088 3 Microbacterium_phage(33.33%) NA NA
DBSCAN-SWA_70 1046949 : 1050455 2 Tokyovirus(50.0%) NA NA
DBSCAN-SWA_71 1078041 : 1078455 1 Bandra_megavirus(100.0%) NA NA
DBSCAN-SWA_72 1082815 : 1084521 2 Mycobacterium_phage(50.0%) NA NA
DBSCAN-SWA_73 1098399 : 1101380 5 uncultured_Mediterranean_phage(33.33%) NA NA
DBSCAN-SWA_74 1110705 : 1111833 1 uncultured_phage(100.0%) NA NA
DBSCAN-SWA_75 1116312 : 1117617 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_76 1135439 : 1136126 1 Emiliania_huxleyi_virus(100.0%) NA NA
DBSCAN-SWA_77 1139887 : 1140868 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_78 1157520 : 1163057 4 Acinetobacter_phage(50.0%) NA NA
DBSCAN-SWA_79 1168205 : 1169207 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_80 1173604 : 1177895 5 Chrysochromulina_ericina_virus(50.0%) NA NA
DBSCAN-SWA_81 1185128 : 1186304 1 Acanthamoeba_polyphaga_mimivirus(100.0%) NA NA
DBSCAN-SWA_82 1221622 : 1226853 4 Bodo_saltans_virus(50.0%) tRNA NA
DBSCAN-SWA_83 1248827 : 1251289 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_84 1264518 : 1265568 1 Geobacillus_virus(100.0%) NA NA
DBSCAN-SWA_85 1279796 : 1280033 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_86 1306815 : 1308581 2 Ectocarpus_siliculosus_virus(50.0%) NA NA
DBSCAN-SWA_87 1318729 : 1319755 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_88 1326700 : 1328512 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_89 1333675 : 1334671 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_90 1346952 : 1348737 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_91 1364355 : 1365384 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_92 1373048 : 1375214 1 Cannes_8_virus(100.0%) NA NA
DBSCAN-SWA_93 1385869 : 1391972 3 Streptomyces_phage(50.0%) NA NA
DBSCAN-SWA_94 1419482 : 1423031 1 Streptomyces_phage(100.0%) NA NA
DBSCAN-SWA_95 1436995 : 1444002 9 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_96 1459111 : 1460892 2 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_97 1466520 : 1469217 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_98 1483308 : 1484523 1 Burkholderia_phage(100.0%) NA NA
DBSCAN-SWA_99 1504462 : 1505416 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_100 1527226 : 1529320 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_101 1534318 : 1545197 8 Staphylococcus_phage(50.0%) tRNA,protease NA
DBSCAN-SWA_102 1555365 : 1557231 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_103 1565449 : 1567279 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_104 1581232 : 1582264 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_105 1586451 : 1587726 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_106 1603770 : 1615632 11 Bacillus_phage(20.0%) tRNA NA
DBSCAN-SWA_107 1618816 : 1624535 5 Gordonia_phage(33.33%) NA NA
DBSCAN-SWA_108 1629007 : 1631814 2 Tokyovirus(50.0%) tRNA NA
DBSCAN-SWA_109 1641291 : 1641537 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_110 1645257 : 1646184 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_111 1650157 : 1651816 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_112 1662705 : 1666972 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_113 1670618 : 1675499 5 Agrobacterium_phage(50.0%) NA NA
DBSCAN-SWA_114 1687076 : 1688555 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_115 1701420 : 1708451 8 Anomala_cuprea_entomopoxvirus(33.33%) NA NA
DBSCAN-SWA_116 1719532 : 1723005 2 Cedratvirus(100.0%) NA NA
DBSCAN-SWA_117 1735353 : 1736250 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_118 1744794 : 1745469 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_119 1748570 : 1749935 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_120 1760905 : 1761412 1 Streptomyces_phage(100.0%) NA NA
DBSCAN-SWA_121 1766675 : 1767791 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_122 1803109 : 1804579 1 Freshwater_phage(100.0%) NA NA
DBSCAN-SWA_123 1813517 : 1815044 1 Mocis_latipes_granulovirus(100.0%) NA NA
DBSCAN-SWA_124 1820072 : 1824352 5 Orpheovirus(50.0%) NA NA
DBSCAN-SWA_125 1836882 : 1837557 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_126 1846685 : 1850711 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_127 1869173 : 1872014 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_128 1884516 : 1887370 4 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_129 1897191 : 1898472 1 Acanthamoeba_polyphaga_mimivirus(100.0%) NA NA
DBSCAN-SWA_130 1904542 : 1906084 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_131 1914104 : 1915559 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_132 1923875 : 1925863 2 Micromonas_sp._RCC1109_virus(100.0%) NA NA
DBSCAN-SWA_133 1938028 : 1939495 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_134 1946394 : 1947120 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_135 1961834 : 1964956 3 Agrobacterium_phage(66.67%) protease NA
DBSCAN-SWA_136 1977268 : 1978876 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_137 1982543 : 1984175 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_138 1992951 : 1994514 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_139 2003719 : 2008267 3 Mycobacterium_phage(50.0%) NA NA
DBSCAN-SWA_140 2013313 : 2015139 2 Thermobifida_phage(50.0%) NA NA
DBSCAN-SWA_141 2025036 : 2026566 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_142 2044360 : 2048574 3 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_143 2053030 : 2057877 5 environmental_halophage(33.33%) NA NA
DBSCAN-SWA_144 2061018 : 2066274 4 Rhodococcus_phage(33.33%) NA NA
DBSCAN-SWA_145 2069987 : 2076015 4 Diadromus_pulchellus_ascovirus(50.0%) NA NA
DBSCAN-SWA_146 2080847 : 2083419 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_147 2089726 : 2090506 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_148 2099287 : 2101863 3 Streptomyces_phage(50.0%) NA NA
DBSCAN-SWA_149 2107239 : 2107848 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_150 2116564 : 2118001 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_151 2123749 : 2128560 2 Saccharomonospora_phage(50.0%) NA NA
DBSCAN-SWA_152 2136855 : 2137518 1 Mollivirus(100.0%) NA NA
DBSCAN-SWA_153 2146667 : 2152617 3 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_154 2158083 : 2159832 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_155 2174163 : 2176980 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_156 2181949 : 2182876 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_157 2191728 : 2195763 5 Sulfolobus_monocaudavirus(50.0%) NA NA
DBSCAN-SWA_158 2207250 : 2209635 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_159 2218500 : 2220309 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_160 2224059 : 2231486 6 Klosneuvirus(33.33%) NA NA
DBSCAN-SWA_161 2235139 : 2236300 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_162 2247570 : 2250441 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_163 2267205 : 2270122 3 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_164 2278751 : 2280683 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_165 2330240 : 2331836 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_166 2340279 : 2341088 2 Hokovirus(50.0%) NA NA
DBSCAN-SWA_167 2367142 : 2368174 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_168 2383858 : 2397316 11 uncultured_Mediterranean_phage(28.57%) NA NA
DBSCAN-SWA_169 2414930 : 2418980 4 Dickeya_phage(50.0%) NA NA
DBSCAN-SWA_170 2426382 : 2427384 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_171 2433846 : 2434953 1 Tupanvirus(100.0%) tRNA NA
DBSCAN-SWA_172 2438288 : 2439344 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_173 2443471 : 2446579 4 Agrobacterium_phage(50.0%) NA NA
DBSCAN-SWA_174 2454123 : 2456659 3 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_175 2465822 : 2466365 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_176 2473317 : 2476804 4 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_177 2482819 : 2489339 7 Halovirus(33.33%) NA NA
DBSCAN-SWA_178 2504874 : 2510880 5 Bacillus_virus(66.67%) tRNA NA
DBSCAN-SWA_179 2516298 : 2517504 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_180 2524535 : 2525846 1 Klosneuvirus(100.0%) tRNA NA
DBSCAN-SWA_181 2534360 : 2541919 6 Orpheovirus(25.0%) NA NA
DBSCAN-SWA_182 2560215 : 2562204 1 Tupanvirus(100.0%) tRNA NA
DBSCAN-SWA_183 2578324 : 2579767 1 Aeromonas_phage(100.0%) NA NA
DBSCAN-SWA_184 2588564 : 2589608 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_185 2594977 : 2602080 6 Acinetobacter_phage(66.67%) NA NA
DBSCAN-SWA_186 2616761 : 2617277 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_187 2624629 : 2631208 6 Mycobacterium_phage(33.33%) NA NA
DBSCAN-SWA_188 2637368 : 2640745 3 Mycoplasma_phage(50.0%) NA NA
DBSCAN-SWA_189 2683162 : 2685205 2 Hokovirus(50.0%) NA NA
DBSCAN-SWA_190 2689611 : 2690277 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_191 2696466 : 2697444 1 Shigella_phage(100.0%) NA NA
DBSCAN-SWA_192 2702578 : 2703520 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_193 2708069 : 2712807 3 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_194 2724929 : 2730356 4 Ectocarpus_siliculosus_virus(33.33%) NA NA
DBSCAN-SWA_195 2740471 : 2743375 2 Wolbachia_phage(50.0%) NA NA
DBSCAN-SWA_196 2760106 : 2761474 1 Mollivirus(100.0%) NA NA
DBSCAN-SWA_197 2772891 : 2774013 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_198 2777054 : 2779064 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_199 2782548 : 2784123 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_200 2789871 : 2791314 1 Pithovirus(100.0%) NA NA
DBSCAN-SWA_201 2800248 : 2801817 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_202 2807579 : 2808875 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_203 2820335 : 2824689 5 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_204 2851190 : 2852588 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_205 2897278 : 2900802 5 Pandoravirus(33.33%) NA NA
DBSCAN-SWA_206 2914826 : 2919064 2 Gordonia_phage(100.0%) NA NA
DBSCAN-SWA_207 2938933 : 2942476 6 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_208 2949375 : 2950125 1 Stenotrophomonas_phage(100.0%) NA NA
DBSCAN-SWA_209 2960869 : 2961268 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_210 2965112 : 2967999 2 Pandoravirus(50.0%) NA NA
DBSCAN-SWA_211 2976432 : 2976801 1 Virus_Rctr197k(100.0%) NA NA
DBSCAN-SWA_212 2982804 : 2985182 2 Mycobacterium_phage(50.0%) holin NA
DBSCAN-SWA_213 2991441 : 2992767 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_214 3006205 : 3017685 7 Bacillus_phage(75.0%) NA NA
DBSCAN-SWA_215 3047480 : 3050294 3 Acinetobacter_phage(50.0%) NA NA
DBSCAN-SWA_216 3054704 : 3062851 9 Klosneuvirus(33.33%) NA NA
DBSCAN-SWA_217 3070972 : 3072481 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_218 3097116 : 3098684 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_219 3113110 : 3117007 3 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_220 3127498 : 3127756 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_221 3130836 : 3131277 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_222 3135470 : 3140479 4 Cryptophlebia_leucotreta_granulosis_virus(50.0%) NA NA
DBSCAN-SWA_223 3143542 : 3144733 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_224 3148639 : 3149707 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_225 3154519 : 3155131 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_226 3165139 : 3165628 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_227 3198635 : 3202543 3 Erysipelothrix_phage(66.67%) NA NA
DBSCAN-SWA_228 3208245 : 3209898 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_229 3223437 : 3225284 2 Streptomyces_phage(50.0%) NA NA
DBSCAN-SWA_230 3229198 : 3230743 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_231 3241885 : 3244627 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_232 3254449 : 3255580 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_233 3273018 : 3274590 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_234 3283575 : 3284571 1 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_235 3287736 : 3289998 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_236 3297054 : 3302225 3 Escherichia_virus(50.0%) NA NA
DBSCAN-SWA_237 3307896 : 3318117 9 Streptomyces_phage(25.0%) NA NA
DBSCAN-SWA_238 3324864 : 3325845 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_239 3332456 : 3338666 5 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_240 3358847 : 3363905 6 uncultured_Mediterranean_phage(33.33%) NA NA
DBSCAN-SWA_241 3372110 : 3375284 1 Tupanvirus(100.0%) tRNA NA
DBSCAN-SWA_242 3380809 : 3383766 3 Streptomyces_phage(50.0%) NA NA
DBSCAN-SWA_243 3387169 : 3388450 1 Tupanvirus(100.0%) tRNA NA
DBSCAN-SWA_244 3396595 : 3400202 2 Acanthocystis_turfacea_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_245 3404311 : 3405607 1 Rhizobium_phage(100.0%) NA NA
DBSCAN-SWA_246 3409957 : 3410245 1 Gordonia_phage(100.0%) NA NA
DBSCAN-SWA_247 3425910 : 3427149 1 Gordonia_phage(100.0%) NA NA
DBSCAN-SWA_248 3442885 : 3444079 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_249 3447285 : 3448998 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_250 3454895 : 3462186 6 Streptomyces_phage(25.0%) NA NA
DBSCAN-SWA_251 3473736 : 3476190 3 Paramecium_bursaria_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_252 3487451 : 3488609 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_253 3495102 : 3496452 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_254 3512890 : 3516725 4 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_255 3525669 : 3526950 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_256 3550639 : 3556048 1 Leptospira_phage(100.0%) NA NA
DBSCAN-SWA_257 3572988 : 3583509 8 Acinetobacter_phage(25.0%) NA NA
DBSCAN-SWA_258 3602500 : 3603535 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_259 3607629 : 3609096 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_260 3612499 : 3616441 5 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_261 3628086 : 3631405 4 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_262 3645372 : 3647067 1 Phormidium_phage(100.0%) NA NA
DBSCAN-SWA_263 3652052 : 3671056 6 uncultured_Mediterranean_phage(80.0%) NA NA
DBSCAN-SWA_264 3680666 : 3681740 1 Wolbachia_phage(100.0%) NA NA
DBSCAN-SWA_265 3685288 : 3690820 5 uncultured_virus(50.0%) NA NA
DBSCAN-SWA_266 3701253 : 3703605 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_267 3707487 : 3711716 4 Moraxella_phage(50.0%) NA NA
DBSCAN-SWA_268 3729107 : 3729821 1 Pithovirus(100.0%) NA NA
DBSCAN-SWA_269 3733699 : 3735340 1 Klosneuvirus(100.0%) holin NA
DBSCAN-SWA_270 3753271 : 3754648 1 Moumouvirus(100.0%) tRNA NA
DBSCAN-SWA_271 3757718 : 3759290 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_272 3784099 : 3787964 4 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_273 3812375 : 3813899 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_274 3831764 : 3832538 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_275 3844978 : 3846470 2 Anomala_cuprea_entomopoxvirus(50.0%) NA NA
DBSCAN-SWA_276 3886888 : 3888328 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_277 3893928 : 3896877 3 Tupanvirus(33.33%) NA NA
DBSCAN-SWA_278 3900718 : 3915130 16 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_279 3936327 : 3946997 12 Bacillus_phage(25.0%) NA NA
DBSCAN-SWA_280 3956892 : 3970188 10 Cedratvirus(20.0%) NA NA
DBSCAN-SWA_281 3974616 : 3976425 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_282 3984111 : 3985467 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_283 3999737 : 4001369 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_284 4007549 : 4008746 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_285 4012420 : 4015743 4 Staphylococcus_phage(66.67%) NA NA
DBSCAN-SWA_286 4024482 : 4033730 9 Enterobacteria_phage(25.0%) protease NA
DBSCAN-SWA_287 4037362 : 4041435 5 Synechococcus_phage(66.67%) NA NA
DBSCAN-SWA_288 4054543 : 4057487 2 Gordonia_phage(50.0%) NA NA
DBSCAN-SWA_289 4060929 : 4062024 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_290 4069238 : 4070201 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_291 4078256 : 4079081 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_292 4082759 : 4089774 6 Pneumococcus_phage(25.0%) tRNA,protease NA
DBSCAN-SWA_293 4094510 : 4098305 3 Cedratvirus(50.0%) tRNA NA
DBSCAN-SWA_294 4109621 : 4126316 13 Vibrio_phage(16.67%) NA NA
DBSCAN-SWA_295 4134406 : 4135219 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_296 4155862 : 4156495 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_297 4168514 : 4171223 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_298 4177212 : 4179504 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_299 4191655 : 4192768 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_300 4200093 : 4202079 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_301 4205386 : 4206655 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_302 4222035 : 4225460 3 Mycobacterium_phage(50.0%) NA NA
DBSCAN-SWA_303 4232270 : 4237586 5 Bacteriophage(50.0%) NA NA
DBSCAN-SWA_304 4244194 : 4255385 5 Klebsiella_phage(66.67%) NA NA
DBSCAN-SWA_305 4271571 : 4276287 2 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_306 4280894 : 4281326 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_307 4289143 : 4290622 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_308 4300588 : 4301284 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_309 4314649 : 4319829 2 Brevibacillus_phage(50.0%) NA NA
DBSCAN-SWA_310 4328577 : 4329744 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_311 4369184 : 4372127 2 Tupanvirus(50.0%) tRNA NA
DBSCAN-SWA_312 4376945 : 4379437 2 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_313 4384985 : 4386620 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_314 4403010 : 4403733 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_315 4414757 : 4417057 3 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_316 4425559 : 4426339 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_317 4441620 : 4443105 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_318 4448193 : 4449300 1 Yellowstone_lake_mimivirus(100.0%) NA NA
DBSCAN-SWA_319 4454972 : 4455722 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_320 4461462 : 4462809 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_321 4490332 : 4495219 4 Catovirus(50.0%) NA NA
DBSCAN-SWA_322 4509257 : 4511189 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_323 4516057 : 4517155 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_324 4543284 : 4544652 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_325 4547866 : 4548280 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_326 4552585 : 4554458 3 Arthrobacter_phage(50.0%) NA NA
DBSCAN-SWA_327 4572672 : 4573761 1 Stenotrophomonas_phage(100.0%) NA NA
DBSCAN-SWA_328 4577453 : 4578983 1 Mycobacterium_phage(100.0%) tRNA NA
DBSCAN-SWA_329 4586552 : 4592860 7 Orpheovirus(25.0%) NA NA
DBSCAN-SWA_330 4598832 : 4607858 6 Arthrobacter_phage(25.0%) NA NA
DBSCAN-SWA_331 4616848 : 4623158 6 Marseillevirus(66.67%) protease NA
DBSCAN-SWA_332 4635354 : 4635834 1 Molluscum_contagiosum_virus(100.0%) NA NA
DBSCAN-SWA_333 4641020 : 4644820 4 Anomala_cuprea_entomopoxvirus(50.0%) NA NA
DBSCAN-SWA_334 4666919 : 4669699 2 Klosneuvirus(50.0%) holin NA
DBSCAN-SWA_335 4672880 : 4674491 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_336 4686035 : 4688015 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_337 4692241 : 4704028 11 Diadromus_pulchellus_ascovirus(20.0%) NA NA
DBSCAN-SWA_338 4724867 : 4725530 1 Enterococcus_phage(100.0%) NA NA
DBSCAN-SWA_339 4743012 : 4748629 5 Acinetobacter_phage(25.0%) NA NA
DBSCAN-SWA_340 4774838 : 4775753 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_341 4779037 : 4781059 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_342 4786213 : 4787554 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_343 4793832 : 4795308 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_344 4800353 : 4801178 1 Gordonia_phage(100.0%) NA NA
DBSCAN-SWA_345 4827689 : 4829324 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_346 4846371 : 4846962 1 Saccharomonospora_phage(100.0%) NA NA
DBSCAN-SWA_347 4882080 : 4883625 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_348 4911908 : 4917679 6 Mollivirus(33.33%) NA NA
DBSCAN-SWA_349 4928914 : 4934470 5 Bodo_saltans_virus(50.0%) NA NA
DBSCAN-SWA_350 4951704 : 4957472 4 Bacillus_virus(33.33%) NA NA
DBSCAN-SWA_351 4963472 : 4966368 3 Mollivirus(50.0%) NA NA
DBSCAN-SWA_352 4972024 : 4977325 4 Mycobacterium_phage(50.0%) NA NA
DBSCAN-SWA_353 4980711 : 4982757 2 Brazilian_cedratvirus(50.0%) NA NA
DBSCAN-SWA_354 4989408 : 4994518 4 Enterococcus_phage(25.0%) NA NA
DBSCAN-SWA_355 4999519 : 5000509 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_356 5005149 : 5005959 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_357 5026599 : 5027667 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_358 5040931 : 5042725 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_359 5093782 : 5094754 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_360 5102960 : 5108947 5 Cedratvirus(50.0%) NA NA
DBSCAN-SWA_361 5114077 : 5115064 1 Moumouvirus(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage